Skip to Main Content
Table 1.

Oligonucleotide primer sequences for the p53 gene amplification and sequencing

ExonPrimers for gene amplificationSize (bp)Primers for sequencing
Exon-4 S 5′TCCCCCTTGCCGTCCCAA3′ 279 S 5′TCCCCCTTGCCGTCCCAA3′ 
 A 5′CGTGCAAGTCACAGACTT3′  A 5′CGTGCAAGTCACAGACTT3′ 
Exon-5 S 5′TTTCAACTCTGTCTCCTTCCT3′ 229 S 5′CCTTCCTCTTCCTGGAGTAC3′ 
 A 5′GCCCCCAGCTGCTCACCATC3′  A 5′AGCTGCTCACCATCGCTATC3′ 
Exon-6 S 5′CACTGATTGCTCTTAGGTCTG3′ 144 S 5′TCTTAGGTCTGGCCCCTCCT3′ 
 A 5′AGTTGCAAACCAGACCTCAG3′  A 5′ACCAGACCTCAGGCGGCTCA3′ 
Exon-7 S 5′GTGTTGTCTCCTAGGTTGGC3′ 150 S 5′CCTAGGTTGGCTCTGACTGT3′ 
 A 5′TGTGCAGGGTGGCAAGTGGC3′  A 5′GGGTGGCAAGTGGCTCCTGA3′ 
Exons 8-9 S 5′CCTATCCTGAGTAGTGGTAA3′ 346 S 5′TGGTAATCTACTGGGAGCAG3′ 
 A 5′ACTTGATAAGAGGTCCCAAG3′  A 5′CCCAAGACTTAGTACCTGAA3′ 
ExonPrimers for gene amplificationSize (bp)Primers for sequencing
Exon-4 S 5′TCCCCCTTGCCGTCCCAA3′ 279 S 5′TCCCCCTTGCCGTCCCAA3′ 
 A 5′CGTGCAAGTCACAGACTT3′  A 5′CGTGCAAGTCACAGACTT3′ 
Exon-5 S 5′TTTCAACTCTGTCTCCTTCCT3′ 229 S 5′CCTTCCTCTTCCTGGAGTAC3′ 
 A 5′GCCCCCAGCTGCTCACCATC3′  A 5′AGCTGCTCACCATCGCTATC3′ 
Exon-6 S 5′CACTGATTGCTCTTAGGTCTG3′ 144 S 5′TCTTAGGTCTGGCCCCTCCT3′ 
 A 5′AGTTGCAAACCAGACCTCAG3′  A 5′ACCAGACCTCAGGCGGCTCA3′ 
Exon-7 S 5′GTGTTGTCTCCTAGGTTGGC3′ 150 S 5′CCTAGGTTGGCTCTGACTGT3′ 
 A 5′TGTGCAGGGTGGCAAGTGGC3′  A 5′GGGTGGCAAGTGGCTCCTGA3′ 
Exons 8-9 S 5′CCTATCCTGAGTAGTGGTAA3′ 346 S 5′TGGTAATCTACTGGGAGCAG3′ 
 A 5′ACTTGATAAGAGGTCCCAAG3′  A 5′CCCAAGACTTAGTACCTGAA3′ 

Abbreviations: S, sense primer; A, antisense primer.

Close Modal

or Create an Account

Close Modal
Close Modal