Skip to Main Content
Table 1.

Genes differentially expressed between samples of lung adenocarcinoma and mesothelioma and not expressed in normal mesothelial cells

Gene (GenBank accession no.)Primers (5′ > 3′)Product size (bp)Affymetrix fold change (log2)Real-time fold change (log2)
SFTP3 (NM_000542) FWD: TTTGTGGAGCAGCACACG 115 7.67 10.7 
 REV: TACACTGGAGAGGGCTGGAC    
CEACAM6 (M18728) FWD: ATGAAGAAGCAACCGGACAG 97 6.64 10.4 
 REV: ACAGCATCCTTGTCCTCCAC    
WFDC2 (X63187) FWD: CCGACAACCTCAAGTGCTG 105 4.61 3.59 
 REV: CGAGCTGGGGAAAGTTAATG    
AGR2 (AF038451) FWD: CGAACCTGCAGATACAGCTC 105 4.48 7.40 
 REV: GACAGACAGAAGGGCTTGGA    
CLDN7 (AJ011497) FWD: CAAAATGTACGACTCGGTGCT 100 4.07 4.33 
 REV: CACAAACATGGCCAGGAAG    
CLDN3 (NM_001306) FWD: AACATCATCACGTCGCAGAA 98 4.07 5.33 
 REV: AGCAGCGAGTCGTACACCTT    
ERBB3 (NM_001982) FWD: GATGGGGAACCTTGAGATTG 91 3.80 4.41 
 REV: CACGAGGACATAGCCTGTCA    
FLJ12443 (AF052162) FWD: CCTCGCACTTGTCGCATC 96 3.16 2.32 
 REV: ATGGCCTTCAGCAGGAAGT    
XMP (U52100) FWD: CTGCAGCCTTGCTGTTCAT 103 2.67 3.73 
 REV: GTGCAATTCGTGTTGTTGGT    
LAD (U42408) FWD: CTTCAGACCCTCCGACTGTG 102 2.36 1.90 
 REV: GCTGTGTGGGTGAGGACATA    
SPINT1 (BT007425) FWD: CTCACGAGGGAAGTGTACCG 93 1.67 1.59 
 REV: GGTTCCTGGGGTTGTACCTT    
GAS6 (NM_000820) FWD: CCTCTCTCTGTGGCACTGGT 112 −2.27 −1.06 
 REV: CGCAGACCTTGATCTCCATT    
SEMA3C (AB000220) FWD: CAGCCCCAAGCAAGAGTTTA 89 −4.12 −2.50 
 REV: TCTAAAGGATGGTGGGAAAGG    
KIBRA (AB020676) FWD: AAGCGGCTGGAAAAGGAC 114 −2.41 −1.09 
 REV: GGCTTCCTCCAGTTCTCTCA    
GFPT2 (NM_005110) FWD: AGGCCGTGGAATTCTTCTTT 110 −3.47 −2.86 
 REV: GAGTTTCCCATCAGCCACTG    
S1-5 (EFEMP1) (NM_004105) FWD: GCTAAGCAGTGACAGGCTCA 93 −4.12 −3.37 
 REV: TTCCCAGGTTCATTGACACA    
RALDH2 (AB015226) FWD: GTAGTGGGGAGTCCCTTTGA 97 −4.53 −5.75 
 REV: CCACACCACTCTGGATGAGTT    
Gene (GenBank accession no.)Primers (5′ > 3′)Product size (bp)Affymetrix fold change (log2)Real-time fold change (log2)
SFTP3 (NM_000542) FWD: TTTGTGGAGCAGCACACG 115 7.67 10.7 
 REV: TACACTGGAGAGGGCTGGAC    
CEACAM6 (M18728) FWD: ATGAAGAAGCAACCGGACAG 97 6.64 10.4 
 REV: ACAGCATCCTTGTCCTCCAC    
WFDC2 (X63187) FWD: CCGACAACCTCAAGTGCTG 105 4.61 3.59 
 REV: CGAGCTGGGGAAAGTTAATG    
AGR2 (AF038451) FWD: CGAACCTGCAGATACAGCTC 105 4.48 7.40 
 REV: GACAGACAGAAGGGCTTGGA    
CLDN7 (AJ011497) FWD: CAAAATGTACGACTCGGTGCT 100 4.07 4.33 
 REV: CACAAACATGGCCAGGAAG    
CLDN3 (NM_001306) FWD: AACATCATCACGTCGCAGAA 98 4.07 5.33 
 REV: AGCAGCGAGTCGTACACCTT    
ERBB3 (NM_001982) FWD: GATGGGGAACCTTGAGATTG 91 3.80 4.41 
 REV: CACGAGGACATAGCCTGTCA    
FLJ12443 (AF052162) FWD: CCTCGCACTTGTCGCATC 96 3.16 2.32 
 REV: ATGGCCTTCAGCAGGAAGT    
XMP (U52100) FWD: CTGCAGCCTTGCTGTTCAT 103 2.67 3.73 
 REV: GTGCAATTCGTGTTGTTGGT    
LAD (U42408) FWD: CTTCAGACCCTCCGACTGTG 102 2.36 1.90 
 REV: GCTGTGTGGGTGAGGACATA    
SPINT1 (BT007425) FWD: CTCACGAGGGAAGTGTACCG 93 1.67 1.59 
 REV: GGTTCCTGGGGTTGTACCTT    
GAS6 (NM_000820) FWD: CCTCTCTCTGTGGCACTGGT 112 −2.27 −1.06 
 REV: CGCAGACCTTGATCTCCATT    
SEMA3C (AB000220) FWD: CAGCCCCAAGCAAGAGTTTA 89 −4.12 −2.50 
 REV: TCTAAAGGATGGTGGGAAAGG    
KIBRA (AB020676) FWD: AAGCGGCTGGAAAAGGAC 114 −2.41 −1.09 
 REV: GGCTTCCTCCAGTTCTCTCA    
GFPT2 (NM_005110) FWD: AGGCCGTGGAATTCTTCTTT 110 −3.47 −2.86 
 REV: GAGTTTCCCATCAGCCACTG    
S1-5 (EFEMP1) (NM_004105) FWD: GCTAAGCAGTGACAGGCTCA 93 −4.12 −3.37 
 REV: TTCCCAGGTTCATTGACACA    
RALDH2 (AB015226) FWD: GTAGTGGGGAGTCCCTTTGA 97 −4.53 −5.75 
 REV: CCACACCACTCTGGATGAGTT    

NOTE: The primers used for quantitative RT-PCR analysis and the expected product sizes are shown. Log2-transformed fold change in median expression in lung adenocarcinoma relative to malignant mesothelioma for both Affymetrix U95A and quantitative RT-PCR are given. Gene expression levels were normalized relative to GAPDH probesets (Affymetrix data) or to quantitative RT-PCR controls.

Close Modal

or Create an Account

Close Modal
Close Modal