Skip to Main Content
Table 1.

Sequences of PCR primers and probes

Cyclooxygenase-2 (COX-2)  
    Forward primer (COX2-633F) 5′-GCTCAAACATGATGTTTGCATTC-3′ 
    Reverse primer (COX2-711R) 5′-GCTGGCCTCGCTTATGA-3′ 
    Probe (COX2-658T) 5′-(FAM)TGCCCAGCACTTCACGCATCAGTT(TAMRA)-3′ 
β-Actin  
    Forward primer (b-actin-592F) 5′-TGAGCGGGCTACAGCTT-3′ 
    Reverse primer (b-actin-651R) 5′-TCCTTAATGTCACGCACGATTT-3′ 
    Probe (b-actin-611T) 5′-(FAM)ACCACCACGGCCGAGCGG(TAMRA)-3′ 
Cyclooxygenase-2 (COX-2)  
    Forward primer (COX2-633F) 5′-GCTCAAACATGATGTTTGCATTC-3′ 
    Reverse primer (COX2-711R) 5′-GCTGGCCTCGCTTATGA-3′ 
    Probe (COX2-658T) 5′-(FAM)TGCCCAGCACTTCACGCATCAGTT(TAMRA)-3′ 
β-Actin  
    Forward primer (b-actin-592F) 5′-TGAGCGGGCTACAGCTT-3′ 
    Reverse primer (b-actin-651R) 5′-TCCTTAATGTCACGCACGATTT-3′ 
    Probe (b-actin-611T) 5′-(FAM)ACCACCACGGCCGAGCGG(TAMRA)-3′ 
Close Modal

or Create an Account

Close Modal
Close Modal