Skip to Main Content
Table 1

Sequences of antisense oligonucleotides used in this study

OligomerLengthSequence (5′-3′)aComments
G3139 18 TCTCCCAGCGTGCGCCAT Phosphorothioate, targeted to bcl-2 initiation codon 
G4126 18 TCTCCCAGCATGTGCCAT Phosphorothioate, G3139 variant with single base mismatch at each CpG motif 
2009 20 AATCCTCCCCCAGTTCACCC Phosphorothioate, no CpG motifs, targeted to bcl-2 coding region 
G4232 18 TCTCCCAGCbGTGCbGCCAT Phosphorothioate, G3139 variant with cytosine C5-methyl at each CpG 
OligomerLengthSequence (5′-3′)aComments
G3139 18 TCTCCCAGCGTGCGCCAT Phosphorothioate, targeted to bcl-2 initiation codon 
G4126 18 TCTCCCAGCATGTGCCAT Phosphorothioate, G3139 variant with single base mismatch at each CpG motif 
2009 20 AATCCTCCCCCAGTTCACCC Phosphorothioate, no CpG motifs, targeted to bcl-2 coding region 
G4232 18 TCTCCCAGCbGTGCbGCCAT Phosphorothioate, G3139 variant with cytosine C5-methyl at each CpG 
a

Bold italic represent mismatched bases.

b

5-methyl-deoxycytidine.

Close Modal

or Create an Account

Close Modal
Close Modal