American Association for Cancer Research

Skip to Main Content

Table 1

Sequences of antisense oligonucleotides used in this study

Oligomer	Length	Sequence (5′-3′)^a	Comments
G3139	18	TCTCCCAGCGTGCGCCAT	Phosphorothioate, targeted to bcl-2 initiation codon
G4126	18	TCTCCCAGCATGTGCCAT	Phosphorothioate, G3139 variant with single base mismatch at each CpG motif
2009	20	AATCCTCCCCCAGTTCACCC	Phosphorothioate, no CpG motifs, targeted to bcl-2 coding region
G4232	18	TCTCCCAGC^bGTGC^bGCCAT	Phosphorothioate, G3139 variant with cytosine C5-methyl at each CpG

Oligomer	Length	Sequence (5′-3′)^a	Comments
G3139	18	TCTCCCAGCGTGCGCCAT	Phosphorothioate, targeted to bcl-2 initiation codon
G4126	18	TCTCCCAGCATGTGCCAT	Phosphorothioate, G3139 variant with single base mismatch at each CpG motif
2009	20	AATCCTCCCCCAGTTCACCC	Phosphorothioate, no CpG motifs, targeted to bcl-2 coding region
G4232	18	TCTCCCAGC^bGTGC^bGCCAT	Phosphorothioate, G3139 variant with cytosine C5-methyl at each CpG

^a

Bold italic represent mismatched bases.

^b

5-methyl-deoxycytidine.