Skip to Main Content
Table 2

Sequences of primers, probe, and calibration oligonucleotide

Intron-spanning primers Forward Exon 2 5′-GCGTGGACAATGGCTACTCA-3′ 
 Reverse Exon 3 5′-CCGCTTTTCTGTCTGGTTCC-3′ 
Dual-labelled fluorescent probe  Exon 3 5′-(FAMa)TGATTTGATGGAGTTGGACATGGCCA (TAMRAb)-3′ 
Oligonucleotide for calibration   5′-ATCCAGCGTGGACAATGGCTACTCAAGCTGA TTTGATGGAGTTGGACATGGCCATGGAACCA GACAGAAAAGCGCTGTT-3′ 
Intron-spanning primers Forward Exon 2 5′-GCGTGGACAATGGCTACTCA-3′ 
 Reverse Exon 3 5′-CCGCTTTTCTGTCTGGTTCC-3′ 
Dual-labelled fluorescent probe  Exon 3 5′-(FAMa)TGATTTGATGGAGTTGGACATGGCCA (TAMRAb)-3′ 
Oligonucleotide for calibration   5′-ATCCAGCGTGGACAATGGCTACTCAAGCTGA TTTGATGGAGTTGGACATGGCCATGGAACCA GACAGAAAAGCGCTGTT-3′ 
a

6-carboxyfluorescein.

b

6-carboxytetramethylrhodamine.

Close Modal

or Create an Account

Close Modal
Close Modal