Skip to Main Content
Table 2.

MSI analysis of invasive intestinal adenocarcinomas with mononucleotide repeats

GenotypeMouse IDAge (d)Sample pairChange in allele size (bp)
D1Mit79mBat-24mBat-26mBat-27*mBat-37mBat-59mBat-64mBat-67
B6 Mlh1−/− 4934 269 −2 −3 −2 −3, −7 −7, −11 −6, −12 
(BR × B6)F1ApcMin/+ 1851 362 
 2012 297 ND 
 2056 232 
(SWR × B6)F1ApcMin/+ 2058 530 
 2079 536 −24 
   ND 
 2217 520 −25, −34, −40 
   
 2232 517 10 ND 
   11 ND 
 1840 601 12 −22, −38 
 1888 591 13 −30 
 1902 595 14 −21 
 1904 595 15 ND 
 2000 571 16 −38 
 2001 571 17 
 2221 533 18 −25 −15, −26, −35 
   19 ND ND 
 2223 533 20 −27, −37 
   21 −12, −20 
 1986 579 22 −12, −24, −33 
 1885 604 23 −18 
 1898 609 24 −26 
 2041 578 25 
 2047 577 26 ND −21 
GenotypeMouse IDAge (d)Sample pairChange in allele size (bp)
D1Mit79mBat-24mBat-26mBat-27*mBat-37mBat-59mBat-64mBat-67
B6 Mlh1−/− 4934 269 −2 −3 −2 −3, −7 −7, −11 −6, −12 
(BR × B6)F1ApcMin/+ 1851 362 
 2012 297 ND 
 2056 232 
(SWR × B6)F1ApcMin/+ 2058 530 
 2079 536 −24 
   ND 
 2217 520 −25, −34, −40 
   
 2232 517 10 ND 
   11 ND 
 1840 601 12 −22, −38 
 1888 591 13 −30 
 1902 595 14 −21 
 1904 595 15 ND 
 2000 571 16 −38 
 2001 571 17 
 2221 533 18 −25 −15, −26, −35 
   19 ND ND 
 2223 533 20 −27, −37 
   21 −12, −20 
 1986 579 22 −12, −24, −33 
 1885 604 23 −18 
 1898 609 24 −26 
 2041 578 25 
 2047 577 26 ND −21 
*

mBat-27 (accession no. L24372) primer sequences were GGGAAGACTGCTTAGGGAAGA and ATTTGGCTTTCAAGCATCCATA (48). The other microsatellite markers were described previously (17).

Close Modal

or Create an Account

Close Modal
Close Modal