Skip to Main Content
Table 2

Primer sequences for candidate normalization genes

SymbolForward primerReverse primerAmplicon sizeIntron spanning
FLOT2 TGCCGTGGTGCAGAGAGA GGTGTCTGCCATGAACTTCACA 115 Yes 
ATP5B TCACCCAGGCTGGTTCAGA AGTGGCCAGGGTAGGCTGAT 80 Yes 
HSPCB AAGAGAGCAAGGCAAAGTTTGAG TGGTCACAATGCAGCAAGGT 120 Yes 
S100A6 ACAAGCACACCCTGAGCAAGA CCATCAGCCTTGCAATTTCA 99 Yes 
TEGT TGCTGGATTTGCATTCCTTACA ACGGCGCCTGGCATAGA 151 Yes 
CFL1 GAAGGAGGATCTGGTGTTTATCTTCT GCTGGCATAAATCATTTTGCTCTT 73 Yes 
FLJ20030 GGCTTTGGACTTGCAGAATGTT ATAATGTAGTGTGTTACTAGTTGTCCTTTTCTC 144 Yes 
TPT1 GATCGCGGACGGGTTGT TTCAGCGGAGGCATTTCC 100 Yes 
UBB GGGCGGTTGGCTTTGTT GACCTGTTAGCGGATACCAGGAT 91 Yes 
UBC GATTTGGGTCGCGGTTCTT TGCCTTGACATTCTCGATGGT 134 Yes 
RPS13 CGAAAGCATCTTGAGAGGAACA TCGAGCCAAACGGTGAATC 87 Yes 
RPS23 TGGAGGTGCTTCTCATGCAA AATGGCAGAATTTGGCTGTTTG 76 Yes 
GAPD TCTCCTCTGACTTCAACAGCGAC CCCTGTTGCTGTAGCCAAATTC 126 Yes 
ACTB GCCCTGAGGCACTCTTCCA CGGATGTCCACGTCACACTTC 100 Yes 
CLTC TCGCTACCTGGTACGTCGAAA GCCTTTACAGTTACTGACACTTCTTCAG 150 Yes 
NACA GCAAAACAGAGTCGGAGTGAAAA GTAACTCCTGTAACCTGCCGAAGA 77 Yes 
SUI1 CAGGGTGACCAACGCAAGA CACAAGCACTTAAAACCCATGAAC 96 Yes 
TUBA6 GCAGACCCCTTCAAGTTCTAGTCA GTAGAGCTCCCAGCAGGCATT 95 Yes 
SymbolForward primerReverse primerAmplicon sizeIntron spanning
FLOT2 TGCCGTGGTGCAGAGAGA GGTGTCTGCCATGAACTTCACA 115 Yes 
ATP5B TCACCCAGGCTGGTTCAGA AGTGGCCAGGGTAGGCTGAT 80 Yes 
HSPCB AAGAGAGCAAGGCAAAGTTTGAG TGGTCACAATGCAGCAAGGT 120 Yes 
S100A6 ACAAGCACACCCTGAGCAAGA CCATCAGCCTTGCAATTTCA 99 Yes 
TEGT TGCTGGATTTGCATTCCTTACA ACGGCGCCTGGCATAGA 151 Yes 
CFL1 GAAGGAGGATCTGGTGTTTATCTTCT GCTGGCATAAATCATTTTGCTCTT 73 Yes 
FLJ20030 GGCTTTGGACTTGCAGAATGTT ATAATGTAGTGTGTTACTAGTTGTCCTTTTCTC 144 Yes 
TPT1 GATCGCGGACGGGTTGT TTCAGCGGAGGCATTTCC 100 Yes 
UBB GGGCGGTTGGCTTTGTT GACCTGTTAGCGGATACCAGGAT 91 Yes 
UBC GATTTGGGTCGCGGTTCTT TGCCTTGACATTCTCGATGGT 134 Yes 
RPS13 CGAAAGCATCTTGAGAGGAACA TCGAGCCAAACGGTGAATC 87 Yes 
RPS23 TGGAGGTGCTTCTCATGCAA AATGGCAGAATTTGGCTGTTTG 76 Yes 
GAPD TCTCCTCTGACTTCAACAGCGAC CCCTGTTGCTGTAGCCAAATTC 126 Yes 
ACTB GCCCTGAGGCACTCTTCCA CGGATGTCCACGTCACACTTC 100 Yes 
CLTC TCGCTACCTGGTACGTCGAAA GCCTTTACAGTTACTGACACTTCTTCAG 150 Yes 
NACA GCAAAACAGAGTCGGAGTGAAAA GTAACTCCTGTAACCTGCCGAAGA 77 Yes 
SUI1 CAGGGTGACCAACGCAAGA CACAAGCACTTAAAACCCATGAAC 96 Yes 
TUBA6 GCAGACCCCTTCAAGTTCTAGTCA GTAGAGCTCCCAGCAGGCATT 95 Yes 
Close Modal

or Create an Account

Close Modal
Close Modal