Skip to Main Content
Table 1

List of primers, annealing temperatures, and product sizes for methylation-specific PCR and RT-PCR

GeneChromosome locationForward primer (5′–3′)Reverse primer (5′–3′)Annealing temperature (°C)Product size (bp)
Methylation-specific PCRa      
  N: TTAAG(C/T)TTTGTGAGAATTTTG CCTATAATTAATCCAAATAATCATTTA CC 53 425 
RARβ 3p24 U: TTGAGAATGTGAGTGATTTGA AACCAATCCAACCAAAACAA 62 146 
  M: TCGAGAACGCGAGCGATTCG GACCAATCCAACCGAAACGA 62 146 
  N: GGATATGTTG GGATAGTT CCAAAAACCCCAAACCC 52 289 
MGMT 10q26 U: TTTGTGTTTTGATGTTTGTAGGTTTTTGT AACTCCACACTCTTCCAAAAACAAAACA 59 93 
  M: TTTCGACGTTCGTAGGTTTTCGC GCACTCTTCCGAAAACGAAACG 59 81 
  N: GGAGAGGGGGAGAGTAGGT CTACAAACCCTCTACCCACCT 60 208 
P16 9p21 U: TGGGGAGTAGTATGGAGTTGGTGGT CAACCCCAAACCACAACCATAA 62 81 
  M: CGGGGAGTAGTATGGAGTCGGCGGC GACCCCGAACCGCGACCGTAA 62 81 
  N: GGTATTTTTGTTTTTATTGGTTGGAT AATACCAATCAAATTTCTCAACTCCT 55 185 
hMLH1 3p22 U: TAAAAATGAATTAATAGGAAGAGT CTCTATAAATTACTAAATCTCTTCA 60 117 
  M: TAAAAACGAATTAATAGGAAGAGC CTCTATAAATTACTAAATCTCTTCG 60 117 
RT-PCR      
RARβ  GACTGTATGGATGTTCTGTCAG ATTTGTCCTGGCAGACGAAGCA 60 256 
MGMT  AAAATGGACAAGGATTGTGAAA CATCCGATGCAGTGTTACACG 57 568 
P16  CGGAAGGTCCCTCAGACATC TCATGAAGTCGACAGCTTCCG 60 385 
hMLH1  CAGCGGCCAGCTAATGCTAT AATCCTCAAAGGACTGCAGTT 60 195 
DNMT1  ACCAAGCAAGAAGTGAAGCC GCTTCCTGCAGAAGAACCTG 60 336 
DNMT3a  CACACAGAAGCATATCCAGGAGTG AGTGGAAACCAAATACCC 60 550 
DNMT3b  AATGTGAATCCAGCCAGGAAAGGC ACTGGATTACACTCCAGGAACCGT 60 191 
MBD2  AACCCTGCTGTTTGGCTTAAC CGTACTTGCTGTACTCGCTCTTC 60 101 
G3DPH  TTGCAACTGTTTTAGGACTTT AGCATTGGGAAATGTTCAAGG 60 983 
GeneChromosome locationForward primer (5′–3′)Reverse primer (5′–3′)Annealing temperature (°C)Product size (bp)
Methylation-specific PCRa      
  N: TTAAG(C/T)TTTGTGAGAATTTTG CCTATAATTAATCCAAATAATCATTTA CC 53 425 
RARβ 3p24 U: TTGAGAATGTGAGTGATTTGA AACCAATCCAACCAAAACAA 62 146 
  M: TCGAGAACGCGAGCGATTCG GACCAATCCAACCGAAACGA 62 146 
  N: GGATATGTTG GGATAGTT CCAAAAACCCCAAACCC 52 289 
MGMT 10q26 U: TTTGTGTTTTGATGTTTGTAGGTTTTTGT AACTCCACACTCTTCCAAAAACAAAACA 59 93 
  M: TTTCGACGTTCGTAGGTTTTCGC GCACTCTTCCGAAAACGAAACG 59 81 
  N: GGAGAGGGGGAGAGTAGGT CTACAAACCCTCTACCCACCT 60 208 
P16 9p21 U: TGGGGAGTAGTATGGAGTTGGTGGT CAACCCCAAACCACAACCATAA 62 81 
  M: CGGGGAGTAGTATGGAGTCGGCGGC GACCCCGAACCGCGACCGTAA 62 81 
  N: GGTATTTTTGTTTTTATTGGTTGGAT AATACCAATCAAATTTCTCAACTCCT 55 185 
hMLH1 3p22 U: TAAAAATGAATTAATAGGAAGAGT CTCTATAAATTACTAAATCTCTTCA 60 117 
  M: TAAAAACGAATTAATAGGAAGAGC CTCTATAAATTACTAAATCTCTTCG 60 117 
RT-PCR      
RARβ  GACTGTATGGATGTTCTGTCAG ATTTGTCCTGGCAGACGAAGCA 60 256 
MGMT  AAAATGGACAAGGATTGTGAAA CATCCGATGCAGTGTTACACG 57 568 
P16  CGGAAGGTCCCTCAGACATC TCATGAAGTCGACAGCTTCCG 60 385 
hMLH1  CAGCGGCCAGCTAATGCTAT AATCCTCAAAGGACTGCAGTT 60 195 
DNMT1  ACCAAGCAAGAAGTGAAGCC GCTTCCTGCAGAAGAACCTG 60 336 
DNMT3a  CACACAGAAGCATATCCAGGAGTG AGTGGAAACCAAATACCC 60 550 
DNMT3b  AATGTGAATCCAGCCAGGAAAGGC ACTGGATTACACTCCAGGAACCGT 60 191 
MBD2  AACCCTGCTGTTTGGCTTAAC CGTACTTGCTGTACTCGCTCTTC 60 101 
G3DPH  TTGCAACTGTTTTAGGACTTT AGCATTGGGAAATGTTCAAGG 60 983 
a

N, nest primers; U, unmethylation-specific primers; and M, methylation-specific primers.

Close Modal

or Create an Account

Close Modal
Close Modal