Skip to Main Content
a

Appendix 2 Detailed information on the polymorphisms in 11 HCC susceptibility genes in humans

Gene locationAccession no.SNP: positionSize (bp)Primer 1Primer 2Annealing temperatureScoring
EPHX1-3e L29766 Exon 3, codon 147 GCTGCTTCCACTATGGCTTC GGCGTTTTGCAAACATACCT 66°C 11 (CC:GG) 
1q42.1 AF253417 113, T to C     12 (CT:GG) 
(exon 3)  (Tyr to His)     13 (CT:GA) 
  T/C: 17673     22 (TT:GG) 
       23 (TT:GA) 
  A/G: 17693     33 (TT:AA) 
EPHX1-4e L29766 Exon 4, codon 139, A to G, 381 CAGAGCCTGACCGTGCAG GGTCACCCCGCCGGAAGG 67°C 11 (AA) 
1q42.1 AF253417      22 (GG) 
(exon 4)  (His to Arg)     12 (GA) 
  A/G: 24448      
EPHX2 L05779 A/G: 1742 291 CGGTGGTCTCAAAGATGTAGA TGTCCCCCTACAGGACACTA 60°C 11 (AA) 
8p21-p12       22 (GG) 
       12 (AG) 
GSTP1 M37065 STRs 230-295 CACGCACCTATAATTCCACC GCTTAGAGGAAAGGAAATTGC 54°C NA 
11q13  (AAAAT):      
  1856–1942      
GSTT1 Z67376 STRs (CA repeats): 110-155 268 CAACTTCATCCACGTTCACC GAAGAGCCAAGGACAGTTAC 54°C NA 
22q11.23        
GSTT2 Z84718 G/T: 66094 527 TAAAACACTGATGACATTTGCC AGGTGACACTGGCTGATCTC 56°C 11 (TT) 
22q11.23       22 (GG) 
       12 (TG) 
MGST1 J03746 G/A: 560 325 TTCCATGGCTTACAGGTTG AGTGAGGTGTTGTGTGAATGTT 66°C 11 (AA) 
12p12.3-p12.1       22 (GG) 
       12 (AG) 
GSTA1 L13269 C/T: 3962 287 CCAACCTTGAAAAGGAACAC CTAGACAGGAGGGTGTAAGGC 66°C 11 (CC) 
6p12       22 (TT) 
       12 (CT) 
GSTA4 AL121969 T/G: 97161 397 TGTAAAACGACGGCCAGTGGCCA TAAAACAACACATCC CAGGAAACAGCTATGACCGAGA GCAGAAAGACGCTCAG 62°C 11 (TT) 
6p12       22 (GG) 
       12 (TG) 
GSTM1 X68676 C/G: 534 132 GCTTCACGTGTTATGAAGGTTC TTGGGAAGGCGTCCAAGCGC/ TTGGGAAGGCGTCCAAGCAG 56°C 11 (CC) 
1p13.3       GSTM1B 
       22 (GG) 
       GSTM1A 
       12 (GC) 
       GSTM1AB 
GSTM2 M63509 G/A: 905 284 GCCCTTTAAAGCAGACACAA GAGTGAGGAGCCCATACTCA 56°C 11 (AA) 
1p13.3       22 (GG) 
       12 (GA) 
GSTM3 AF043105 AGG/—: 273 CCTCAGTACTTGGAAGAGCT CACATGAAAGCCTTCAGGTT 58°C 11 GSTM3*A 
1p13.3  4596–4598     22 GSTM3*B 
       12 GSTM3*AB 
Gene locationAccession no.SNP: positionSize (bp)Primer 1Primer 2Annealing temperatureScoring
EPHX1-3e L29766 Exon 3, codon 147 GCTGCTTCCACTATGGCTTC GGCGTTTTGCAAACATACCT 66°C 11 (CC:GG) 
1q42.1 AF253417 113, T to C     12 (CT:GG) 
(exon 3)  (Tyr to His)     13 (CT:GA) 
  T/C: 17673     22 (TT:GG) 
       23 (TT:GA) 
  A/G: 17693     33 (TT:AA) 
EPHX1-4e L29766 Exon 4, codon 139, A to G, 381 CAGAGCCTGACCGTGCAG GGTCACCCCGCCGGAAGG 67°C 11 (AA) 
1q42.1 AF253417      22 (GG) 
(exon 4)  (His to Arg)     12 (GA) 
  A/G: 24448      
EPHX2 L05779 A/G: 1742 291 CGGTGGTCTCAAAGATGTAGA TGTCCCCCTACAGGACACTA 60°C 11 (AA) 
8p21-p12       22 (GG) 
       12 (AG) 
GSTP1 M37065 STRs 230-295 CACGCACCTATAATTCCACC GCTTAGAGGAAAGGAAATTGC 54°C NA 
11q13  (AAAAT):      
  1856–1942      
GSTT1 Z67376 STRs (CA repeats): 110-155 268 CAACTTCATCCACGTTCACC GAAGAGCCAAGGACAGTTAC 54°C NA 
22q11.23        
GSTT2 Z84718 G/T: 66094 527 TAAAACACTGATGACATTTGCC AGGTGACACTGGCTGATCTC 56°C 11 (TT) 
22q11.23       22 (GG) 
       12 (TG) 
MGST1 J03746 G/A: 560 325 TTCCATGGCTTACAGGTTG AGTGAGGTGTTGTGTGAATGTT 66°C 11 (AA) 
12p12.3-p12.1       22 (GG) 
       12 (AG) 
GSTA1 L13269 C/T: 3962 287 CCAACCTTGAAAAGGAACAC CTAGACAGGAGGGTGTAAGGC 66°C 11 (CC) 
6p12       22 (TT) 
       12 (CT) 
GSTA4 AL121969 T/G: 97161 397 TGTAAAACGACGGCCAGTGGCCA TAAAACAACACATCC CAGGAAACAGCTATGACCGAGA GCAGAAAGACGCTCAG 62°C 11 (TT) 
6p12       22 (GG) 
       12 (TG) 
GSTM1 X68676 C/G: 534 132 GCTTCACGTGTTATGAAGGTTC TTGGGAAGGCGTCCAAGCGC/ TTGGGAAGGCGTCCAAGCAG 56°C 11 (CC) 
1p13.3       GSTM1B 
       22 (GG) 
       GSTM1A 
       12 (GC) 
       GSTM1AB 
GSTM2 M63509 G/A: 905 284 GCCCTTTAAAGCAGACACAA GAGTGAGGAGCCCATACTCA 56°C 11 (AA) 
1p13.3       22 (GG) 
       12 (GA) 
GSTM3 AF043105 AGG/—: 273 CCTCAGTACTTGGAAGAGCT CACATGAAAGCCTTCAGGTT 58°C 11 GSTM3*A 
1p13.3  4596–4598     22 GSTM3*B 
       12 GSTM3*AB 
Close Modal

or Create an Account

Close Modal
Close Modal