Skip to Main Content
a

Appendix 1 Primer sequences for mouse loci

Primer NameSequence 5′-3′Primer NameSequence 5′-3′
Ephx1-1F AGTAGGAACCCGAGAGCGAC Gstm4-1F GAGTCTTTCCCGACCAGTGA 
Ephx1-1R CAGCCCTTCAATCTTGGTCT Gstm4-1R ACACGGATCCTCTCCTCCTC 
Ephx1-2F GGTGGAGATCCTCAACCAAT Gstm4-2F GCACAACCTGTGTGGAGAGA 
Ephx1-2R GGCTATGTTGGTGCAGATGA Gstm4-2R CATTCGATCGTAATCAAGGACA 
Ephx1-3F AGTTCTACATTCAAGGCGGC Gstm5-1F TAAAGTTAGCCGCCCACAGT 
Ephx1-3R TTGGTCCAGGTGGAGAACTT Gstm5-1R CTGAGGCTTCAGGTTTTCGT 
Ephx1-4F GCCTGGCTGCCTACATCTT Gstm5-2F AACCAGATCATGGACTTCCG 
Ephx1-4R TAGCGTCATCACTGCAGCTC Gstm5-2R CAGTGAGCTAAGAGTGTGGGC 
Ephx2-1F TCCAGCTTCGTGTCTGTGTC Gstm6-1F CGTGACTCTGGGTTATTGGG 
Ephx2-1R CAGCCAGTTGTTGGTGACAA Gstm6-1R ACTCTGGCTTCCGTTTCTCA 
Ephx2-2F AAAAGAAAGGATTCACAACATGC Gstm6-2F GAATTCAGATGGGCATGCTT 
Ephx2-2R GAGCCCATCTCCACAAAATG Gstm6-2R TCAGTGTTCACGGTGACAGG 
Ephx2-3F AGGGATCCGCCTGCATTT Gstm6-3F TTGGTGGGGAAGATCTATCAG 
Ephx2-3R TCATGGGAGACACATCAGGA Gstm6-3R CTCACACAAGACTGGGCCTT 
Ephx2-4F GCTGTGGCCAGTTTGAACAC Gstp1-1F AGATGGGGTGGGAAAGTGTA 
Ephx2-4R CCAACCCTTTACAGCTCCAC Gstp1-1R CCTCCACTACGGGTGTCACT 
Gsta1-1F AGCCCGTGCTTCACTACTTC Gstp1-2F TGAGTGACACCCGTAGTGGA 
Gsta1-1R CAAGGCAGTCTTGGCTTCTC Gstp1-2R CAGATGCAGCCTGAACAAGA 
Gsta1-2F TTGGGCAATTGGTATTATGTCC Gstp1-3F CCTGAGGAAATCAGGGATCA 
Gsta1-3R AATCTTGAAAGCCTTCCTTGC Gstp1-3R CGTGAGGGACACACACACTC 
Gsta2-1F ATTGGGAGCTGAGTGGAGAA Gstp1-4F CATTACAGGGCAGCAGGAGT 
Gsta2-1R TTGCCCAATCATTTCAGTCA Gstp1-4R GAGGTGTGGGTCTCAGAAGC 
Gsta2-2F GGAGAGAGCCCTGATTGACA Gstp1-5F AAGGACAAGAGGGAGCCATA 
Gsta2-2R GTATCTGCGGCTCCATCAAT Gstp1-5R AAAACGGGGACAAGAAGCTC 
Gsta3-1F CAAGAAAACCCAAGCAACTG Gstp2-1F CCCTCTGTCTACGCAGCACT 
Gsta3-1R TATCTCCAGATCCGCCACTC Gstp2-1R CAGGGCCTTCACGTAGTCAT 
Gsta3-2F TGGGAAGGACATGAAGGAGA Gstp2-2F GAATGATGGGGTGGAGGAC 
Gsta3-2R CTGCCAGGTTGAAGGAACTT Gstp2-2R TACTGTTTGCCATTGCCATT 
Gsta3-3F TGTGGACAACTTCCCTCTCC Gstt1-1F GACCTCGTGCTTCCAGAGTC 
Gsta3-3R CCAGAGTCTAAGAAGCTTGTTTTGT Gstt1-1R GCGGCACCTTAGAGAATGAC 
Gsta4-1F CTTCTTTCTCGAGTGCCTGG Gstt1-2F GATGACCCGTACAAGAAGGC 
Gsta4-1R TCTTTTTCCTTGGGGGTTTT Gstt1-2R CAGTGAGGGGAAACAGCATT 
Gsta4-2F ACATGTATGCAGATGGCACC Gstt2-1F CAGAGGAGGAAATCGTTTGG 
Gsta4-2R TGACACTGCAATTGGAACCT Gstt2-1R GTGGTCTGCCACCTGGTACT 
Gstm1-1F CTTCCGCTTTAGGGTCTGCT Gstt2-2F GACGGAAGCTTCGTGTTGAC 
Gstm1-1R AAGGCAGATTGGGAAAGTCC Gstt2-2R GGGCTGCATCAACTCCTC 
Gstm1-2F ATACACCATGGGTGACGCTC Gstt2-3F GCAACAGCTGGAGGACAAGT 
Gstm1-2R GACCTTGTCCCCTGCAAAC Gstt2-3R GGAGGGGGTACTGGTAACAT 
Gstm1-3F TCTACTCTGAGTTCCTGGGCA   
Gstm1-3R AGAGAGAACCAGGAGCCACA   
Gstm2-1F TGACACTAGGTTACTGGGACATC   
Gstm2-1R TTTTCTCAAAGTCAGGGCTGT   
Gstm2-2F GGAGAACCAGGCTATGGACA   
Gstm2-2R GGGTTCCAAAAGGCCATC   
Gstm2-3F CTTTGAGGGCCTGAAGAAGA   
Gstm2-3R ACCAAGGCAGCACACAGAC   
Gstm2-4F CTTCCCTCAGTGATGGTTGG   
Gstm2-4R CATCAAAAGGCTTCCTCTGG   
Gstm2-5F AAGCGCTGAGAAGCAGAGTC   
Gstm2-5R CCAGAGTCTAAGAAGCTTGTTTTGT   
Gstm2-6F AGGTTACTGGGACATCCGTG   
Gstm2-6R TAGGTGACCTTGTTCCCTGC   
Gstm2-7F AGTTGGCCATGGTTTGCTAC   
Gstm2-7R AGAAGAAAGCTGCACGTGGT   
Gstm3-1F ACTGACTCACTCCATCCGCT   
Gstm3-1R AGGGATGGCCTTCAAGAACT   
Gstm3-2F AACCAAGTTATGGACACCCG   
Gstm3-2R CATATGGACAGTCCCCCACT   
Gstm3-3F CATGAAGAGTAGCCGCTTCC   
Gstm3-3R GGAGGGCTGGCACTAAGATA   
Primer NameSequence 5′-3′Primer NameSequence 5′-3′
Ephx1-1F AGTAGGAACCCGAGAGCGAC Gstm4-1F GAGTCTTTCCCGACCAGTGA 
Ephx1-1R CAGCCCTTCAATCTTGGTCT Gstm4-1R ACACGGATCCTCTCCTCCTC 
Ephx1-2F GGTGGAGATCCTCAACCAAT Gstm4-2F GCACAACCTGTGTGGAGAGA 
Ephx1-2R GGCTATGTTGGTGCAGATGA Gstm4-2R CATTCGATCGTAATCAAGGACA 
Ephx1-3F AGTTCTACATTCAAGGCGGC Gstm5-1F TAAAGTTAGCCGCCCACAGT 
Ephx1-3R TTGGTCCAGGTGGAGAACTT Gstm5-1R CTGAGGCTTCAGGTTTTCGT 
Ephx1-4F GCCTGGCTGCCTACATCTT Gstm5-2F AACCAGATCATGGACTTCCG 
Ephx1-4R TAGCGTCATCACTGCAGCTC Gstm5-2R CAGTGAGCTAAGAGTGTGGGC 
Ephx2-1F TCCAGCTTCGTGTCTGTGTC Gstm6-1F CGTGACTCTGGGTTATTGGG 
Ephx2-1R CAGCCAGTTGTTGGTGACAA Gstm6-1R ACTCTGGCTTCCGTTTCTCA 
Ephx2-2F AAAAGAAAGGATTCACAACATGC Gstm6-2F GAATTCAGATGGGCATGCTT 
Ephx2-2R GAGCCCATCTCCACAAAATG Gstm6-2R TCAGTGTTCACGGTGACAGG 
Ephx2-3F AGGGATCCGCCTGCATTT Gstm6-3F TTGGTGGGGAAGATCTATCAG 
Ephx2-3R TCATGGGAGACACATCAGGA Gstm6-3R CTCACACAAGACTGGGCCTT 
Ephx2-4F GCTGTGGCCAGTTTGAACAC Gstp1-1F AGATGGGGTGGGAAAGTGTA 
Ephx2-4R CCAACCCTTTACAGCTCCAC Gstp1-1R CCTCCACTACGGGTGTCACT 
Gsta1-1F AGCCCGTGCTTCACTACTTC Gstp1-2F TGAGTGACACCCGTAGTGGA 
Gsta1-1R CAAGGCAGTCTTGGCTTCTC Gstp1-2R CAGATGCAGCCTGAACAAGA 
Gsta1-2F TTGGGCAATTGGTATTATGTCC Gstp1-3F CCTGAGGAAATCAGGGATCA 
Gsta1-3R AATCTTGAAAGCCTTCCTTGC Gstp1-3R CGTGAGGGACACACACACTC 
Gsta2-1F ATTGGGAGCTGAGTGGAGAA Gstp1-4F CATTACAGGGCAGCAGGAGT 
Gsta2-1R TTGCCCAATCATTTCAGTCA Gstp1-4R GAGGTGTGGGTCTCAGAAGC 
Gsta2-2F GGAGAGAGCCCTGATTGACA Gstp1-5F AAGGACAAGAGGGAGCCATA 
Gsta2-2R GTATCTGCGGCTCCATCAAT Gstp1-5R AAAACGGGGACAAGAAGCTC 
Gsta3-1F CAAGAAAACCCAAGCAACTG Gstp2-1F CCCTCTGTCTACGCAGCACT 
Gsta3-1R TATCTCCAGATCCGCCACTC Gstp2-1R CAGGGCCTTCACGTAGTCAT 
Gsta3-2F TGGGAAGGACATGAAGGAGA Gstp2-2F GAATGATGGGGTGGAGGAC 
Gsta3-2R CTGCCAGGTTGAAGGAACTT Gstp2-2R TACTGTTTGCCATTGCCATT 
Gsta3-3F TGTGGACAACTTCCCTCTCC Gstt1-1F GACCTCGTGCTTCCAGAGTC 
Gsta3-3R CCAGAGTCTAAGAAGCTTGTTTTGT Gstt1-1R GCGGCACCTTAGAGAATGAC 
Gsta4-1F CTTCTTTCTCGAGTGCCTGG Gstt1-2F GATGACCCGTACAAGAAGGC 
Gsta4-1R TCTTTTTCCTTGGGGGTTTT Gstt1-2R CAGTGAGGGGAAACAGCATT 
Gsta4-2F ACATGTATGCAGATGGCACC Gstt2-1F CAGAGGAGGAAATCGTTTGG 
Gsta4-2R TGACACTGCAATTGGAACCT Gstt2-1R GTGGTCTGCCACCTGGTACT 
Gstm1-1F CTTCCGCTTTAGGGTCTGCT Gstt2-2F GACGGAAGCTTCGTGTTGAC 
Gstm1-1R AAGGCAGATTGGGAAAGTCC Gstt2-2R GGGCTGCATCAACTCCTC 
Gstm1-2F ATACACCATGGGTGACGCTC Gstt2-3F GCAACAGCTGGAGGACAAGT 
Gstm1-2R GACCTTGTCCCCTGCAAAC Gstt2-3R GGAGGGGGTACTGGTAACAT 
Gstm1-3F TCTACTCTGAGTTCCTGGGCA   
Gstm1-3R AGAGAGAACCAGGAGCCACA   
Gstm2-1F TGACACTAGGTTACTGGGACATC   
Gstm2-1R TTTTCTCAAAGTCAGGGCTGT   
Gstm2-2F GGAGAACCAGGCTATGGACA   
Gstm2-2R GGGTTCCAAAAGGCCATC   
Gstm2-3F CTTTGAGGGCCTGAAGAAGA   
Gstm2-3R ACCAAGGCAGCACACAGAC   
Gstm2-4F CTTCCCTCAGTGATGGTTGG   
Gstm2-4R CATCAAAAGGCTTCCTCTGG   
Gstm2-5F AAGCGCTGAGAAGCAGAGTC   
Gstm2-5R CCAGAGTCTAAGAAGCTTGTTTTGT   
Gstm2-6F AGGTTACTGGGACATCCGTG   
Gstm2-6R TAGGTGACCTTGTTCCCTGC   
Gstm2-7F AGTTGGCCATGGTTTGCTAC   
Gstm2-7R AGAAGAAAGCTGCACGTGGT   
Gstm3-1F ACTGACTCACTCCATCCGCT   
Gstm3-1R AGGGATGGCCTTCAAGAACT   
Gstm3-2F AACCAAGTTATGGACACCCG   
Gstm3-2R CATATGGACAGTCCCCCACT   
Gstm3-3F CATGAAGAGTAGCCGCTTCC   
Gstm3-3R GGAGGGCTGGCACTAAGATA   
Close Modal

or Create an Account

Close Modal
Close Modal