Skip to Main Content
Table 1

List of primers used for quantitative RT-PCR

Gene nameForward primerReverse primer
Expressed sequence tag, unknown (Rn.37805) GCATATGAGCAGCAATACT AGTCTCTGACCCTAAATGAG 
Heat-shock Mr 60,000 protein 1 AGAGTTCCTCAGAGGTTGGC CCCCAGCAGCATCCAGTAAA 
Ribosomal protein S6 CACTGTGCCTCGTCGGTTGG AACATACTGGCGGACATC 
Heat-shock Mr 10,000 protein CGGCACTCCTTTCAACCAAT GGCGGCGTAAGTCAT 
Heme oxygenase GTCAACATGGACGCCGACTA ACCAGCAGCCCCAAATCCT 
Intercellular adhesion molecule 1 CGGGCTTCGTGATCGTGGC GGAGGCGGGGCTTGTACCTT 
Tissue inhibitor of metalloproteinase-1 AACTCCTCGCTGCGGTTCT GGTTTCCGGTTCGCCTACAC 
Solute carrier family 7 CGGCCCTCCTCACAGTACAT CGCAGAGGCAGGCCACGAG 
Glutathione S-transferase π CCCCTGCTCTCTGCCTATG CTGTTTACCATTGCCGTTGA 
Claudin 3 CGGCTGTGCTCACCTTAGTG AGTTCCCATCTCTCGCTTCT 
Cyclin D1 GCCCTCCGTTTCTTACTTC AGACCTCCTCTTCGCACTTC 
Stearoyl-CoA desaturase 2 GGTCAGGAATATTATCCCAT CCAACCCGTGAATCAT 
Cyclophilin TGACTTCACACGCCATAAT AGATGCCAGGACCTGTATGC 
Gene nameForward primerReverse primer
Expressed sequence tag, unknown (Rn.37805) GCATATGAGCAGCAATACT AGTCTCTGACCCTAAATGAG 
Heat-shock Mr 60,000 protein 1 AGAGTTCCTCAGAGGTTGGC CCCCAGCAGCATCCAGTAAA 
Ribosomal protein S6 CACTGTGCCTCGTCGGTTGG AACATACTGGCGGACATC 
Heat-shock Mr 10,000 protein CGGCACTCCTTTCAACCAAT GGCGGCGTAAGTCAT 
Heme oxygenase GTCAACATGGACGCCGACTA ACCAGCAGCCCCAAATCCT 
Intercellular adhesion molecule 1 CGGGCTTCGTGATCGTGGC GGAGGCGGGGCTTGTACCTT 
Tissue inhibitor of metalloproteinase-1 AACTCCTCGCTGCGGTTCT GGTTTCCGGTTCGCCTACAC 
Solute carrier family 7 CGGCCCTCCTCACAGTACAT CGCAGAGGCAGGCCACGAG 
Glutathione S-transferase π CCCCTGCTCTCTGCCTATG CTGTTTACCATTGCCGTTGA 
Claudin 3 CGGCTGTGCTCACCTTAGTG AGTTCCCATCTCTCGCTTCT 
Cyclin D1 GCCCTCCGTTTCTTACTTC AGACCTCCTCTTCGCACTTC 
Stearoyl-CoA desaturase 2 GGTCAGGAATATTATCCCAT CCAACCCGTGAATCAT 
Cyclophilin TGACTTCACACGCCATAAT AGATGCCAGGACCTGTATGC 
Close Modal

or Create an Account

Close Modal
Close Modal