Skip to Main Content
Table 4.

RT-PCR validation of genes up-regulated in the breast epithelium of parous women

Gene nameGene symbolPrimer sequenceParous controlNulliparous controlParous caseNulliparous case
TNFRSF1A-associated via death domain TRADD gatggccttagggttccttc 11488.00 ± 985.00 0.57 ± 0.33 2.18 ± 1.57 1.89 ± 1.85 
Eukaryotic translation initiation factor 4A, isoform 3 EIF4A3 aagaaaggtggactggctga 3822.18 ± 764.10 1.09 ± 1.04 2.29 ± 2.72 12.97 ± 27.51 
Suppressor of Ty 5 homologue (S. cerevisiaeSUPT5H ctttgaggggaaccgttaca 1517.76 ± 234.55 0.26 ± 0.12 16.84 ± 26.09 2.90 ± 3.15 
SRY (sex determining region Y)-box 5 SOX5 agggactcccgagagcttag 267.61 ± 24.87 0.79 ± 0.71 2.73 ± 3.05 6.04 ± 5.71 
Carcinoembryonic antigen–related cell adhesion molecule 1 CEACAM1 acccacctgcacagtactcc 12.58 ± 1.01 1.97 ± 0.16 0.64 ± 0.06 1.74 ± 0.14 
Homeo box D1 HOXD1 ttcagcaccaagcaactgac 9.49 ± 3.15 2.57 ± 3.54 2.64 ± 2.34 1.11 ± 1.11 
Ephrin B3 EFNB3 cttcccaagatctcccttcc 3.63 ± 3.23 1.11 ± 0.08 0.7 ± 0.59 1.17 ± 0.84 
p300/CBP-associated factor PCAF acgttcacctgctggtccaa 98.36 ± 21.44 1.38 ± 0.33 9.87 ± 3.76 2.95 ± 5.34 
Inhibitor of DNA binding 4 ID4 atgggatgaggaaatgcttg 830.28 ± 100.33 0.21 ± 0.23 33.80 ± 63.44 3.37 ± 3.83 
Surfeit 5 Surfeit cctgcctgcaggttagaaag 1.12 ± 1.13 1.75 ± 0.08 1.35 ± 0.67 1.53 ± 2.16 
Gene nameGene symbolPrimer sequenceParous controlNulliparous controlParous caseNulliparous case
TNFRSF1A-associated via death domain TRADD gatggccttagggttccttc 11488.00 ± 985.00 0.57 ± 0.33 2.18 ± 1.57 1.89 ± 1.85 
Eukaryotic translation initiation factor 4A, isoform 3 EIF4A3 aagaaaggtggactggctga 3822.18 ± 764.10 1.09 ± 1.04 2.29 ± 2.72 12.97 ± 27.51 
Suppressor of Ty 5 homologue (S. cerevisiaeSUPT5H ctttgaggggaaccgttaca 1517.76 ± 234.55 0.26 ± 0.12 16.84 ± 26.09 2.90 ± 3.15 
SRY (sex determining region Y)-box 5 SOX5 agggactcccgagagcttag 267.61 ± 24.87 0.79 ± 0.71 2.73 ± 3.05 6.04 ± 5.71 
Carcinoembryonic antigen–related cell adhesion molecule 1 CEACAM1 acccacctgcacagtactcc 12.58 ± 1.01 1.97 ± 0.16 0.64 ± 0.06 1.74 ± 0.14 
Homeo box D1 HOXD1 ttcagcaccaagcaactgac 9.49 ± 3.15 2.57 ± 3.54 2.64 ± 2.34 1.11 ± 1.11 
Ephrin B3 EFNB3 cttcccaagatctcccttcc 3.63 ± 3.23 1.11 ± 0.08 0.7 ± 0.59 1.17 ± 0.84 
p300/CBP-associated factor PCAF acgttcacctgctggtccaa 98.36 ± 21.44 1.38 ± 0.33 9.87 ± 3.76 2.95 ± 5.34 
Inhibitor of DNA binding 4 ID4 atgggatgaggaaatgcttg 830.28 ± 100.33 0.21 ± 0.23 33.80 ± 63.44 3.37 ± 3.83 
Surfeit 5 Surfeit cctgcctgcaggttagaaag 1.12 ± 1.13 1.75 ± 0.08 1.35 ± 0.67 1.53 ± 2.16 
Close Modal

or Create an Account

Close Modal
Close Modal