RT-PCR validation of genes up-regulated in the breast epithelium of parous women
Gene name . | Gene symbol . | Primer sequence . | Parous control . | Nulliparous control . | Parous case . | Nulliparous case . |
---|---|---|---|---|---|---|
TNFRSF1A-associated via death domain | TRADD | gatggccttagggttccttc | 11488.00 ± 985.00 | 0.57 ± 0.33 | 2.18 ± 1.57 | 1.89 ± 1.85 |
Eukaryotic translation initiation factor 4A, isoform 3 | EIF4A3 | aagaaaggtggactggctga | 3822.18 ± 764.10 | 1.09 ± 1.04 | 2.29 ± 2.72 | 12.97 ± 27.51 |
Suppressor of Ty 5 homologue (S. cerevisiae) | SUPT5H | ctttgaggggaaccgttaca | 1517.76 ± 234.55 | 0.26 ± 0.12 | 16.84 ± 26.09 | 2.90 ± 3.15 |
SRY (sex determining region Y)-box 5 | SOX5 | agggactcccgagagcttag | 267.61 ± 24.87 | 0.79 ± 0.71 | 2.73 ± 3.05 | 6.04 ± 5.71 |
Carcinoembryonic antigen–related cell adhesion molecule 1 | CEACAM1 | acccacctgcacagtactcc | 12.58 ± 1.01 | 1.97 ± 0.16 | 0.64 ± 0.06 | 1.74 ± 0.14 |
Homeo box D1 | HOXD1 | ttcagcaccaagcaactgac | 9.49 ± 3.15 | 2.57 ± 3.54 | 2.64 ± 2.34 | 1.11 ± 1.11 |
Ephrin B3 | EFNB3 | cttcccaagatctcccttcc | 3.63 ± 3.23 | 1.11 ± 0.08 | 0.7 ± 0.59 | 1.17 ± 0.84 |
p300/CBP-associated factor | PCAF | acgttcacctgctggtccaa | 98.36 ± 21.44 | 1.38 ± 0.33 | 9.87 ± 3.76 | 2.95 ± 5.34 |
Inhibitor of DNA binding 4 | ID4 | atgggatgaggaaatgcttg | 830.28 ± 100.33 | 0.21 ± 0.23 | 33.80 ± 63.44 | 3.37 ± 3.83 |
Surfeit 5 | Surfeit | cctgcctgcaggttagaaag | 1.12 ± 1.13 | 1.75 ± 0.08 | 1.35 ± 0.67 | 1.53 ± 2.16 |
Gene name . | Gene symbol . | Primer sequence . | Parous control . | Nulliparous control . | Parous case . | Nulliparous case . |
---|---|---|---|---|---|---|
TNFRSF1A-associated via death domain | TRADD | gatggccttagggttccttc | 11488.00 ± 985.00 | 0.57 ± 0.33 | 2.18 ± 1.57 | 1.89 ± 1.85 |
Eukaryotic translation initiation factor 4A, isoform 3 | EIF4A3 | aagaaaggtggactggctga | 3822.18 ± 764.10 | 1.09 ± 1.04 | 2.29 ± 2.72 | 12.97 ± 27.51 |
Suppressor of Ty 5 homologue (S. cerevisiae) | SUPT5H | ctttgaggggaaccgttaca | 1517.76 ± 234.55 | 0.26 ± 0.12 | 16.84 ± 26.09 | 2.90 ± 3.15 |
SRY (sex determining region Y)-box 5 | SOX5 | agggactcccgagagcttag | 267.61 ± 24.87 | 0.79 ± 0.71 | 2.73 ± 3.05 | 6.04 ± 5.71 |
Carcinoembryonic antigen–related cell adhesion molecule 1 | CEACAM1 | acccacctgcacagtactcc | 12.58 ± 1.01 | 1.97 ± 0.16 | 0.64 ± 0.06 | 1.74 ± 0.14 |
Homeo box D1 | HOXD1 | ttcagcaccaagcaactgac | 9.49 ± 3.15 | 2.57 ± 3.54 | 2.64 ± 2.34 | 1.11 ± 1.11 |
Ephrin B3 | EFNB3 | cttcccaagatctcccttcc | 3.63 ± 3.23 | 1.11 ± 0.08 | 0.7 ± 0.59 | 1.17 ± 0.84 |
p300/CBP-associated factor | PCAF | acgttcacctgctggtccaa | 98.36 ± 21.44 | 1.38 ± 0.33 | 9.87 ± 3.76 | 2.95 ± 5.34 |
Inhibitor of DNA binding 4 | ID4 | atgggatgaggaaatgcttg | 830.28 ± 100.33 | 0.21 ± 0.23 | 33.80 ± 63.44 | 3.37 ± 3.83 |
Surfeit 5 | Surfeit | cctgcctgcaggttagaaag | 1.12 ± 1.13 | 1.75 ± 0.08 | 1.35 ± 0.67 | 1.53 ± 2.16 |