Skip to Main Content
Table 1.

Primer and probes specific for methylated DNA and used for MethyLight reactions

HUGO gene nomenclatureForward primer sequenceReverse primer sequenceProbe oligo sequence
ACTB TGGTGATGGAGGAGGTTTAGTAAGT AACCAATAAAACCTACTCCTCCCTTAA 6FAM-ACCACCACCCAACACACAATAACAAACACA-BHQ-1 
APC GAACCAAAACGCTCCCCAT TTATATGTCGGTTACGTGCGTTTATAT 6FAM-CCCGTCGAAAACCCGCCGATTA-BHQ-1 
ARHI GCGTAAGCGGAATTTATGTTTGT CCGCGATTTTATATTCCGACTT 6FAM-CGCACAAAAACGAAATACGAAAACGCAAA-BHQ-1 
BLT1 GCGTTGGTTTTATCGGAAGG AAACCGTAATTCCCGCTCG 6FAM-GACTCCGCCCAACTTCGCCAAAA-BHQ-1 
BRCA1 GAGAGGTTGTTGTTTAGCGGTAGTT CGCGCAATCGCAATTTTAAT 6FAM-CCGCGCTTTTCCGTTACCACGA-BHQ-1 
CALCA GTTTTGGAAGTATGAGGGTGACG TTCCCGCCGCTATAAATCG 6FAM-ATTCCGCCAATACACAACAACCAATAAACG-BHQ-1 
CDH1 AATTTTAGGTTAGAGGGTTATCGCGT TCCCCAAAACGAAACTAACGAC 6FAM-CGCCCACCCGACCTCGCAT-BHQ-1 
CDH13 AATTTCGTTCGTTTTGTGCGT CTACCCGTACCGAACGATCC 6FAM-AACGCAAAACGCGCCCGACA-BHQ-1 
CDKN2A TGGAGTTTTCGGTTGATTGGTT AACAACGCCCGCACCTCCT 6FAM-ACCCGACCCCGAACCGCG-BHQ-1 
CYP1B1 GTGCGTTTGGACGGGAGTT AACGCGACCTAACAAAACGAA 6FAM-CGCCGCACACCAAACCGCTT-BHQ-1 
DAPK1 TCGTCGTCGTTTCGGTTAGTT TCCCTCCGAAACGCTATCG 6FAM-CGACCATAAACGCCAACGCCG-BHQ-1 
ESR1 GGCGTTCGTTTTGGGATTG GCCGACACGCGAACTCTAA 6FAM-CGATAAAACCGAACGACCCGACGA-BHQ-1 
ESR2 TTTGAAATTTGTAGGGCGAAGAGTAG ACCCGTCGCAACTCGAATAA 6FAM-CCGACCCAACGCTCGCCG-BHQ-1 
FGF18 ATCTCCTCCTCCGCGTCTCT TCGCGCGTAGAAAACGTTT 6FAM-CGACCGTACGCATCGCCGC-BHQ-1 
GSTM3 GCGCGAACGCCCTAACT AACGTCGGTATTAGTCGCGTTT 6FAM-CCCCGTTCTCCGTCCCTTACCTCC-BHQ-1 
GSTP1 GTCGGCGTCGTGATTTAGTATTG AAACTACGACGACGAAACTCCAA 6FAM-AAACCTCGCGACCTCCGAACCTTATAAAA-BHQ-1 
HIC1 GTTAGGCGGTTAGGGCGTC CCGAACGCCTCCATCGTAT 6FAM-CAACATCGTCTACCCAACACACTCTCCTACG-BHQ-1 
HLA-G CACCCCCATATACGCGCTAA GGTCGTTACGTTTCGGGTAGTTTA 6FAM-CGCGCTCACACGCTCAAAAACCT-BHQ-1 
HSD17B4 TATCGTTGAGGTTCGACGGG TCCAACCTTCGCATACTCACC 6FAM-CCCGCGCCGATAACCAATACCA-BHQ-1 
HSPA2 CACGAACACTACCAACAACTCAACT GGGAGCGGATTGGGTTTG 6FAM-CCGCGCCCAATTCCCGATTCT-BHQ-1 
IGFBP2 CTCGCGCCGACAAATAAATAC CGGGAAGAGTAGGGAATTTTTAGAGT 6FAM-ACGCCCGCTCGCCCACCT-BHQ-1 
MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA-BHQ-1 
MLH1 AGGAAGAGCGGATAGCGATTT TCTTCGTCCCTCCCTAAAACG 6FAM-CCCGCTACCTAAAAAAATATACGCTTACGCG-BHQ-1 
MLLT7 CCTCACGATACCTCCCCTCAA TTAGGGATTAGCGTTTTGGGATT 6FAM-AAACACATTCCTACCAATCTTCAAAAAATCGCG-BHQ-1 
MT3 CGATAAACGAACTTCTCCAAACAA GCGCGGTGCGTAGGG 6FAM-AAACGCGCGACTTAACTAATAACAACAAATAACGA-BHQ-1 
MYOD1 GAGCGCGCGTAGTTAGCG TCCGACACGCCCTTTCC 6FAM-CTCCAACACCCGACTACTATATCCGCGAAA-BHQ-1 
PGR TTATAATTCGAGGCGGTTAGTGTTT TCGAACTTCTACTAACTCCGTACTACGA 6FAM-ATCATCTCCGAAAATCTCAAATCCCAATAATACG-BHQ-1 
PPP1R13B CCTCACCCACCGACATCATC TCGGAGCGGTGGGTATAGTTC 6FAM-AAAAATCCGCGACGCCCTCGA-BHQ-1 
PTGS2 CGGAAGCGTTCGGGTAAAG AATTCCACCGCCCCAAAC 6FAM-TTTCCGCCAAATATCTTTTCTTCTTCGCA-BHQ-1 
RASSF1A ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-BHQ-1 
SOCS1 GCGTCGAGTTCGTGGGTATTT CCGAAACCATCTTCACGCTAA 6FAM-ACAATTCCGCTAACGACTATCGCGCA-BHQ-1 
SOCS2 TCCCTTCCCCGCCATT TTGTTTTTGTCGCGGTGATTT 6FAM-CCGAAAAACTCAAAACACCGCAAAATCAT-BHQ-1 
SYK GGGCGCGATATTGGGAG GCGACTCTTCCTCATTTTAAACAAC 6FAM-CCTTAACGCGCCCGAACAAACG-BHQ-1 
TERT GGATTCGCGGGTATAGACGTT CGAAATCCGCGCGAAA 6FAM-CCCAATCCCTCCGCCACGTAAAA-BHQ-1 
TFF1 TAAGGTTACGGTGGTTATTTCGTGA ACCTTAATCCAAATCCTACTCATATCTAAAA 6FAM-CCCTCCCGCCAAAATAAATACTATACTCACTACAAAA-BHQ-1 
TIMP3 GCGTCGGAGGTTAAGGTTGTT CTCTCCAAAATTACCGTACGCG 6FAM-AACTCGCTCGCCCGCCGAA-BHQ-1 
TITF1 CGAAATAAACCGAATCCTCCTTAA TGTTTTGTTGTTTTAGCGTTTACGT 6FAM-CTCGCGTTTATTTTAACCCGACGCCA-BHQ-1 
TP53BP2 ACCCCCTAACGCGACTTTATC GTTCGATTCGGGATTAGTTGGT 6FAM-CGCTCGTAACGATCGAAACTCCCTCCT-BHQ-1 
TWIST GTAGCGCGGCGAACGT AAACGCAACGAATCATAACCAAC 6FAM-CCAACGCACCCAATCGCTAAACGA-BHQ-1 
HUGO gene nomenclatureForward primer sequenceReverse primer sequenceProbe oligo sequence
ACTB TGGTGATGGAGGAGGTTTAGTAAGT AACCAATAAAACCTACTCCTCCCTTAA 6FAM-ACCACCACCCAACACACAATAACAAACACA-BHQ-1 
APC GAACCAAAACGCTCCCCAT TTATATGTCGGTTACGTGCGTTTATAT 6FAM-CCCGTCGAAAACCCGCCGATTA-BHQ-1 
ARHI GCGTAAGCGGAATTTATGTTTGT CCGCGATTTTATATTCCGACTT 6FAM-CGCACAAAAACGAAATACGAAAACGCAAA-BHQ-1 
BLT1 GCGTTGGTTTTATCGGAAGG AAACCGTAATTCCCGCTCG 6FAM-GACTCCGCCCAACTTCGCCAAAA-BHQ-1 
BRCA1 GAGAGGTTGTTGTTTAGCGGTAGTT CGCGCAATCGCAATTTTAAT 6FAM-CCGCGCTTTTCCGTTACCACGA-BHQ-1 
CALCA GTTTTGGAAGTATGAGGGTGACG TTCCCGCCGCTATAAATCG 6FAM-ATTCCGCCAATACACAACAACCAATAAACG-BHQ-1 
CDH1 AATTTTAGGTTAGAGGGTTATCGCGT TCCCCAAAACGAAACTAACGAC 6FAM-CGCCCACCCGACCTCGCAT-BHQ-1 
CDH13 AATTTCGTTCGTTTTGTGCGT CTACCCGTACCGAACGATCC 6FAM-AACGCAAAACGCGCCCGACA-BHQ-1 
CDKN2A TGGAGTTTTCGGTTGATTGGTT AACAACGCCCGCACCTCCT 6FAM-ACCCGACCCCGAACCGCG-BHQ-1 
CYP1B1 GTGCGTTTGGACGGGAGTT AACGCGACCTAACAAAACGAA 6FAM-CGCCGCACACCAAACCGCTT-BHQ-1 
DAPK1 TCGTCGTCGTTTCGGTTAGTT TCCCTCCGAAACGCTATCG 6FAM-CGACCATAAACGCCAACGCCG-BHQ-1 
ESR1 GGCGTTCGTTTTGGGATTG GCCGACACGCGAACTCTAA 6FAM-CGATAAAACCGAACGACCCGACGA-BHQ-1 
ESR2 TTTGAAATTTGTAGGGCGAAGAGTAG ACCCGTCGCAACTCGAATAA 6FAM-CCGACCCAACGCTCGCCG-BHQ-1 
FGF18 ATCTCCTCCTCCGCGTCTCT TCGCGCGTAGAAAACGTTT 6FAM-CGACCGTACGCATCGCCGC-BHQ-1 
GSTM3 GCGCGAACGCCCTAACT AACGTCGGTATTAGTCGCGTTT 6FAM-CCCCGTTCTCCGTCCCTTACCTCC-BHQ-1 
GSTP1 GTCGGCGTCGTGATTTAGTATTG AAACTACGACGACGAAACTCCAA 6FAM-AAACCTCGCGACCTCCGAACCTTATAAAA-BHQ-1 
HIC1 GTTAGGCGGTTAGGGCGTC CCGAACGCCTCCATCGTAT 6FAM-CAACATCGTCTACCCAACACACTCTCCTACG-BHQ-1 
HLA-G CACCCCCATATACGCGCTAA GGTCGTTACGTTTCGGGTAGTTTA 6FAM-CGCGCTCACACGCTCAAAAACCT-BHQ-1 
HSD17B4 TATCGTTGAGGTTCGACGGG TCCAACCTTCGCATACTCACC 6FAM-CCCGCGCCGATAACCAATACCA-BHQ-1 
HSPA2 CACGAACACTACCAACAACTCAACT GGGAGCGGATTGGGTTTG 6FAM-CCGCGCCCAATTCCCGATTCT-BHQ-1 
IGFBP2 CTCGCGCCGACAAATAAATAC CGGGAAGAGTAGGGAATTTTTAGAGT 6FAM-ACGCCCGCTCGCCCACCT-BHQ-1 
MGMT GCGTTTCGACGTTCGTAGGT CACTCTTCCGAAAACGAAACG 6FAM-CGCAAACGATACGCACCGCGA-BHQ-1 
MLH1 AGGAAGAGCGGATAGCGATTT TCTTCGTCCCTCCCTAAAACG 6FAM-CCCGCTACCTAAAAAAATATACGCTTACGCG-BHQ-1 
MLLT7 CCTCACGATACCTCCCCTCAA TTAGGGATTAGCGTTTTGGGATT 6FAM-AAACACATTCCTACCAATCTTCAAAAAATCGCG-BHQ-1 
MT3 CGATAAACGAACTTCTCCAAACAA GCGCGGTGCGTAGGG 6FAM-AAACGCGCGACTTAACTAATAACAACAAATAACGA-BHQ-1 
MYOD1 GAGCGCGCGTAGTTAGCG TCCGACACGCCCTTTCC 6FAM-CTCCAACACCCGACTACTATATCCGCGAAA-BHQ-1 
PGR TTATAATTCGAGGCGGTTAGTGTTT TCGAACTTCTACTAACTCCGTACTACGA 6FAM-ATCATCTCCGAAAATCTCAAATCCCAATAATACG-BHQ-1 
PPP1R13B CCTCACCCACCGACATCATC TCGGAGCGGTGGGTATAGTTC 6FAM-AAAAATCCGCGACGCCCTCGA-BHQ-1 
PTGS2 CGGAAGCGTTCGGGTAAAG AATTCCACCGCCCCAAAC 6FAM-TTTCCGCCAAATATCTTTTCTTCTTCGCA-BHQ-1 
RASSF1A ATTGAGTTGCGGGAGTTGGT ACACGCTCCAACCGAATACG 6FAM-CCCTTCCCAACGCGCCCA-BHQ-1 
SOCS1 GCGTCGAGTTCGTGGGTATTT CCGAAACCATCTTCACGCTAA 6FAM-ACAATTCCGCTAACGACTATCGCGCA-BHQ-1 
SOCS2 TCCCTTCCCCGCCATT TTGTTTTTGTCGCGGTGATTT 6FAM-CCGAAAAACTCAAAACACCGCAAAATCAT-BHQ-1 
SYK GGGCGCGATATTGGGAG GCGACTCTTCCTCATTTTAAACAAC 6FAM-CCTTAACGCGCCCGAACAAACG-BHQ-1 
TERT GGATTCGCGGGTATAGACGTT CGAAATCCGCGCGAAA 6FAM-CCCAATCCCTCCGCCACGTAAAA-BHQ-1 
TFF1 TAAGGTTACGGTGGTTATTTCGTGA ACCTTAATCCAAATCCTACTCATATCTAAAA 6FAM-CCCTCCCGCCAAAATAAATACTATACTCACTACAAAA-BHQ-1 
TIMP3 GCGTCGGAGGTTAAGGTTGTT CTCTCCAAAATTACCGTACGCG 6FAM-AACTCGCTCGCCCGCCGAA-BHQ-1 
TITF1 CGAAATAAACCGAATCCTCCTTAA TGTTTTGTTGTTTTAGCGTTTACGT 6FAM-CTCGCGTTTATTTTAACCCGACGCCA-BHQ-1 
TP53BP2 ACCCCCTAACGCGACTTTATC GTTCGATTCGGGATTAGTTGGT 6FAM-CGCTCGTAACGATCGAAACTCCCTCCT-BHQ-1 
TWIST GTAGCGCGGCGAACGT AAACGCAACGAATCATAACCAAC 6FAM-CCAACGCACCCAATCGCTAAACGA-BHQ-1 
Close Modal

or Create an Account

Close Modal
Close Modal