Skip to Main Content
Table 1

Primers and probes of E48 and PBGD used for RT-PCR amplification

PrimersSequence 5′-3′
E48 product size: 116 bp  
E48 forward AGATGAGGACAGCATTGCTGC 
E48 reverse GCAGACCACAGAATGCTTGC 
E48 TaqMan FAM-TTACCCTGCGCTGCCACGTGTG-TAMRA 
PBGD product size: 135 bp  
PBGD forward GGCAATGCGGCTGCAA 
PBGD reverse GGGTACCCACGCGAATCAC 
PBGD TaqMan FAM-CATCTTTGGGCTGTTTTCTTCCGCC-TAMRA 
PrimersSequence 5′-3′
E48 product size: 116 bp  
E48 forward AGATGAGGACAGCATTGCTGC 
E48 reverse GCAGACCACAGAATGCTTGC 
E48 TaqMan FAM-TTACCCTGCGCTGCCACGTGTG-TAMRA 
PBGD product size: 135 bp  
PBGD forward GGCAATGCGGCTGCAA 
PBGD reverse GGGTACCCACGCGAATCAC 
PBGD TaqMan FAM-CATCTTTGGGCTGTTTTCTTCCGCC-TAMRA 
Close Modal

or Create an Account

Close Modal
Close Modal