Abstract
Curcumin has been shown to prevent and inhibit carcinogen-induced tumorigenesis in different organs of rodent carcinogenesis models. Our objective is to study global gene expression profiles elicited by curcumin in mouse liver and small intestine as well as to identify curcumin-regulated nuclear factor E2-related factor 2 (Nrf2)–dependent genes. Wild-type C57BL/6J and Nrf2 knockout C57BL/6J/Nrf2(−/−) mice were given a single oral dose of curcumin at 1,000 mg/kg. Liver and small intestine were collected at 3 and 12 hours after treatments. Total RNA was extracted and analyzed using Affymetrix (Santa Clara, CA) mouse genome 430 array (45K) and GeneSpring 6.1 software (Silicon Genetics, Redwood City, CA). Genes that were induced or suppressed >2-fold by curcumin treatments compared with vehicle in wild-type mice but not in knockout mice were filtered using GeneSpring software and regarded as Nrf2-dependent genes. Among those well-defined genes, 822 (664 induced and 158 suppressed) and 222 (154 induced and 68 suppressed) were curcumin-regulated Nrf2-dependent genes identified in the liver and small intestine, respectively. Based on their biological functions, these genes can be classified into the category of ubiquitination and proteolysis, electron transport, detoxification, transport, apoptosis and cell cycle control, cell adhesion, kinase and phosphatase, and transcription factor. Many phase II detoxification/antioxidant enzyme genes, which are regulated by Nrf2, are among the identified genes. The identification of curcumin-regulated Nrf2-dependent genes not only provides potential novel insights into the biological effects of curcumin on global gene expression and chemoprevention but also points to the potential role of Nrf2 in these processes. [Mol Cancer Ther 2006;5(1):39–51]
Introduction
Cancer development is believed to be a multistage process, including initiation, promotion, and progression (1, 2). In 1976, Dr. Michael B. Sporn first coined the term “chemoprevention” and advocated using cancer chemopreventive agents to decrease the incidence of cancer (3). Since then, many natural products isolated from food and plants have been investigated for their potential as cancer chemopreventive agent. Curcumin, a naturally occurring flavonoid present in the spice turmeric, has been shown to prevent and inhibit carcinogen-induced tumorigenesis in different organs in rodent carcinogenesis models, and its cancer chemopreventive effects in these animal models have been reviewed previously (4, 5). In addition to its cancer chemopreventive activity, curcumin is also well known for its antioxidant and anti-inflammatory properties (6, 7). Therefore, numerous studies have been carried out to elucidate the molecular mechanisms of the above effects of curcumin. Based on these studies, the potential mechanisms or molecular targets of curcumin have been extensively reviewed recently (4, 5, 8, 9). These include the regulation of a variety of signal transduction pathways [such as epidermal growth factor receptor, nuclear factor-κB, activator protein-1, β-catenin/TCF, mitogen-activated protein kinase (MAPK), and Akt pathways] as well as the expression of many oncogenes (such as c-jun, c-fos, c-myc, cyclooxygenase-2, and NOS) that are involved in the cell proliferation, differentiation, apoptosis, and angiogenesis. However, the chemopreventive mechanism of curcumin, especially in vivo, is still not fully elucidated because the interactions between these different signal transduction pathways in response to curcumin treatment are not fully understood.
Basic leucine zipper family transcription factor nuclear factor E2-related factor 2 (Nrf2) involves the regulation of antioxidant response element (ARE)–mediated gene transcription. Under homeostasis condition, Nrf2 is sequestered in cytoplasm by Kelch-like ECH-associated protein 1 (10). Exposure of cells to oxidative stress or ARE inducers triggers the release of Nrf2 from Kelch-like ECH-associated protein 1 and facilitate its nuclear translocation (11). The nuclear translocation of Nrf2 and subsequent dimerization with small Maf protein and other coactivators, such as CBP, will drive the transcription of its target genes (12). One large group of these target genes is the phase II detoxification and antioxidant genes. By inducing these genes through the Nrf2/ARE pathway, chemopreventive agents could increase the detoxification of procarcinogens or carcinogens and protect normal cells from the DNA/protein damage caused by electrophiles and reactive oxygen intermediates, thus decreasing the incidence of tumor initiation and reducing the risk of cancer. The role of Nrf2 in preventing tumorigenesis is also supported by studies in which Nrf2 knockout mice were much more susceptible to carcinogen-induced carcinogenesis and failed to respond to certain cancer chemopreventive agents, which were effective in Nrf2 wild-type mice (13–15). Therefore, Nrf2 has been considered as a molecular target of cancer chemoprevention (16). Previous studies have shown that chemopreventive agent sulforaphane and 3H-1,2-dithiole-3-thione could regulate a variety of genes, including phase II genes, in a Nrf2-dependent manner (17, 18). Curcumin has also been shown to be able to induce many phase II genes as well as ARE reporter gene activities (19). Therefore, studies investigating the role of Nrf2 in curcumin-regulated gene expression may help to identify new molecular mechanisms of the cancer protective effects of curcumin. Furthermore, it will also address other possible roles of Nrf2 in cancer chemoprevention in addition to the regulation of phase II detoxification enzyme and antioxidant enzyme genes.
Gene expression profiling using genome-based Affymetrix (Santa Clara, CA) microarray is an unbiased method to identify novel molecular targets of curcumin in vivo. In the current study, the global gene expression profiles elicited by oral administration of curcumin in wild-type and Nrf2-knockout C57BL/6J mice were compared by microarray analysis. The identification of curcumin-regulated Nrf2-dependent genes will yield valuable insights into the role of Nrf2 in the curcumin-mediated gene regulation and its cancer chemopreventive effects. The current study is also the first to investigate the global gene expression profiles elicited by curcumin in an in vivo mouse model where the role of Nrf2 is also examined.
Materials and Methods
Animal and Treatment
Nrf2 knockout mice Nrf2(−/−) (C57BL/SV129) were described previously (20). Nrf2(−/−) mice were back-crossed with C57BL/6J mice (The Jackson Laboratory, Bar Harbor, ME). Mice were genotyped for Nrf2 status by PCR amplification of genomic DNA extracted from tail. PCR amplification was carried out by using primers (3′-primer, 5′-GGAATGGAAAATAGCTCCTGCC-3′; 5′-primer, 5′-GCCTGAGAGCTGTAGGCCC-3′; and lacZ primer, 5′-GGGTTTTCCCAGTCACGAC-3′). Male C57BL/6J/Nrf2(−/−) mice from third generation of back-crossing were used in this study. Age-matched male C57BL/6J mice were purchased from The Jackson Laboratory. Mice 9 to 12 weeks old were used and housed at Rutgers Animal Facility. Mice were fed AIN-76A diet (Research Diets, Inc., New Brunswick, NJ) with free access to water ad libitum under 12-hour light/dark cycles. After 1 week of acclimatization, mice were treated with curcumin (Sigma, St. Louis, MO) at a dose of 1,000 mg/kg (dissolved in 50% polyethylene glycol 400 solution at concentration of 100 mg/mL) by oral gavages. The control groups were given vehicle only (50% polyethylene glycol 400 solution). Each treatment was administrated to a group of four animals for both C57BL/6J and C57BL/6J/Nrf2(−/−) mice. Mice were sacrificed 3 and 12 hours after curcumin treatment or 3 hours after vehicle treatment (control group; Fig. 1). Livers and small intestines were removed and stored in RNA Later (Ambion, Austin, TX) solution immediately.
RNA Extraction, Microarray Hybridization, and Data Analysis
Total RNA from liver and small intestine were isolated by using a method of Trizol (Invitrogen, Carlsbad, CA) extraction coupled with the RNeasy Midi kit from Qiagen (Valencia, CA) according to the manufacturer's protocol. After RNA isolation, all the subsequent technical procedures, including quality control, concentration measurement of RNA, cDNA synthesis, and biotin labeling of cRNA, hybridization, and scanning of the arrays, were done at CINJ Core Expression Array Facility of Robert Wood Johnson Medical School (New Brunswick, NJ). Affymetrix mouse genome 430 2.0 array containing >45,101 probe sets was used to probe the global gene expression profile in mice following curcumin treatment. Each array was hybridized with cRNA derived from a pooled total RNA sample from four mice per treatment group, per time point, per organ, and per genotype (total 12 chips were used in this study; Fig. 1). After hybridization and washing, the intensity of the fluorescence of the array chips were measured by the Affymetrix GeneChip Scanner. The expression analysis file created from each sample (chip) scanning was imported into GeneSpring 6.1 software (Silicon Genetics, Redwood City, CA) for further data characterization. A new experiment was generated after importing data from the same organ in which data were normalized to the 50th percentile of all measurements on that array. Data filtration based on flags present in at least one of the samples was generated. Lists of genes that were either induced or suppressed >2-fold between treated and vehicle group of same genotype were created by filtration-on-fold function within the presented flag list. By using color-by-Venn-diagram function, lists of genes that were regulated >2-fold only in C57BL/6J mice in both liver and small intestine were created.
Quantitative Real-time PCR for Microarray Data Validation
To verify the microarray data, several genes (including the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase) from different categories were chosen for quantitative real-time PCR analyses. The specific primers for these genes were listed in Table 1. Instead of using pooled RNA from each group, RNA samples isolated from individual mice as described above were used in real-time PCR analyses. First-strand cDNA was synthesized using 4 μg total RNA following the protocol of SuperScript III First-Strand cDNA Synthesis System (Invitrogen). Real-time PCR was done as described previously (21). The gene expression was determined by normalization with control gene glyceraldehyde-3-phosphate dehydrogenase. The correlation between corresponding microarray data and real-time PCR data was validated by Spearman rank correlation method.
Gene name . | Genbank . | Forward primer (5′-3′) . | Reverse primer (5′-3′) . |
---|---|---|---|
Rho-associated coiled-coil forming kinase 2 (ROCK2) | BB761686 | TTCTGTGACCTTCAGATGGCC | TTCCCAACCAGAGCACAGCT |
PKC, μ (PKCm) | NM_008858 | AGCCCTTCAACGAGCAACAA | ACCATCCACCCTTCCTTCATC |
Inhibitor of κB kinase γ (IKKg) | NM_010547 | CTGAAAGTTGGCTGCCATGAG | GAGTGGTGAGCTGGAGCAGG |
GST, μ (GSTm) | NM_010358 | GAAGCCAGTGGCTGAATGAGA | GATGGCATTGCTCTGGGTG |
ATPase, Cu2+ transporting, α-polypeptide (ATP7A) | U03434 | TTGTGGCGGCTGGTACTTCT | CAAATGCGATGGTGGTTGC |
Heme oxygenase 1 (HO-1) | NM_010442 | CCCACCAAGTTCAAACAGCTC | AGGAAGGCGGTCTTAGCCTC |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | NM_008084 | CACCAACTGCTTAGCCCCC | TCTTCTGGGTGGCAGTGATG |
Gene name . | Genbank . | Forward primer (5′-3′) . | Reverse primer (5′-3′) . |
---|---|---|---|
Rho-associated coiled-coil forming kinase 2 (ROCK2) | BB761686 | TTCTGTGACCTTCAGATGGCC | TTCCCAACCAGAGCACAGCT |
PKC, μ (PKCm) | NM_008858 | AGCCCTTCAACGAGCAACAA | ACCATCCACCCTTCCTTCATC |
Inhibitor of κB kinase γ (IKKg) | NM_010547 | CTGAAAGTTGGCTGCCATGAG | GAGTGGTGAGCTGGAGCAGG |
GST, μ (GSTm) | NM_010358 | GAAGCCAGTGGCTGAATGAGA | GATGGCATTGCTCTGGGTG |
ATPase, Cu2+ transporting, α-polypeptide (ATP7A) | U03434 | TTGTGGCGGCTGGTACTTCT | CAAATGCGATGGTGGTTGC |
Heme oxygenase 1 (HO-1) | NM_010442 | CCCACCAAGTTCAAACAGCTC | AGGAAGGCGGTCTTAGCCTC |
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | NM_008084 | CACCAACTGCTTAGCCCCC | TCTTCTGGGTGGCAGTGATG |
Results
Curcumin-Altered Gene Expression Pattern in Mouse Liver and Small Intestine
Genes that were only regulated by curcumin in C57BL/6J mice but not in C57BL/6J/Nrf2(−/−) mice were regarded as curcumin-regulated Nrf2-dependent genes. Among these Nrf2-dependent genes, expression levels of 822 well-defined genes were either induced (664) or suppressed (158) >2-fold by curcumin only in wild-type mice liver at both time points (Fig. 2). Similar changes in gene expression profiles were also observed in the small intestine array data analysis. Compared with the results from liver sample arrays, an even smaller percentage of total probes on the array were either induced or suppressed >2-fold by curcumin regardless of Nrf2 status at both time points. Further analyses showed that 222 well-defined genes were regulated >2-fold (154 up-regulated and 68 down-regulated) in a Nrf2-dependent manner at both time points by curcumin (Fig. 2).
Curcumin-Induced Nrf2-Dependent Genes in Liver and Small Intestine
Genes that were induced only in wild-type mice but not in Nrf2(−/−) mice by curcumin were considered curcumin-induced Nrf2-dependent genes. Based on their biological functions, these genes can be classified into categories, including heat shock protein, ubiquitination and proteolysis, electron transport, detoxification enzyme, transport, cell cycle control and apoptosis, cell adhesion, kinase and phosphatase, transcription, G protein-coupled receptor, and nuclear receptor (Table 2). Among these genes, a group of curcumin-induced Nrf2-dependent phase II detoxification and antioxidant genes was identified in both liver and small intestine microarray analysis. These include quinone reductase, catalytic subunit of glutamate-cysteine ligase (γ-GCS), and thioredoxin reductase 1 genes in liver and different isoforms of glutathione S-transferase (GST), heme oxygenase 1 (HO-1), and UDP-glucuronosyltransferase 2b5 genes in small intestine.
Gene description . | Symbol . | Genbank . | Liver* . | . | Small intestine† . | . | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
. | . | . | 3 h . | 12 h . | 3 h . | 12 h . | ||||||
Heat shock protein | ||||||||||||
Heat shock protein 2 | Hspb2 | AK012780 | 3.39 | 4.71 | ||||||||
Heat shock protein 1A | Hspa1a | M12573 | 8.28 | 6.24 | 5.88 | 2.22 | ||||||
Heat shock protein 1A | Hspa1a | M12573 | 6.15 | 4.30 | 5.48 | 2.12 | ||||||
Crystallin, αB | Cryab | NM_009964 | 6.02 | 6.68 | ||||||||
Ubiquitination and proteolysis | ||||||||||||
A disintegrin and metalloproteinase domain 19 (meltrin β) | Adam19 | NM_009616 | 2.67 | 2.68 | ||||||||
Cathepsin M | Cstm | NM_022326 | 3.68 | 2.14 | ||||||||
Dipeptidylpeptidase 9 | Dpp9 | BB667346 | 2.15 | 4.83 | ||||||||
Leishmanolysin-like (metallopeptidase M8 family) | Lmln | BB182358 | 5.17 | 5.70 | ||||||||
Mucosa-associated lymphoid tissue lymphoma translocation gene 1 | Malt1 | BM239348 | 2.41 | 2.62 | ||||||||
Procollagen C-proteinase enhancer protein | Pcolce | NM_008788 | 8.12 | 10.07 | ||||||||
Proprotein convertase subtilisin/kexin type 5 | Pcsk5 | BC013068 | 11.83 | 18.73 | ||||||||
Proteaseome (prosome, macropain) 28S subunit, 3 | Psme3 | U60330 | 2.30 | 2.88 | ||||||||
Proteasome (prosome, macropain) 26S subunit, ATPase, 6 | Psmc6 | AW208944 | 2.31 | 3.02 | ||||||||
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 | Psmd11 | AA050796 | 2.67 | 3.41 | ||||||||
Proteasome (prosome, macropain) 26S subunit, ATPase, 4 | Psmc4 | NM_011874 | 2.52 | 2.60 | ||||||||
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 | Psmd9 | BG092381 | 2.39 | 2.75 | ||||||||
Ring finger protein 11 | Rnf11 | BI150320 | 2.12 | 2.24 | ||||||||
Ubiquitin fusion degradation 1 like | BB500664 | 3.28 | 2.72 | |||||||||
Ubiquitin-specific protease 30 | Usp30 | BG067690 | 3.37 | 3.93 | ||||||||
Ubiquitin-specific protease 38 | Usp38 | BG064874 | 2.43 | 2.70 | ||||||||
Ubiquitin-conjugating enzyme E2B | AK011961 | 2.31 | 2.13 | |||||||||
Coagulation factor IX | F9 | M23109 | 5.06 | 8.86 | ||||||||
Proteasome (prosome, macropain) activator, subunit 4 | BB200981 | 8.21 | 3.24 | |||||||||
Tolloid-like | Tll1 | NM_009390 | 7.80 | 3.61 | ||||||||
Transferrin receptor 2 | Trfr2 | AV027486 | 3.86 | 4.20 | ||||||||
Electron transport | ||||||||||||
Aldehyde oxidase 1 | Aox1 | NM_009676 | 2.01 | 2.47 | ||||||||
Cytochrome c oxidase, subunit VIIa 2 | Cox7a2 | BB745549 | 4.32 | 4.82 | ||||||||
Cytochrome c oxidase, subunit VIIIb | Cox8b | NM_007751 | 3.14 | 2.38 | ||||||||
Similar to cytochrome P450, 4a10 | Cyp4a10 | BC025936 | 2.02 | 2.42 | ||||||||
Thioredoxin reductase 1 | Txnrd1 | NM_015762 | 2.12 | 2.16 | ||||||||
Ubiquinol-cytochrome c reductase core protein 1 | BG864756 | 2.08 | 2.57 | |||||||||
Cytochrome P450, family 2, subfamily c, polypeptide 55 | Cyp2c55 | NM_028089 | 2.89 | 4.95 | ||||||||
Detoxification enzyme | ||||||||||||
Crystallin, ζ (quinone reductase) like 1 | Cryzl1 | AK010433 | 2.02 | 2.26 | ||||||||
Fucosyltransferase 8 | Fut8 | NM_016893 | 10.78 | 10.62 | ||||||||
Glutamate-cysteine ligase, catalytic subunit | Gclc | AW825835 | 2.41 | 4.26 | ||||||||
Methyltransferase-like 1 | Mettl1 | AI838750 | 4.28 | 5.76 | ||||||||
Sialyltransferase 10 | Siat10 | NM_018784 | 15.70 | 17.79 | ||||||||
Steroid sulfatase | Sts | NM_009293 | 2.49 | 3.33 | ||||||||
Thioredoxin interacting protein | Txnip | AF173681 | 2.94 | 2.34 | ||||||||
Carbonyl reductase 3 | Cbr3 | AK003232 | 21.68 | 13.22 | ||||||||
GST, μ1 | Gstm1 | NM_010358 | 4.42 | 11.65 | ||||||||
GST, μ1 | Gstm1 | J03952 | 2.84 | 7.90 | ||||||||
GST, μ3 | Gstm3 | J03953 | 3.72 | 5.91 | ||||||||
GST, α2 (Yc2) | Gsta2 | NM_008182 | 2.79 | 9.58 | ||||||||
GST, α3 | Gsta3 | AI172943 | 4.49 | 2.62 | ||||||||
GST, α4 | Gsta4 | NM_010357 | 3.76 | 2.49 | ||||||||
HO-1 (decycling) | Hmox1 | NM_010442 | 76.06 | 4.54 | ||||||||
UDP-glucuronosyltransferase 2 family, member 5 | Ugt2b5 | NM_009467 | 2.07 | 6.70 | ||||||||
Transport | ||||||||||||
Aquaporin 7 | Aqp7 | AB056091 | 2.38 | 3.30 | ||||||||
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 | Atp5g2 | AW413339 | 4.03 | 5.12 | ||||||||
ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 | Atp2a2 | AA245637 | 2.12 | 3.10 | ||||||||
ATPase, class II, type 9A | Atp9a | AF011336 | 2.14 | 2.60 | ||||||||
ATPase, Cu2+ transporting, α-polypeptide | Atp7a | U03434 | 4.06 | 3.10 | ||||||||
ATP-binding cassette, subfamily B (MDR/TAP), member 1A | Abcb1a | M30697 | 2.23 | 2.05 | ||||||||
ATP-binding cassette, subfamily B (MDR/TAP), member 1B | Abcb1b | NM_011075 | 7.06 | 5.18 | ||||||||
ATP-binding cassette, subfamily D (ALD), member 3 | Abcd3 | BB042134 | 2.10 | 2.37 | ||||||||
Cation channel, sperm associated 2 | Catsper2 | BB484902 | 2.18 | 2.15 | ||||||||
Chloride channel 3 | Clcn3 | BB328803 | 12.31 | 15.49 | ||||||||
Chloride channel calcium activated 1 | Clca1 | AF047838 | 7.22 | 3.48 | ||||||||
Fatty acid–binding protein 4, adipocyte | Fabp4 | BC002148 | 5.62 | 3.24 | ||||||||
FXYD domain-containing ion transport regulator 2 | Fxyd2 | NM_052823 | 3.62 | 11.19 | 4.50 | 6.00 | ||||||
Kinesin family member 5B | Kif5b | BI328541 | 2.27 | 2.41 | ||||||||
Membrane targeting (tandem) C2 domain containing 1 | Mtac2d1 | AB062282 | 8.52 | 7.72 | ||||||||
Myosin IC | Myo1c | NM_008659 | 3.28 | 2.79 | ||||||||
N-ethylmaleimide-sensitive fusion protein | Nsf | BB400581 | 2.20 | 2.95 | ||||||||
Potassium voltage-gated channel, Shab-related subfamily, member 1 | Kcnb1 | BB324482 | 6.09 | 3.17 | ||||||||
Potassium voltage-gated channel, subfamily Q, member 2 | Kcnq2 | AB000502 | 11.48 | 2.10 | ||||||||
Solute carrier family 12, member 2 | Slc12a2 | BG069505 | 2.27 | 2.71 | ||||||||
Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 | Slc13a2 | BC013493 | 5.37 | 4.68 | ||||||||
Solute carrier family 16 (monocarboxylic acid transporters), member 1 | Slc16a1 | NM_009196 | 2.25 | 8.09 | ||||||||
Solute carrier family 18 (vesicular monoamine), member 2 | Pdzk8 | BB102308 | 3.38 | 3.12 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 9 | BE197100 | 2.73 | 2.58 | |||||||||
Solute carrier family 22 (organic cation transporter), member 3 | Slc22a3 | NM_011395 | 3.51 | 5.57 | ||||||||
Solute carrier family 22 (organic cation transporter), member 5 | Slc22a5 | NM_011396 | 2.18 | 3.76 | ||||||||
Solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29 | Slc25a29 | BC006711 | 2.06 | 2.20 | ||||||||
Solute carrier family 37 (glycerol-3-phosphate transporter), member 3 | Slc37a3 | BC005744 | 2.09 | 2.49 | ||||||||
Solute carrier family 39 (zinc transporter), member 14 | Slc39a14 | BB022806 | 3.78 | 2.11 | ||||||||
Solute carrier family 6 (neurotransmitter transporter), member 14 | Slc6a14 | AF320226 | 23.50 | 19.96 | ||||||||
Solute carrier family 9 (sodium/hydrogen exchanger), member 8 | Slc9a8 | AK018301 | 2.09 | 4.70 | ||||||||
Src activating and signaling molecule | Srcasm | BC004710 | 2.08 | 2.04 | ||||||||
Syntaxin 6 | Stx6 | BB492711 | 2.78 | 3.83 | ||||||||
Transporter 2, ATP-binding cassette, subfamily B (MDR/TAP) | Tap2 | BE691515 | 2.90 | 2.12 | ||||||||
ATPase, class V, type 10A | Atp10a | BM249532 | 5.13 | 3.11 | ||||||||
Chemokine (C-C motif) ligand 7 | Ccl7 | AF128193 | 8.15 | 12.09 | ||||||||
Hemopexin | Hpxn | BC011246 | 7.84 | 32.11 | ||||||||
5-Hydroxytryptamine (serotonin) receptor 3A | Htr3a | NM_013561 | 2.74 | 2.31 | ||||||||
Major urinary protein 3 | Mup3 | M27608 | 13.25 | 102.59 | ||||||||
Solute carrier family 17 (sodium phosphate), member 1 | Slc17a1 | NM_009198 | 2.01 | 3.00 | ||||||||
Solute carrier family 34 (sodium phosphate), member 2 | Slc34a2 | NM_011402 | 2.13 | 5.54 | ||||||||
Solute carrier family 35 (UDP galactose transporter), member 2 | AU080926 | 2.14 | 2.61 | |||||||||
Solute carrier family 40 (iron-regulated transporter), member 1 | Slc40a1 | AF226613 | 2.22 | 2.43 | ||||||||
Solute carrier family 6 (neurotransmitter transporter), member 14 | Slc6a14 | AF320226 | 3.50 | 3.29 | ||||||||
Zinc finger protein 316 | Zfp316 | AV367169 | 2.34 | 2.00 | ||||||||
Solute carrier family 4, sodium bicarbonate transporter-like, member 11 | Slc4a11 | BB498904 | 3.12 | 2.49 | ||||||||
Sodium channel, voltage-gated, type IX, α-polypeptide | BB452274 | 2.72 | 4.16 | |||||||||
Apoptosis and cell cycle control | ||||||||||||
Apoptotic protease-activating factor 1 | Apaf1 | AK018076 | 16.54 | 14.58 | ||||||||
Baculoviral IAP repeat-containing 1a | Birc1a | AF135491 | 3.02 | 4.02 | ||||||||
Bcl-2-associated transcription factor 1 | Bclaf1 | BI965039 | 2.23 | 2.62 | ||||||||
Bcl-2-like | Bcl2l1 | NM_009743 | 2.98 | 3.08 | ||||||||
Cyclin-dependent kinase inhibitor 1A (p21) | Cdkn1a | AK007630 | 2.02 | 10.06 | ||||||||
Cytotoxic granule-associated RNA-binding protein 1 | Tia1 | BG518542 | 4.18 | 4.22 | ||||||||
Ring finger protein 7 | Rnf7 | AV047821 | 2.62 | 3.74 | ||||||||
Tumor necrosis factor receptor-associated factor 3 | Traf3 | U21050 | 5.78 | 4.25 | ||||||||
Transformation-related protein 53-inducible nuclear protein 1 | Trp53inp1 | AW495711 | 2.26 | 2.41 | ||||||||
Tripartite motif-containing 35 | BQ175280 | 3.80 | 3.27 | |||||||||
Tumor differentially expressed 1 | Tde1 | NM_012032 | 3.15 | 4.29 | ||||||||
CWF19-like 2, cell cycle control (Schizosaccharomyces pombe) | Cwf19l2 | AK014327 | 3.18 | 3.97 | ||||||||
Bcl-2-interacting killer-like | Biklk | NM_007546 | 3.41 | 9.60 | ||||||||
RAS like, estrogen regulated, growth inhibitor | Rerg | BC026463 | 3.81 | 2.60 | ||||||||
Cell adhesion | ||||||||||||
Cadherin 11 | Cdh11 | NM_009866 | 3.54 | 3.35 | ||||||||
Cadherin 22 | Cdh22 | AB019618 | 2.00 | 2.54 | 2.37 | 2.77 | ||||||
Cadherin 4 | Cdh4 | NM_009867 | 15.48 | 10.96 | ||||||||
Catenin α-like 1 | Catnal1 | BQ031240 | 4.49 | 4.74 | ||||||||
Catenin src | Catns | NM_007615 | 2.15 | 3.08 | ||||||||
Contactin-associated protein 1 | Cntnap1 | NM_016782 | 4.56 | 4.75 | ||||||||
Integrin α8 | Itga8 | BB623587 | 6.71 | 6.44 | ||||||||
Laminin, β3 | Lamb3 | NM_008484 | 2.41 | 5.53 | ||||||||
Neurotrimin | AF282980 | 0.49 | 0.43 | |||||||||
Osteomodulin | Omd | NM_012050 | 3.11 | 3.01 | ||||||||
Protocadherin 18 | Pcdh18 | BM218630 | 2.83 | 3.78 | ||||||||
Fibronectin leucine-rich transmembrane protein 2 | Flrt2 | BB817332 | 11.38 | 5.14 | ||||||||
Procollagen, type IX, α1 | Col9a1 | AK004383 | 3.33 | 2.32 | ||||||||
Thrombospondin 2 | Thbs2 | BB233297 | 2.06 | 2.51 | ||||||||
Kinase and phosphatase | ||||||||||||
Casein kinase II, α1 polypeptide | Csnk2a1 | BB283759 | 3.85 | 2.07 | ||||||||
Induced in fatty liver dystrophy 2 | BB508622 | 3.68 | 5.71 | |||||||||
Keratin complex 2, basic, gene 8 | Krt2-8 | AW322280 | 2.49 | 2.56 | ||||||||
MAPK-activated protein kinase 2 | Mapkapk2 | BG918951 | 2.07 | 2.84 | ||||||||
Microtubule-associated serine/threonine kinase 2 | Mast2 | BB367890 | 5.34 | 12.50 | ||||||||
MAPK kinase kinase 12 | Map3k12 | NM_009582 | 3.57 | 2.70 | ||||||||
MAPK 8 interacting protein 3 | Mapkip8 | AF178636 | 3.41 | 4.28 | ||||||||
MAPK kinase kinase kinase 4 | Map4k4 | NM_008696 | 3.71 | 4.24 | ||||||||
MAPK kinase kinase kinase 5 | Map4k5 | BG067961 | 8.29 | 7.17 | ||||||||
PCTAIRE-motif protein kinase 1 | Pctk1 | AW539955 | 6.66 | 5.81 | ||||||||
PKC, α | BB355213 | 4.49 | 4.04 | |||||||||
Protein kinase, cAMP-dependent regulatory, type IIβ | Prkar2b | BB216074 | 26.47 | 4.75 | ||||||||
Proviral integration site 2 | NM_138606 | 2.00 | 2.45 | |||||||||
Regulator of G protein signaling 19 | Rgs19 | BC003838 | 2.09 | 2.49 | ||||||||
Rho-associated coiled-coil forming kinase 1 | Rock1 | BI662863 | 2.15 | 3.07 | ||||||||
Rho-associated coiled-coil forming kinase 2 | Rock2 | BB761686 | 3.07 | 2.54 | ||||||||
Ribosomal protein S6 kinase, polypeptide 5 | Rps6ka5 | BQ174267 | 2.65 | 2.39 | ||||||||
Serine/threonine kinase 17b (apoptosis inducing) | Stk17b | AV173139 | 3.05 | 2.53 | ||||||||
Serum/glucocorticoid-regulated kinase 3 | Sgk3 | BB768208 | 6.68 | 6.67 | ||||||||
SNF1-like kinase | Snf1lk | AI648260 | 7.55 | 9.82 | ||||||||
Testis-specific protein kinase 1 | Tesk1 | NM_011571 | 2.05 | 2.28 | ||||||||
Tousled-like kinase 2 (Arabidopsis) | Tlk2 | NM_011903 | 2.48 | 2.81 | ||||||||
Dual specificity phosphatase 6 | Dusp6 | NM_026268 | 2.45 | 2.18 | ||||||||
Eyes absent 3 homologue (Drosophila) | Eya3 | BB428881 | 2.94 | 3.12 | ||||||||
Paladin | NM_013753 | 2.14 | 2.53 | |||||||||
Protein tyrosine phosphatase, nonreceptor type 21 | Ptpn21 | AW987375 | 7.44 | 13.85 | ||||||||
PKC, μ | Prkcm | NM_008858 | 2.22 | 2.04 | ||||||||
Keratin complex 2, basic, gene 8 | Krt2-18 | NM_016879 | 2.85 | 2.29 | ||||||||
MAPK kinase kinase 10 | Map3k10 | AA789425 | 10.02 | 7.37 | ||||||||
Dual specificity phosphatase 4 | Dusp4 | AK012530 | 2.65 | 2.00 | ||||||||
G protein-coupled receptors | ||||||||||||
G protein-coupled receptor 65 | Gpr65 | NM_008152 | 6.34 | 5.32 | ||||||||
Endothelial differentiation, sphingolipid G protein-coupled receptor, 8 | Edg8 | NM_053190 | 4.92 | 3.92 | ||||||||
Endothelin receptor type A | Ednra | BC008277 | 9.12 | 10.42 | ||||||||
Endothelin receptor type A | Ednra | AW558570 | 7.84 | 7.60 | ||||||||
Transcription factors | ||||||||||||
Ankyrin repeat domain 1 (cardiac muscle) | Ankrd1 | AK009959 | 2.12 | 2.88 | ||||||||
Basic transcription element-binding protein 1 | Bteb1 | NM_010638 | 2.90 | 3.54 | ||||||||
cAMP-responsive element modulator | Crem | AU258667 | 9.73 | 6.29 | ||||||||
cAMP-responsive element modulator | Crem | AI467599 | 2.58 | 2.56 | ||||||||
cAMP-responsive element–binding protein–binding protein | BG076163 | 5.62 | 10.55 | |||||||||
cAMP-responsive element–binding protein–binding protein/EP300 inhibitory protein 1 | Cri1 | BC010712 | 2.05 | 2.19 | ||||||||
E4F transcription factor 1 | E4f1 | NM_007893 | 3.69 | 3.50 | ||||||||
E74-like factor 1 | Elf1 | NM_007920 | 2.06 | 2.22 | ||||||||
Early growth response 1 | Egr1 | NM_007913 | 4.19 | 5.06 | ||||||||
Ewing sarcoma homologue | Ewsr1 | AW610680 | 10.50 | 5.63 | ||||||||
Forkhead box N2 | Foxn2 | AV295543 | 3.34 | 2.75 | ||||||||
Forkhead box P1 | Foxp1 | BG962849 | 2.71 | 3.65 | ||||||||
Heterogeneous nuclear ribonucleoprotein A/B | Hnrpab | AK013709 | 6.55 | 7.28 | ||||||||
Heterogeneous nuclear ribonucleoprotein R | Hnrpr | BB251000 | 2.50 | 2.10 | ||||||||
Homeobox C8 | Hoxc8 | BB283726 | 4.83 | 2.57 | ||||||||
Homeodomain leucine zipper-encoding gene | AV298304 | 7.72 | 8.52 | |||||||||
Inhibitor of κB kinase γ | Ikbkg | BB147462 | 2.73 | 3.55 | ||||||||
Inhibitor of κB kinase γ | Ikbkg | NM_010547 | 2.12 | 2.83 | ||||||||
Kruppel-like factor 7 (ubiquitous) | Klf7 | BB524597 | 2.09 | 2.97 | ||||||||
LIM homeobox protein 9 | Lhx9 | AK013209 | 3.23 | 5.88 | ||||||||
Longevity assurance homologue 4 (Saccharomyces cerevisiae) | Lass4 | BB006809 | 3.18 | 9.26 | ||||||||
Nuclear factor, interleukin 3, regulated | Nfil3 | AY061760 | 2.13 | 3.52 | ||||||||
Nuclear receptor subfamily 2, group C, member 2 | Nr2c2 | AU066920 | 2.22 | 2.60 | ||||||||
Retinoid X receptor γ | Rxrg | NM_009107 | 2.63 | 2.94 | ||||||||
SCAN-KRAB-zinc finger gene 1 | Zpf306 | BC007473 | 2.21 | 3.91 | ||||||||
Suppressor of K+ transport defect 3 | Skd3 | NM_009191 | 2.80 | 2.76 | ||||||||
TAF5 RNA polymerase II, TATA box-binding protein–associated factor | Taf5 | AV117817 | 2.96 | 3.90 | ||||||||
TAR DNA-binding protein | Tardbp | BC012873 | 2.63 | 3.96 | ||||||||
Transforming growth factor-β-inducible early growth response 1 | Tieg1 | NM_013692 | 2.76 | 3.52 | ||||||||
Transcription factor 12 | Tcf12 | BB540782 | 2.79 | 2.86 | ||||||||
Transcription factor 20 | Tcf20 | AW552808 | 2.22 | 2.14 | ||||||||
Transcription factor 3 | Tcf3 | NM_009332 | 4.44 | 5.08 | ||||||||
Zinc finger proliferation 1 | Zipro1 | AI326272 | 4.02 | 7.65 | ||||||||
Zinc finger protein 148 | Zfp148 | X98096 | 2.11 | 2.29 | ||||||||
Zinc finger protein 207 | Zfp207 | AV338324 | 2.16 | 2.11 | ||||||||
Zinc finger protein 263 | Zfp263 | AI326880 | 3.02 | 2.96 | ||||||||
Zinc finger protein 319 | Zfp319 | BB476317 | 5.45 | 5.41 | ||||||||
Zinc finger protein 354C | Zfp354c | NM_013922 | 3.33 | 3.73 | ||||||||
Zinc fingers and homeoboxes 3 | Zhx3 | BE952825 | 6.37 | 7.45 | ||||||||
Ankyrin repeat domain 1 (cardiac muscle) | Ankrd1 | AK009959 | 3.82 | 16.77 | ||||||||
CBFA2T1 identified gene homologue (human) | Cbfa2t1h | BG072085 | 19.43 | 12.24 | ||||||||
E4F transcription factor 1 | BB027397 | 7.90 | 9.35 | |||||||||
Myeloid ecotropic viral integration site 1 | Meis1 | AW547821 | 4.31 | 3.67 | ||||||||
POU domain, class 2, transcription factor 2 | Pou2f2 | X57938 | 12.27 | 12.47 | ||||||||
Runt-related transcription factor 1 | Runx1 | NM_009821 | 2.24 | 2.64 | ||||||||
Transforming growth factor-β1-induced transcript 4 | Tgfbli4 | AW413169 | 9.17 | 4.53 | ||||||||
Zinc finger protein 2 | Zfp2 | NM_009550 | 6.84 | 3.90 | ||||||||
Zinc finger protein 37 | Zfp37 | NM_009554 | 7.84 | 5.46 | ||||||||
Zinc finger protein 68 | Zfp68 | NM_013844 | 2.03 | 3.15 | ||||||||
Others | ||||||||||||
Amyloid-β (A4) precursor protein binding, family B, member 3 | Apbb3 | BC024809 | 2.37 | 2.33 | ||||||||
Aryl hydrocarbon receptor nuclear translocator like | Arntl | BC011080 | 5.12 | 21.26 | ||||||||
Breast cancer metastasis suppressor 1 | Brms1 | NM_134155 | 2.04 | 4.57 | ||||||||
Peroxisome proliferator-activated receptor–binding protein | Pparbp | NM_134027 | 2.56 | 2.63 | ||||||||
Suppression of tumorigenicity 7 | St7 | NM_022332 | 2.08 | 3.75 | ||||||||
Suppressor of cytokine signaling 6 | Socs6 | NM_018821 | 2.31 | 2.28 | ||||||||
Suppressor of cytokine signaling 4 | Socs4 | AK014988 | 2.72 | 2.09 | ||||||||
Tumor necrosis factor receptor-associated factor 6 | Traf6 | AV244412 | 2.22 | 2.14 |
Gene description . | Symbol . | Genbank . | Liver* . | . | Small intestine† . | . | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
. | . | . | 3 h . | 12 h . | 3 h . | 12 h . | ||||||
Heat shock protein | ||||||||||||
Heat shock protein 2 | Hspb2 | AK012780 | 3.39 | 4.71 | ||||||||
Heat shock protein 1A | Hspa1a | M12573 | 8.28 | 6.24 | 5.88 | 2.22 | ||||||
Heat shock protein 1A | Hspa1a | M12573 | 6.15 | 4.30 | 5.48 | 2.12 | ||||||
Crystallin, αB | Cryab | NM_009964 | 6.02 | 6.68 | ||||||||
Ubiquitination and proteolysis | ||||||||||||
A disintegrin and metalloproteinase domain 19 (meltrin β) | Adam19 | NM_009616 | 2.67 | 2.68 | ||||||||
Cathepsin M | Cstm | NM_022326 | 3.68 | 2.14 | ||||||||
Dipeptidylpeptidase 9 | Dpp9 | BB667346 | 2.15 | 4.83 | ||||||||
Leishmanolysin-like (metallopeptidase M8 family) | Lmln | BB182358 | 5.17 | 5.70 | ||||||||
Mucosa-associated lymphoid tissue lymphoma translocation gene 1 | Malt1 | BM239348 | 2.41 | 2.62 | ||||||||
Procollagen C-proteinase enhancer protein | Pcolce | NM_008788 | 8.12 | 10.07 | ||||||||
Proprotein convertase subtilisin/kexin type 5 | Pcsk5 | BC013068 | 11.83 | 18.73 | ||||||||
Proteaseome (prosome, macropain) 28S subunit, 3 | Psme3 | U60330 | 2.30 | 2.88 | ||||||||
Proteasome (prosome, macropain) 26S subunit, ATPase, 6 | Psmc6 | AW208944 | 2.31 | 3.02 | ||||||||
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 | Psmd11 | AA050796 | 2.67 | 3.41 | ||||||||
Proteasome (prosome, macropain) 26S subunit, ATPase, 4 | Psmc4 | NM_011874 | 2.52 | 2.60 | ||||||||
Proteasome (prosome, macropain) 26S subunit, non-ATPase, 9 | Psmd9 | BG092381 | 2.39 | 2.75 | ||||||||
Ring finger protein 11 | Rnf11 | BI150320 | 2.12 | 2.24 | ||||||||
Ubiquitin fusion degradation 1 like | BB500664 | 3.28 | 2.72 | |||||||||
Ubiquitin-specific protease 30 | Usp30 | BG067690 | 3.37 | 3.93 | ||||||||
Ubiquitin-specific protease 38 | Usp38 | BG064874 | 2.43 | 2.70 | ||||||||
Ubiquitin-conjugating enzyme E2B | AK011961 | 2.31 | 2.13 | |||||||||
Coagulation factor IX | F9 | M23109 | 5.06 | 8.86 | ||||||||
Proteasome (prosome, macropain) activator, subunit 4 | BB200981 | 8.21 | 3.24 | |||||||||
Tolloid-like | Tll1 | NM_009390 | 7.80 | 3.61 | ||||||||
Transferrin receptor 2 | Trfr2 | AV027486 | 3.86 | 4.20 | ||||||||
Electron transport | ||||||||||||
Aldehyde oxidase 1 | Aox1 | NM_009676 | 2.01 | 2.47 | ||||||||
Cytochrome c oxidase, subunit VIIa 2 | Cox7a2 | BB745549 | 4.32 | 4.82 | ||||||||
Cytochrome c oxidase, subunit VIIIb | Cox8b | NM_007751 | 3.14 | 2.38 | ||||||||
Similar to cytochrome P450, 4a10 | Cyp4a10 | BC025936 | 2.02 | 2.42 | ||||||||
Thioredoxin reductase 1 | Txnrd1 | NM_015762 | 2.12 | 2.16 | ||||||||
Ubiquinol-cytochrome c reductase core protein 1 | BG864756 | 2.08 | 2.57 | |||||||||
Cytochrome P450, family 2, subfamily c, polypeptide 55 | Cyp2c55 | NM_028089 | 2.89 | 4.95 | ||||||||
Detoxification enzyme | ||||||||||||
Crystallin, ζ (quinone reductase) like 1 | Cryzl1 | AK010433 | 2.02 | 2.26 | ||||||||
Fucosyltransferase 8 | Fut8 | NM_016893 | 10.78 | 10.62 | ||||||||
Glutamate-cysteine ligase, catalytic subunit | Gclc | AW825835 | 2.41 | 4.26 | ||||||||
Methyltransferase-like 1 | Mettl1 | AI838750 | 4.28 | 5.76 | ||||||||
Sialyltransferase 10 | Siat10 | NM_018784 | 15.70 | 17.79 | ||||||||
Steroid sulfatase | Sts | NM_009293 | 2.49 | 3.33 | ||||||||
Thioredoxin interacting protein | Txnip | AF173681 | 2.94 | 2.34 | ||||||||
Carbonyl reductase 3 | Cbr3 | AK003232 | 21.68 | 13.22 | ||||||||
GST, μ1 | Gstm1 | NM_010358 | 4.42 | 11.65 | ||||||||
GST, μ1 | Gstm1 | J03952 | 2.84 | 7.90 | ||||||||
GST, μ3 | Gstm3 | J03953 | 3.72 | 5.91 | ||||||||
GST, α2 (Yc2) | Gsta2 | NM_008182 | 2.79 | 9.58 | ||||||||
GST, α3 | Gsta3 | AI172943 | 4.49 | 2.62 | ||||||||
GST, α4 | Gsta4 | NM_010357 | 3.76 | 2.49 | ||||||||
HO-1 (decycling) | Hmox1 | NM_010442 | 76.06 | 4.54 | ||||||||
UDP-glucuronosyltransferase 2 family, member 5 | Ugt2b5 | NM_009467 | 2.07 | 6.70 | ||||||||
Transport | ||||||||||||
Aquaporin 7 | Aqp7 | AB056091 | 2.38 | 3.30 | ||||||||
ATP synthase, H+ transporting, mitochondrial F0 complex, subunit c (subunit 9), isoform 2 | Atp5g2 | AW413339 | 4.03 | 5.12 | ||||||||
ATPase, Ca2+ transporting, cardiac muscle, slow twitch 2 | Atp2a2 | AA245637 | 2.12 | 3.10 | ||||||||
ATPase, class II, type 9A | Atp9a | AF011336 | 2.14 | 2.60 | ||||||||
ATPase, Cu2+ transporting, α-polypeptide | Atp7a | U03434 | 4.06 | 3.10 | ||||||||
ATP-binding cassette, subfamily B (MDR/TAP), member 1A | Abcb1a | M30697 | 2.23 | 2.05 | ||||||||
ATP-binding cassette, subfamily B (MDR/TAP), member 1B | Abcb1b | NM_011075 | 7.06 | 5.18 | ||||||||
ATP-binding cassette, subfamily D (ALD), member 3 | Abcd3 | BB042134 | 2.10 | 2.37 | ||||||||
Cation channel, sperm associated 2 | Catsper2 | BB484902 | 2.18 | 2.15 | ||||||||
Chloride channel 3 | Clcn3 | BB328803 | 12.31 | 15.49 | ||||||||
Chloride channel calcium activated 1 | Clca1 | AF047838 | 7.22 | 3.48 | ||||||||
Fatty acid–binding protein 4, adipocyte | Fabp4 | BC002148 | 5.62 | 3.24 | ||||||||
FXYD domain-containing ion transport regulator 2 | Fxyd2 | NM_052823 | 3.62 | 11.19 | 4.50 | 6.00 | ||||||
Kinesin family member 5B | Kif5b | BI328541 | 2.27 | 2.41 | ||||||||
Membrane targeting (tandem) C2 domain containing 1 | Mtac2d1 | AB062282 | 8.52 | 7.72 | ||||||||
Myosin IC | Myo1c | NM_008659 | 3.28 | 2.79 | ||||||||
N-ethylmaleimide-sensitive fusion protein | Nsf | BB400581 | 2.20 | 2.95 | ||||||||
Potassium voltage-gated channel, Shab-related subfamily, member 1 | Kcnb1 | BB324482 | 6.09 | 3.17 | ||||||||
Potassium voltage-gated channel, subfamily Q, member 2 | Kcnq2 | AB000502 | 11.48 | 2.10 | ||||||||
Solute carrier family 12, member 2 | Slc12a2 | BG069505 | 2.27 | 2.71 | ||||||||
Solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 2 | Slc13a2 | BC013493 | 5.37 | 4.68 | ||||||||
Solute carrier family 16 (monocarboxylic acid transporters), member 1 | Slc16a1 | NM_009196 | 2.25 | 8.09 | ||||||||
Solute carrier family 18 (vesicular monoamine), member 2 | Pdzk8 | BB102308 | 3.38 | 3.12 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 9 | BE197100 | 2.73 | 2.58 | |||||||||
Solute carrier family 22 (organic cation transporter), member 3 | Slc22a3 | NM_011395 | 3.51 | 5.57 | ||||||||
Solute carrier family 22 (organic cation transporter), member 5 | Slc22a5 | NM_011396 | 2.18 | 3.76 | ||||||||
Solute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29 | Slc25a29 | BC006711 | 2.06 | 2.20 | ||||||||
Solute carrier family 37 (glycerol-3-phosphate transporter), member 3 | Slc37a3 | BC005744 | 2.09 | 2.49 | ||||||||
Solute carrier family 39 (zinc transporter), member 14 | Slc39a14 | BB022806 | 3.78 | 2.11 | ||||||||
Solute carrier family 6 (neurotransmitter transporter), member 14 | Slc6a14 | AF320226 | 23.50 | 19.96 | ||||||||
Solute carrier family 9 (sodium/hydrogen exchanger), member 8 | Slc9a8 | AK018301 | 2.09 | 4.70 | ||||||||
Src activating and signaling molecule | Srcasm | BC004710 | 2.08 | 2.04 | ||||||||
Syntaxin 6 | Stx6 | BB492711 | 2.78 | 3.83 | ||||||||
Transporter 2, ATP-binding cassette, subfamily B (MDR/TAP) | Tap2 | BE691515 | 2.90 | 2.12 | ||||||||
ATPase, class V, type 10A | Atp10a | BM249532 | 5.13 | 3.11 | ||||||||
Chemokine (C-C motif) ligand 7 | Ccl7 | AF128193 | 8.15 | 12.09 | ||||||||
Hemopexin | Hpxn | BC011246 | 7.84 | 32.11 | ||||||||
5-Hydroxytryptamine (serotonin) receptor 3A | Htr3a | NM_013561 | 2.74 | 2.31 | ||||||||
Major urinary protein 3 | Mup3 | M27608 | 13.25 | 102.59 | ||||||||
Solute carrier family 17 (sodium phosphate), member 1 | Slc17a1 | NM_009198 | 2.01 | 3.00 | ||||||||
Solute carrier family 34 (sodium phosphate), member 2 | Slc34a2 | NM_011402 | 2.13 | 5.54 | ||||||||
Solute carrier family 35 (UDP galactose transporter), member 2 | AU080926 | 2.14 | 2.61 | |||||||||
Solute carrier family 40 (iron-regulated transporter), member 1 | Slc40a1 | AF226613 | 2.22 | 2.43 | ||||||||
Solute carrier family 6 (neurotransmitter transporter), member 14 | Slc6a14 | AF320226 | 3.50 | 3.29 | ||||||||
Zinc finger protein 316 | Zfp316 | AV367169 | 2.34 | 2.00 | ||||||||
Solute carrier family 4, sodium bicarbonate transporter-like, member 11 | Slc4a11 | BB498904 | 3.12 | 2.49 | ||||||||
Sodium channel, voltage-gated, type IX, α-polypeptide | BB452274 | 2.72 | 4.16 | |||||||||
Apoptosis and cell cycle control | ||||||||||||
Apoptotic protease-activating factor 1 | Apaf1 | AK018076 | 16.54 | 14.58 | ||||||||
Baculoviral IAP repeat-containing 1a | Birc1a | AF135491 | 3.02 | 4.02 | ||||||||
Bcl-2-associated transcription factor 1 | Bclaf1 | BI965039 | 2.23 | 2.62 | ||||||||
Bcl-2-like | Bcl2l1 | NM_009743 | 2.98 | 3.08 | ||||||||
Cyclin-dependent kinase inhibitor 1A (p21) | Cdkn1a | AK007630 | 2.02 | 10.06 | ||||||||
Cytotoxic granule-associated RNA-binding protein 1 | Tia1 | BG518542 | 4.18 | 4.22 | ||||||||
Ring finger protein 7 | Rnf7 | AV047821 | 2.62 | 3.74 | ||||||||
Tumor necrosis factor receptor-associated factor 3 | Traf3 | U21050 | 5.78 | 4.25 | ||||||||
Transformation-related protein 53-inducible nuclear protein 1 | Trp53inp1 | AW495711 | 2.26 | 2.41 | ||||||||
Tripartite motif-containing 35 | BQ175280 | 3.80 | 3.27 | |||||||||
Tumor differentially expressed 1 | Tde1 | NM_012032 | 3.15 | 4.29 | ||||||||
CWF19-like 2, cell cycle control (Schizosaccharomyces pombe) | Cwf19l2 | AK014327 | 3.18 | 3.97 | ||||||||
Bcl-2-interacting killer-like | Biklk | NM_007546 | 3.41 | 9.60 | ||||||||
RAS like, estrogen regulated, growth inhibitor | Rerg | BC026463 | 3.81 | 2.60 | ||||||||
Cell adhesion | ||||||||||||
Cadherin 11 | Cdh11 | NM_009866 | 3.54 | 3.35 | ||||||||
Cadherin 22 | Cdh22 | AB019618 | 2.00 | 2.54 | 2.37 | 2.77 | ||||||
Cadherin 4 | Cdh4 | NM_009867 | 15.48 | 10.96 | ||||||||
Catenin α-like 1 | Catnal1 | BQ031240 | 4.49 | 4.74 | ||||||||
Catenin src | Catns | NM_007615 | 2.15 | 3.08 | ||||||||
Contactin-associated protein 1 | Cntnap1 | NM_016782 | 4.56 | 4.75 | ||||||||
Integrin α8 | Itga8 | BB623587 | 6.71 | 6.44 | ||||||||
Laminin, β3 | Lamb3 | NM_008484 | 2.41 | 5.53 | ||||||||
Neurotrimin | AF282980 | 0.49 | 0.43 | |||||||||
Osteomodulin | Omd | NM_012050 | 3.11 | 3.01 | ||||||||
Protocadherin 18 | Pcdh18 | BM218630 | 2.83 | 3.78 | ||||||||
Fibronectin leucine-rich transmembrane protein 2 | Flrt2 | BB817332 | 11.38 | 5.14 | ||||||||
Procollagen, type IX, α1 | Col9a1 | AK004383 | 3.33 | 2.32 | ||||||||
Thrombospondin 2 | Thbs2 | BB233297 | 2.06 | 2.51 | ||||||||
Kinase and phosphatase | ||||||||||||
Casein kinase II, α1 polypeptide | Csnk2a1 | BB283759 | 3.85 | 2.07 | ||||||||
Induced in fatty liver dystrophy 2 | BB508622 | 3.68 | 5.71 | |||||||||
Keratin complex 2, basic, gene 8 | Krt2-8 | AW322280 | 2.49 | 2.56 | ||||||||
MAPK-activated protein kinase 2 | Mapkapk2 | BG918951 | 2.07 | 2.84 | ||||||||
Microtubule-associated serine/threonine kinase 2 | Mast2 | BB367890 | 5.34 | 12.50 | ||||||||
MAPK kinase kinase 12 | Map3k12 | NM_009582 | 3.57 | 2.70 | ||||||||
MAPK 8 interacting protein 3 | Mapkip8 | AF178636 | 3.41 | 4.28 | ||||||||
MAPK kinase kinase kinase 4 | Map4k4 | NM_008696 | 3.71 | 4.24 | ||||||||
MAPK kinase kinase kinase 5 | Map4k5 | BG067961 | 8.29 | 7.17 | ||||||||
PCTAIRE-motif protein kinase 1 | Pctk1 | AW539955 | 6.66 | 5.81 | ||||||||
PKC, α | BB355213 | 4.49 | 4.04 | |||||||||
Protein kinase, cAMP-dependent regulatory, type IIβ | Prkar2b | BB216074 | 26.47 | 4.75 | ||||||||
Proviral integration site 2 | NM_138606 | 2.00 | 2.45 | |||||||||
Regulator of G protein signaling 19 | Rgs19 | BC003838 | 2.09 | 2.49 | ||||||||
Rho-associated coiled-coil forming kinase 1 | Rock1 | BI662863 | 2.15 | 3.07 | ||||||||
Rho-associated coiled-coil forming kinase 2 | Rock2 | BB761686 | 3.07 | 2.54 | ||||||||
Ribosomal protein S6 kinase, polypeptide 5 | Rps6ka5 | BQ174267 | 2.65 | 2.39 | ||||||||
Serine/threonine kinase 17b (apoptosis inducing) | Stk17b | AV173139 | 3.05 | 2.53 | ||||||||
Serum/glucocorticoid-regulated kinase 3 | Sgk3 | BB768208 | 6.68 | 6.67 | ||||||||
SNF1-like kinase | Snf1lk | AI648260 | 7.55 | 9.82 | ||||||||
Testis-specific protein kinase 1 | Tesk1 | NM_011571 | 2.05 | 2.28 | ||||||||
Tousled-like kinase 2 (Arabidopsis) | Tlk2 | NM_011903 | 2.48 | 2.81 | ||||||||
Dual specificity phosphatase 6 | Dusp6 | NM_026268 | 2.45 | 2.18 | ||||||||
Eyes absent 3 homologue (Drosophila) | Eya3 | BB428881 | 2.94 | 3.12 | ||||||||
Paladin | NM_013753 | 2.14 | 2.53 | |||||||||
Protein tyrosine phosphatase, nonreceptor type 21 | Ptpn21 | AW987375 | 7.44 | 13.85 | ||||||||
PKC, μ | Prkcm | NM_008858 | 2.22 | 2.04 | ||||||||
Keratin complex 2, basic, gene 8 | Krt2-18 | NM_016879 | 2.85 | 2.29 | ||||||||
MAPK kinase kinase 10 | Map3k10 | AA789425 | 10.02 | 7.37 | ||||||||
Dual specificity phosphatase 4 | Dusp4 | AK012530 | 2.65 | 2.00 | ||||||||
G protein-coupled receptors | ||||||||||||
G protein-coupled receptor 65 | Gpr65 | NM_008152 | 6.34 | 5.32 | ||||||||
Endothelial differentiation, sphingolipid G protein-coupled receptor, 8 | Edg8 | NM_053190 | 4.92 | 3.92 | ||||||||
Endothelin receptor type A | Ednra | BC008277 | 9.12 | 10.42 | ||||||||
Endothelin receptor type A | Ednra | AW558570 | 7.84 | 7.60 | ||||||||
Transcription factors | ||||||||||||
Ankyrin repeat domain 1 (cardiac muscle) | Ankrd1 | AK009959 | 2.12 | 2.88 | ||||||||
Basic transcription element-binding protein 1 | Bteb1 | NM_010638 | 2.90 | 3.54 | ||||||||
cAMP-responsive element modulator | Crem | AU258667 | 9.73 | 6.29 | ||||||||
cAMP-responsive element modulator | Crem | AI467599 | 2.58 | 2.56 | ||||||||
cAMP-responsive element–binding protein–binding protein | BG076163 | 5.62 | 10.55 | |||||||||
cAMP-responsive element–binding protein–binding protein/EP300 inhibitory protein 1 | Cri1 | BC010712 | 2.05 | 2.19 | ||||||||
E4F transcription factor 1 | E4f1 | NM_007893 | 3.69 | 3.50 | ||||||||
E74-like factor 1 | Elf1 | NM_007920 | 2.06 | 2.22 | ||||||||
Early growth response 1 | Egr1 | NM_007913 | 4.19 | 5.06 | ||||||||
Ewing sarcoma homologue | Ewsr1 | AW610680 | 10.50 | 5.63 | ||||||||
Forkhead box N2 | Foxn2 | AV295543 | 3.34 | 2.75 | ||||||||
Forkhead box P1 | Foxp1 | BG962849 | 2.71 | 3.65 | ||||||||
Heterogeneous nuclear ribonucleoprotein A/B | Hnrpab | AK013709 | 6.55 | 7.28 | ||||||||
Heterogeneous nuclear ribonucleoprotein R | Hnrpr | BB251000 | 2.50 | 2.10 | ||||||||
Homeobox C8 | Hoxc8 | BB283726 | 4.83 | 2.57 | ||||||||
Homeodomain leucine zipper-encoding gene | AV298304 | 7.72 | 8.52 | |||||||||
Inhibitor of κB kinase γ | Ikbkg | BB147462 | 2.73 | 3.55 | ||||||||
Inhibitor of κB kinase γ | Ikbkg | NM_010547 | 2.12 | 2.83 | ||||||||
Kruppel-like factor 7 (ubiquitous) | Klf7 | BB524597 | 2.09 | 2.97 | ||||||||
LIM homeobox protein 9 | Lhx9 | AK013209 | 3.23 | 5.88 | ||||||||
Longevity assurance homologue 4 (Saccharomyces cerevisiae) | Lass4 | BB006809 | 3.18 | 9.26 | ||||||||
Nuclear factor, interleukin 3, regulated | Nfil3 | AY061760 | 2.13 | 3.52 | ||||||||
Nuclear receptor subfamily 2, group C, member 2 | Nr2c2 | AU066920 | 2.22 | 2.60 | ||||||||
Retinoid X receptor γ | Rxrg | NM_009107 | 2.63 | 2.94 | ||||||||
SCAN-KRAB-zinc finger gene 1 | Zpf306 | BC007473 | 2.21 | 3.91 | ||||||||
Suppressor of K+ transport defect 3 | Skd3 | NM_009191 | 2.80 | 2.76 | ||||||||
TAF5 RNA polymerase II, TATA box-binding protein–associated factor | Taf5 | AV117817 | 2.96 | 3.90 | ||||||||
TAR DNA-binding protein | Tardbp | BC012873 | 2.63 | 3.96 | ||||||||
Transforming growth factor-β-inducible early growth response 1 | Tieg1 | NM_013692 | 2.76 | 3.52 | ||||||||
Transcription factor 12 | Tcf12 | BB540782 | 2.79 | 2.86 | ||||||||
Transcription factor 20 | Tcf20 | AW552808 | 2.22 | 2.14 | ||||||||
Transcription factor 3 | Tcf3 | NM_009332 | 4.44 | 5.08 | ||||||||
Zinc finger proliferation 1 | Zipro1 | AI326272 | 4.02 | 7.65 | ||||||||
Zinc finger protein 148 | Zfp148 | X98096 | 2.11 | 2.29 | ||||||||
Zinc finger protein 207 | Zfp207 | AV338324 | 2.16 | 2.11 | ||||||||
Zinc finger protein 263 | Zfp263 | AI326880 | 3.02 | 2.96 | ||||||||
Zinc finger protein 319 | Zfp319 | BB476317 | 5.45 | 5.41 | ||||||||
Zinc finger protein 354C | Zfp354c | NM_013922 | 3.33 | 3.73 | ||||||||
Zinc fingers and homeoboxes 3 | Zhx3 | BE952825 | 6.37 | 7.45 | ||||||||
Ankyrin repeat domain 1 (cardiac muscle) | Ankrd1 | AK009959 | 3.82 | 16.77 | ||||||||
CBFA2T1 identified gene homologue (human) | Cbfa2t1h | BG072085 | 19.43 | 12.24 | ||||||||
E4F transcription factor 1 | BB027397 | 7.90 | 9.35 | |||||||||
Myeloid ecotropic viral integration site 1 | Meis1 | AW547821 | 4.31 | 3.67 | ||||||||
POU domain, class 2, transcription factor 2 | Pou2f2 | X57938 | 12.27 | 12.47 | ||||||||
Runt-related transcription factor 1 | Runx1 | NM_009821 | 2.24 | 2.64 | ||||||||
Transforming growth factor-β1-induced transcript 4 | Tgfbli4 | AW413169 | 9.17 | 4.53 | ||||||||
Zinc finger protein 2 | Zfp2 | NM_009550 | 6.84 | 3.90 | ||||||||
Zinc finger protein 37 | Zfp37 | NM_009554 | 7.84 | 5.46 | ||||||||
Zinc finger protein 68 | Zfp68 | NM_013844 | 2.03 | 3.15 | ||||||||
Others | ||||||||||||
Amyloid-β (A4) precursor protein binding, family B, member 3 | Apbb3 | BC024809 | 2.37 | 2.33 | ||||||||
Aryl hydrocarbon receptor nuclear translocator like | Arntl | BC011080 | 5.12 | 21.26 | ||||||||
Breast cancer metastasis suppressor 1 | Brms1 | NM_134155 | 2.04 | 4.57 | ||||||||
Peroxisome proliferator-activated receptor–binding protein | Pparbp | NM_134027 | 2.56 | 2.63 | ||||||||
Suppression of tumorigenicity 7 | St7 | NM_022332 | 2.08 | 3.75 | ||||||||
Suppressor of cytokine signaling 6 | Socs6 | NM_018821 | 2.31 | 2.28 | ||||||||
Suppressor of cytokine signaling 4 | Socs4 | AK014988 | 2.72 | 2.09 | ||||||||
Tumor necrosis factor receptor-associated factor 6 | Traf6 | AV244412 | 2.22 | 2.14 |
Genes that were induced >2-fold by curcumin only in liver of Nrf2 wild-type mice but not in liver of Nrf2 knockout mice comparing with vehicle treatment at both time points. The relative mRNA expression levels of each gene in treatment group over vehicle group (fold of change) were listed.
Genes that were induced >2-fold by curcumin only in small intestine of Nrf2 wild-type mice but not in small intestine of Nrf2 knockout mice comparing with vehicle treatment at both time points. The relative mRNA expression levels of each gene in treatment group over vehicle group (fold of change) were listed.
Surprisingly, curcumin treatment induced more genes that were not known previously as Nrf2/ARE pathway target genes than those related to Nrf2/ARE pathway in a Nrf2-dependent manner. For example, cytochrome P450 genes cyp4a10 and cyp2c55 were selectively induced in liver and small intestine, respectively. Many ubiquitination (Usp30 and Usp38) and proteolysis-related (Psmc4, Psmd9, Psme3, etc.) genes were also induced by curcumin in a Nrf2-dependent manner, especially in liver. Another major category of genes induced by curcumin in a Nrf2-dependent manner were transporter genes. Solute carrier family member genes were the major genes to be induced in both liver and small intestine. Interestingly, several ATP-binding cassette family transporter genes, such as Abcb1a, Abcb1b [multidrug resistance 1 (MDR1)], Abcd3, and Tap2 (Abcb3), also seem to be Nrf2 dependently induced by curcumin in liver. Transporter genes with function of transporting ions of Cu2+, K+, Cl, and H+ were also identified as Nrf2-dependent genes in liver. In addition to genes related to xenobiotic metabolism and excretion, genes involved in cell apoptosis, cell cycle control, cell adhesion, and signal transduction (kinase, phosphatase, and G protein-coupled receptor) were identified as targets of curcumin through Nrf2-dependent pathway. Representative genes affected in these categories include apoptotic protease-activating factor 1, cyclin-dependent kinase inhibitor 1A (p21), cadherin (Cdh4, Cdh11, and Cdh22), MAPK (Map3k12, Map4k4, and Map4k5), and G protein-coupled receptor 65, however, were mostly in liver. Curcumin treatment could also modulate many transcription-related genes in a Nrf2-dependent manner. These include cyclic AMP (cAMP)–responsive element modulator, cAMP-responsive element–binding protein–binding protein, inhibitor of κB kinase γ, and many zinc finger protein genes.
Curcumin-Suppressed Nrf2-Dependent Genes in Liver and Small Intestine
As shown in Table 3, curcumin treatment also inhibited the expression of many genes falling into similar functional categories in a Nrf2-dependent manner, although the number of genes was much smaller. Arachidonate 12-lipoxygenase gene was suppressed >2-fold by curcumin in liver. Cyp11a1 and Cyp2c50 genes were selectively inhibited in liver and small intestine, respectively. Solute carrier family genes were still the major ones in the category of transport to be suppressed in both liver and small intestine. In liver, transcription factor genes were another major category of genes being suppressed, such as forkhead box genes (Foxf2 and Foxm1), homeobox genes (Hoxb8 and Msx2), and Kruppel-like factor genes (Klf3 and Klf5).
Gene description . | Symbol . | Genbank . | Liver* . | . | Small intestine† . | . | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
. | . | . | 3 h . | 12 h . | 3 h . | 12 h . | ||||||
Ubiquitination and proteolysis | ||||||||||||
Cathepsin G | Cstg | NM_007800 | 0.27 | 0.06 | ||||||||
Mast cell protease 6 | Mcpt6 | NM_010781 | 0.46 | 0.19 | ||||||||
Matrix metalloproteinase 24 | Mmp24 | AB021226 | 0.24 | 0.35 | ||||||||
Kallikrein 26 | Klk13 | NM_010115 | 0.49 | 0.25 | ||||||||
Carboxypeptidase A4 | Cpa4 | AV294399 | 0.19 | 0.36 | ||||||||
Electron transport | ||||||||||||
Arachidonate 12-lipoxygenase | Alox12 | BB554189 | 0.33 | 0.21 | ||||||||
Cytochrome P450, family 11, subfamily a, polypeptide 1 | Cyp11a1 | C87524 | 0.38 | 0.37 | ||||||||
Interleukin-4 induced 1 | Ll4i1 | NM_010215 | 0.10 | 0.17 | ||||||||
Phosducin | Pdc | NM_024458 | 0.45 | 0.46 | ||||||||
Thioredoxin like 1 | Txnl1 | AV106191 | 0.33 | 0.20 | ||||||||
Cytochrome P450, family 2, subfamily c, polypeptide 50 | Cyp2c50 | NM_134144 | 0.14 | 0.09 | ||||||||
Transport | ||||||||||||
ATPase, aminophospholipid transporter, class I, type 8A, member 1 | Atp8a1 | AW610650 | 0.36 | 0.21 | ||||||||
ATPase, H+ transporting, V0 subunit D, isoform 2 | Atp6v0d2 | AV204216 | 0.49 | 0.43 | ||||||||
ATP-binding cassette, subfamily C (CFTR/MDR-associated protein), member 8 | Abcc8 | BB515948 | 0.47 | 0.38 | ||||||||
Fatty acid–binding protein 3, muscle and heart | Fabp3 | NM_010174 | 0.42 | 0.43 | ||||||||
γ-Aminobutyric acid-A receptor, subunit δ | Gabrd | NM_008072 | 0.50 | 0.37 | ||||||||
Glutamate receptor, ionotropic, AMPA4 (α4) | Gria4 | AV336506 | 0.11 | 0.37 | ||||||||
Potassium channel, subfamily K, member 2 | Kcnk2 | NM_010607 | 0.41 | 0.23 | ||||||||
Potassium inwardly rectifying channel, subfamily J, member 15 | Kcnj15 | BB533892 | 0.07 | 0.14 | ||||||||
Retinaldehyde-binding protein 1 | Rlbp1 | NM_020599 | 0.27 | 0.06 | ||||||||
Structural maintenance of chromosomes 2 like 1 (yeast) | Smc2l1 | BI684556 | 0.49 | 0.41 | ||||||||
Solute carrier family 12, member 1 | Slc12a1 | NM_011389 | 0.40 | 0.39 | ||||||||
Solute carrier family 15 (oligopeptide transporter), member 1 | Slc15a1 | NM_053079 | 0.46 | 0.30 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 10 | Slc2a10 | NM_130451 | 0.34 | 0.25 | ||||||||
Solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 | Slc24a1 | BC016094 | 0.44 | 0.41 | ||||||||
Synaptogyrin 1 | Syngr1 | NM_009303 | 0.41 | 0.42 | ||||||||
ATPase, H+/K+ transporting, nongastric, α-polypeptide | Atp12a | NM_138652 | 0.26 | 0.12 | ||||||||
Glutamate receptor, ionotropic, kainate 2 (β2) | BB355480 | 0.23 | 0.36 | |||||||||
Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 | Kcnn2 | NM_080465 | 0.50 | 0.31 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 4 | Slc2a4 | AB008453 | 0.47 | 0.49 | ||||||||
Solute carrier family 23 (nucleobase transporters), member 1 | Slc23a1 | AA276202 | 0.39 | 0.40 | ||||||||
Solute carrier family 34 (sodium phosphate), member 1 | Slc34a1 | AK005930 | 0.13 | 0.45 | ||||||||
Calcium channel, voltage-dependent, γ subunit 7 (Cacng7), mRNA | AF361349 | 0.42 | 0.11 | |||||||||
Cell adhesion | ||||||||||||
Desmocollin 1 | Dsc1 | NM_013504 | 0.07 | 0.24 | ||||||||
Neurotrimin | AF282980 | 0.49 | 0.43 | |||||||||
Protocadherin β16 | Pcdhb16 | BB131219 | 0.34 | 0.32 | ||||||||
Cartilage link protein 1 | Hapln1 | AF098460 | 0.09 | 0.32 | ||||||||
Putative neuronal cell adhesion molecule | Punc | BG067286 | 0.42 | 0.40 | ||||||||
Kinase and phosphatase | ||||||||||||
Interleukin-1 receptor-associated kinase 3 | Irak3 | BB497580 | 0.43 | 0.42 | ||||||||
MAPK kinase 6 | BB540608 | 0.50 | 0.30 | |||||||||
Protein kinase, cyclic guanosine 3′,5′-monophosphate-dependent, type II | Prkg2 | BB823350 | 0.48 | 0.34 | ||||||||
Protein tyrosine phosphatase, receptor type, E | Ptpre | U35368 | 0.35 | 0.44 | ||||||||
Regulator of G protein signaling 18 | Rgs18 | BB139986 | 0.48 | 0.25 | ||||||||
Tousled-like kinase 1 | Tlk1 | BM244995 | 0.35 | 0.32 | ||||||||
Wingless-related mouse mammary tumor virus integration site 6 | Wnt6 | AV308073 | 0.35 | 0.34 | ||||||||
Wingless-related mouse mammary tumor virus integration site 7A | Wnt7a | BB129109 | 0.36 | 0.45 | ||||||||
Eph receptor A3 | Epha3 | M68515 | 0.39 | 0.26 | ||||||||
Germ cell–specific gene 2 | Gsg2 | BE457839 | 0.49 | 0.34 | ||||||||
Similar to PKCζ (LOC233024), mRNA | PrkcZ | BG143376 | 0.41 | 0.37 | ||||||||
G protein-coupled receptors | ||||||||||||
5-Hydroxytryptamine (serotonin) receptor 4 | Htr4 | Y09587 | 0.10 | 0.19 | ||||||||
5-Hydroxytryptamine (serotonin) receptor 2C | Htr2c | BQ174268 | 0.42 | 0.38 | ||||||||
G protein-coupled receptor 63 | Gpr63 | BB131092 | 0.23 | 0.19 | ||||||||
Olfactory receptor 17 | Olfr17 | NM_020598 | 0.42 | 0.41 | ||||||||
Platelet-derived growth factor receptor like | Pdgfrl | AK004179 | 0.35 | 0.47 | ||||||||
Transcription factors | ||||||||||||
Ankyrin repeat and SOCs box-containing protein 5 | Asb5 | NM_029569 | 0.10 | 0.44 | ||||||||
Ankyrin repeat domain 6 | Ankrd6 | BM199504 | 0.50 | 0.39 | ||||||||
Camello-like 3 | Cml3 | NM_053097 | 0.44 | 0.38 | ||||||||
Forkhead box F2 | Foxf2 | NM_010225 | 0.24 | 0.35 | ||||||||
Forkhead box M1 | Foxm1 | BB398835 | 0.32 | 0.34 | ||||||||
Hairy/enhancer-of-split related with YRPW motif 2 | Hey2 | NM_013904 | 0.18 | 0.15 | ||||||||
Homeobox B8 | Hoxb8 | X13721 | 0.45 | 0.05 | ||||||||
Homeobox, msh-like 2 | Msx2 | AV297190 | 0.29 | 0.10 | ||||||||
Jumonji domain containing 2C | Jmjd2c | BC020180 | 0.37 | 0.36 | ||||||||
Kruppel-like factor 3 (basic) | Klf3 | BE687999 | 0.40 | 0.30 | ||||||||
Kruppel-like factor 5 | Klf5 | BC006646 | 0.30 | 0.40 | ||||||||
Paired like homeodomain factor 1 | Prop1 | NM_008936 | 0.48 | 0.30 | ||||||||
Snail homologue 2 (Drosophila) | Snai2 | NM_011415 | 0.40 | 0.42 | ||||||||
D site albumin promoter-binding protein | Dbp | BC018323 | 0.40 | 0.06 | ||||||||
Insulin promoter factor 1, homeodomain transcription factor | Lpf1 | AK020261 | 0.37 | 0.26 | ||||||||
Nuclear factor, erythroid derived 2, like 3 | Nfe2l3 | NM_010903 | 0.49 | 0.28 | ||||||||
Period homologue 3 (Drosophila) | Per3 | NM_011067 | 0.46 | 0.15 | ||||||||
Retinoic acid receptor–related orphan receptor β | Rorb | BB751387 | 0.16 | 0.38 | ||||||||
SRY box–containing gene 11 | Sox11 | BG072739 | 0.49 | 0.31 | ||||||||
SRY box–containing gene 4 | Sox4 | AI428101 | 0.31 | 2.42 | ||||||||
Zinc finger protein 354C | Zfp354c | BB024472 | 0.28 | 0.31 | ||||||||
Others | ||||||||||||
Interleukin-4 induced 1 | Il4i1 | NM_010215 | 0.10 | 0.17 | ||||||||
Chemokine (C-X-C motif) ligand 14 | Cxcl14 | AF252873 | 0.37 | 0.47 | ||||||||
Vitamin D receptor | Vdr | AV290079 | 0.12 | 0.50 |
Gene description . | Symbol . | Genbank . | Liver* . | . | Small intestine† . | . | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
. | . | . | 3 h . | 12 h . | 3 h . | 12 h . | ||||||
Ubiquitination and proteolysis | ||||||||||||
Cathepsin G | Cstg | NM_007800 | 0.27 | 0.06 | ||||||||
Mast cell protease 6 | Mcpt6 | NM_010781 | 0.46 | 0.19 | ||||||||
Matrix metalloproteinase 24 | Mmp24 | AB021226 | 0.24 | 0.35 | ||||||||
Kallikrein 26 | Klk13 | NM_010115 | 0.49 | 0.25 | ||||||||
Carboxypeptidase A4 | Cpa4 | AV294399 | 0.19 | 0.36 | ||||||||
Electron transport | ||||||||||||
Arachidonate 12-lipoxygenase | Alox12 | BB554189 | 0.33 | 0.21 | ||||||||
Cytochrome P450, family 11, subfamily a, polypeptide 1 | Cyp11a1 | C87524 | 0.38 | 0.37 | ||||||||
Interleukin-4 induced 1 | Ll4i1 | NM_010215 | 0.10 | 0.17 | ||||||||
Phosducin | Pdc | NM_024458 | 0.45 | 0.46 | ||||||||
Thioredoxin like 1 | Txnl1 | AV106191 | 0.33 | 0.20 | ||||||||
Cytochrome P450, family 2, subfamily c, polypeptide 50 | Cyp2c50 | NM_134144 | 0.14 | 0.09 | ||||||||
Transport | ||||||||||||
ATPase, aminophospholipid transporter, class I, type 8A, member 1 | Atp8a1 | AW610650 | 0.36 | 0.21 | ||||||||
ATPase, H+ transporting, V0 subunit D, isoform 2 | Atp6v0d2 | AV204216 | 0.49 | 0.43 | ||||||||
ATP-binding cassette, subfamily C (CFTR/MDR-associated protein), member 8 | Abcc8 | BB515948 | 0.47 | 0.38 | ||||||||
Fatty acid–binding protein 3, muscle and heart | Fabp3 | NM_010174 | 0.42 | 0.43 | ||||||||
γ-Aminobutyric acid-A receptor, subunit δ | Gabrd | NM_008072 | 0.50 | 0.37 | ||||||||
Glutamate receptor, ionotropic, AMPA4 (α4) | Gria4 | AV336506 | 0.11 | 0.37 | ||||||||
Potassium channel, subfamily K, member 2 | Kcnk2 | NM_010607 | 0.41 | 0.23 | ||||||||
Potassium inwardly rectifying channel, subfamily J, member 15 | Kcnj15 | BB533892 | 0.07 | 0.14 | ||||||||
Retinaldehyde-binding protein 1 | Rlbp1 | NM_020599 | 0.27 | 0.06 | ||||||||
Structural maintenance of chromosomes 2 like 1 (yeast) | Smc2l1 | BI684556 | 0.49 | 0.41 | ||||||||
Solute carrier family 12, member 1 | Slc12a1 | NM_011389 | 0.40 | 0.39 | ||||||||
Solute carrier family 15 (oligopeptide transporter), member 1 | Slc15a1 | NM_053079 | 0.46 | 0.30 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 10 | Slc2a10 | NM_130451 | 0.34 | 0.25 | ||||||||
Solute carrier family 24 (sodium/potassium/calcium exchanger), member 1 | Slc24a1 | BC016094 | 0.44 | 0.41 | ||||||||
Synaptogyrin 1 | Syngr1 | NM_009303 | 0.41 | 0.42 | ||||||||
ATPase, H+/K+ transporting, nongastric, α-polypeptide | Atp12a | NM_138652 | 0.26 | 0.12 | ||||||||
Glutamate receptor, ionotropic, kainate 2 (β2) | BB355480 | 0.23 | 0.36 | |||||||||
Potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2 | Kcnn2 | NM_080465 | 0.50 | 0.31 | ||||||||
Solute carrier family 2 (facilitated glucose transporter), member 4 | Slc2a4 | AB008453 | 0.47 | 0.49 | ||||||||
Solute carrier family 23 (nucleobase transporters), member 1 | Slc23a1 | AA276202 | 0.39 | 0.40 | ||||||||
Solute carrier family 34 (sodium phosphate), member 1 | Slc34a1 | AK005930 | 0.13 | 0.45 | ||||||||
Calcium channel, voltage-dependent, γ subunit 7 (Cacng7), mRNA | AF361349 | 0.42 | 0.11 | |||||||||
Cell adhesion | ||||||||||||
Desmocollin 1 | Dsc1 | NM_013504 | 0.07 | 0.24 | ||||||||
Neurotrimin | AF282980 | 0.49 | 0.43 | |||||||||
Protocadherin β16 | Pcdhb16 | BB131219 | 0.34 | 0.32 | ||||||||
Cartilage link protein 1 | Hapln1 | AF098460 | 0.09 | 0.32 | ||||||||
Putative neuronal cell adhesion molecule | Punc | BG067286 | 0.42 | 0.40 | ||||||||
Kinase and phosphatase | ||||||||||||
Interleukin-1 receptor-associated kinase 3 | Irak3 | BB497580 | 0.43 | 0.42 | ||||||||
MAPK kinase 6 | BB540608 | 0.50 | 0.30 | |||||||||
Protein kinase, cyclic guanosine 3′,5′-monophosphate-dependent, type II | Prkg2 | BB823350 | 0.48 | 0.34 | ||||||||
Protein tyrosine phosphatase, receptor type, E | Ptpre | U35368 | 0.35 | 0.44 | ||||||||
Regulator of G protein signaling 18 | Rgs18 | BB139986 | 0.48 | 0.25 | ||||||||
Tousled-like kinase 1 | Tlk1 | BM244995 | 0.35 | 0.32 | ||||||||
Wingless-related mouse mammary tumor virus integration site 6 | Wnt6 | AV308073 | 0.35 | 0.34 | ||||||||
Wingless-related mouse mammary tumor virus integration site 7A | Wnt7a | BB129109 | 0.36 | 0.45 | ||||||||
Eph receptor A3 | Epha3 | M68515 | 0.39 | 0.26 | ||||||||
Germ cell–specific gene 2 | Gsg2 | BE457839 | 0.49 | 0.34 | ||||||||
Similar to PKCζ (LOC233024), mRNA | PrkcZ | BG143376 | 0.41 | 0.37 | ||||||||
G protein-coupled receptors | ||||||||||||
5-Hydroxytryptamine (serotonin) receptor 4 | Htr4 | Y09587 | 0.10 | 0.19 | ||||||||
5-Hydroxytryptamine (serotonin) receptor 2C | Htr2c | BQ174268 | 0.42 | 0.38 | ||||||||
G protein-coupled receptor 63 | Gpr63 | BB131092 | 0.23 | 0.19 | ||||||||
Olfactory receptor 17 | Olfr17 | NM_020598 | 0.42 | 0.41 | ||||||||
Platelet-derived growth factor receptor like | Pdgfrl | AK004179 | 0.35 | 0.47 | ||||||||
Transcription factors | ||||||||||||
Ankyrin repeat and SOCs box-containing protein 5 | Asb5 | NM_029569 | 0.10 | 0.44 | ||||||||
Ankyrin repeat domain 6 | Ankrd6 | BM199504 | 0.50 | 0.39 | ||||||||
Camello-like 3 | Cml3 | NM_053097 | 0.44 | 0.38 | ||||||||
Forkhead box F2 | Foxf2 | NM_010225 | 0.24 | 0.35 | ||||||||
Forkhead box M1 | Foxm1 | BB398835 | 0.32 | 0.34 | ||||||||
Hairy/enhancer-of-split related with YRPW motif 2 | Hey2 | NM_013904 | 0.18 | 0.15 | ||||||||
Homeobox B8 | Hoxb8 | X13721 | 0.45 | 0.05 | ||||||||
Homeobox, msh-like 2 | Msx2 | AV297190 | 0.29 | 0.10 | ||||||||
Jumonji domain containing 2C | Jmjd2c | BC020180 | 0.37 | 0.36 | ||||||||
Kruppel-like factor 3 (basic) | Klf3 | BE687999 | 0.40 | 0.30 | ||||||||
Kruppel-like factor 5 | Klf5 | BC006646 | 0.30 | 0.40 | ||||||||
Paired like homeodomain factor 1 | Prop1 | NM_008936 | 0.48 | 0.30 | ||||||||
Snail homologue 2 (Drosophila) | Snai2 | NM_011415 | 0.40 | 0.42 | ||||||||
D site albumin promoter-binding protein | Dbp | BC018323 | 0.40 | 0.06 | ||||||||
Insulin promoter factor 1, homeodomain transcription factor | Lpf1 | AK020261 | 0.37 | 0.26 | ||||||||
Nuclear factor, erythroid derived 2, like 3 | Nfe2l3 | NM_010903 | 0.49 | 0.28 | ||||||||
Period homologue 3 (Drosophila) | Per3 | NM_011067 | 0.46 | 0.15 | ||||||||
Retinoic acid receptor–related orphan receptor β | Rorb | BB751387 | 0.16 | 0.38 | ||||||||
SRY box–containing gene 11 | Sox11 | BG072739 | 0.49 | 0.31 | ||||||||
SRY box–containing gene 4 | Sox4 | AI428101 | 0.31 | 2.42 | ||||||||
Zinc finger protein 354C | Zfp354c | BB024472 | 0.28 | 0.31 | ||||||||
Others | ||||||||||||
Interleukin-4 induced 1 | Il4i1 | NM_010215 | 0.10 | 0.17 | ||||||||
Chemokine (C-X-C motif) ligand 14 | Cxcl14 | AF252873 | 0.37 | 0.47 | ||||||||
Vitamin D receptor | Vdr | AV290079 | 0.12 | 0.50 |
Genes that were suppressed >2-fold by curcumin only in liver of Nrf2 wild-type mice but not in liver of Nrf2 knockout mice comparing with vehicle treatment at both time points. The relative mRNA expression levels of each gene in treatment group over vehicle group (fold of change) were listed.
Genes that were suppressed >2-fold by curcumin only in small intestine of Nrf2 wild-type mice but not in small intestine of Nrf2 knockout mice comparing with vehicle treatment at both time points. The relative mRNA expression levels of each gene in treatment group over vehicle group (fold of change) were listed.
Quantitative Real-time PCR Validation of Microarray Data
To verify the data generated from the microarray, seven genes from different categories (Table 1) were chosen to confirm the curcumin regulation effects by using quantitative real-time PCR analyses as described in Materials and Methods. Values for each gene were normalized by the values of corresponding glyceraldehyde-3-phosphate dehydrogenase gene and the ratios of treated/vehicle were calculated. The Spearman correlation was calculated and it showed that the data generated from microarray analyses are well correlated with the results obtained from quantitative real-time PCR (R2 = 0.74; Fig. 3).
Discussion
The major goal of this study is to identify cancer chemopreventive agent curcumin-regulated Nrf2-dependent genes in mice liver and small intestine by using Nrf2 wild-type/knockout mice and genome-scale microarray analysis. As a cancer chemopreventive agent, curcumin could function as a cancer-blocking agent to block the tumorigenesis process in many rodent carcinogenesis models (22–24) by inducing phase II detoxification and antioxidant genes to enhance the elimination of carcinogen or reactive intermediates. During this process, Nrf2 is believed to play a central role because phase II detoxification and antioxidant genes are mainly regulated by Nrf2/ARE pathway in response to phase II inducer or chemopreventive agents. Because it is known that curcumin can induce several phase II detoxification enzyme genes and Nrf2 is critical in phase II gene induction and cancer chemoprevention, the identification of many phase II detoxification and antioxidant genes as curcumin-induced Nrf2-dependent genes in this study not only is consistent with previous studies (17, 19) but also validated the results from a biological perspective. For example, the induction of selective isoform of GST and oxidative-stress response gene HO-1 is consistent with previous findings in which curcumin could induce the expression of GST (25, 26) and HO-1 (19) through Nrf2/ARE pathway. The induction of cytochrome c oxidase subunits (Cox7a2 and Cox8b) and thioredoxin reductase 1 further supports the role of Nrf2 in curcumin-elicited gene expression because their promoter regions all contain putative Nrf2-binding sites.
Interestingly, many genes involved in phase I drug metabolism and phase III drug transporting process were also regulated by curcumin depending on Nrf2 status. Cyp4a10 and Cyp2c55 were induced in liver and small intestine, respectively, whereas Cyp11a1 and Cyp2c50 were suppressed; however, their roles in the cancer chemopreventive effect of curcumin remain unclear. The transport function-related genes were the major group of genes being regulated by curcumin in a Nrf2-dependent manner in both liver and small intestine. Although the interaction between curcumin and transporters, such as MDR1 and MDR-associated protein 1, has been investigated in vitro (27), the effects of curcumin on other transporters, especially their expression, have never been examined in vivo. Solute carrier family transporter genes were the major ones to be selectively regulated in liver and small intestine. Altered expression of these transporter genes could perturb the transporting of organic cation (Slc22a3), glycerol-3-phosphate (Slc37a3), and monocarboxylic acid (Slc16a1) and could affect sodium/hydrogen exchange (Slc9a8). The induction of four ATP-binding cassette transporter genes, such as Abcb1b (MDR1), suggested that Nrf2 also play a significant role in regulating ATP-binding cassette family transporter genes. Although PXR and CAR have been shown to play critical roles in regulating the expression of MDR1 and MDR-associated protein genes (28), the role of Nrf2 has not been excluded. Hemopexin was dramatically induced by curcumin in a Nrf2-dependent manner in small intestine. Hemopexin is critical in maintaining the homeostasis of metal ions by forming a complex with heme. As the major vehicle for the transportation of heme, hemopexin could prevent heme-mediated oxidative stress and heme-bound iron loss (29), functionally analogous to HO-1, which metabolizes heme and prevent oxidative stress. Taken together, our current study suggested that curcumin could coordinately regulate the phase I, II, and III xenobiotic metabolizing enzyme genes as well as antioxidative stress genes through Nrf2-dependent pathways in vivo. Such regulation (especially induction) of these genes could have significant effects on prevention of tumor initiation by enhancing the cellular defense system, preventing the activation of procarcinogens/reactive intermediates, and increasing the excretion of reactive carcinogen or metabolites.
Previous in vitro (30–33) and in vivo (34, 35) studies have suggested that curcumin could also act as a tumor-suppressing agent by regulating many cellular signal transduction pathways in cancer cells. Therefore, modulation of signaling pathways (4, 8, 9) involved in cell proliferation, cell cycle control, apoptosis, adhesion, invasion and metastasis, angiogenesis, and inflammation by curcumin were linked to its strong cancer chemopreventive effects. However, the role of Nrf2 in curcumin-elicited alternation of signaling transduction pathways related to these cellular events has never been investigated. In the current study, apoptosis-related gene apoptotic protease-activating factor 1 was induced by curcumin >14-fold at both time points in the liver. Because the regulation of apoptotic protease-activating factor 1 by curcumin and Nrf2 has not been reported, our results suggested that curcumin-induced cancer cell apoptosis may result from its Nrf2-dependent regulation of apoptotic protease-activating factor 1–related pathways. Cell cycle control gene cyclin-dependent kinase inhibitor 1A (p21) was induced >10-fold at 12 hours on curcumin administration. This is supported by a previous study in which curcumin cause G1 arrest in PC-3 cells by induction of p21 (36). Curcumin has been shown to inhibit cancer cell invasion and metastasis (25, 37) by modulating integrin receptors, collagenase activity, and expression of E-cadherin. In the current study, several cadherin genes were also induced by curcumin, such as Cdh4, Cdh11, and Cdh22, in liver, although Cdh22 gene was also induced in small intestine. The cadherin family of transmembrane glycoproteins plays a critical role in cell-to-cell adhesion, and cadherin dysregulation is strongly associated with cancer metastasis and progression (38). Because impaired expression of cadherin genes were associated with cancer invasion and metastasis (39), the induction of cadherin genes through Nrf2/ARE pathway by curcumin could be another potential mechanism of exerting its cancer chemoprevention effects. Although microarray studies cannot provide information on the regulation of kinase phosphorylation by curcumin, our results indicated that the expression of many signaling pathway members was affected in a Nrf2-dependent manner after curcumin treatment. The induction of nuclear factor-κB signaling pathway component gene inhibitor of κB kinase γ and suppression of Wnt signaling pathway-related Wnt6 and Wnt7a genes were consistent with previous results (40–42). The suppression of phosphatidylinositol 3-kinase downstream target protein kinase C (PKC) ζ–related gene Prkcz suggested that curcumin may intervene in the phosphatidylinositol 3-kinase signaling and nuclear factor-κB p65 subunit nuclear translocation in small intestine (43). Because PKCμ could phosphorylate E-cadherin and increase prostate cancer cell aggregation and decrease cellular motility (38), the induction of both PKCμ gene and several cadherin genes by curcumin in small intestine may contribute to its colon cancer chemopreventive effect.
Because of the protective role of Nrf2-mediated gene expression in response to carcinogen or reactive oxygen intermediate challenge, it is essential and important to identify novel Nrf2/ARE pathway target genes related to cancer chemoprevention in addition to phase II detoxification and antioxidant genes (2, 16). By comparing the gene expression patterns elicited by promising cancer chemopreventive agent curcumin between Nrf2 wild-type and knockout mice, we identified many novel curcumin-regulated Nrf2-dependent genes with a variety of biological functions in mice liver and small intestine. The identification of these genes clearly expanded our scope of understanding the role of Nrf2 in cancer chemoprevention as well as potential new mechanisms of cancer chemoprevention. Interestingly, two previous microarray studies using chemopreventive agent sulforaphane (18) and 3H-1,2-dithiole-3-thione (17) to compare their gene expression profiles between wild-type and Nrf2-deficient mice also identified some of the similar functional categories of Nrf2-dependent genes. Although the chemopreventive agents used in previous studies and our current study are different, the similar induction pattern and the regulation of many identical Nrf2-dependent genes strongly suggested a relationship between the sets of genes being regulated and the cancer chemopreventive effects of these compounds as well as the predominant role of Nrf2 in the regulation of these genes. It also suggested that an elicited similar global gene expression change rather than the regulation of individual pathways could lead to the overall cancer protective effect by these different classes of chemopreventive compounds. Future in vivo or in vitro studies to explore the roles of Nrf2-dependent genes related to ubiquitination, drug metabolism, cell growth and adhesion, phosphorylation, and transcription as uncovered in our current study will greatly extend our knowledge on cancer chemoprevention.
Grant support: NIH grant R01 CA094828.
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
Acknowledgments
We thank Curtis Krier (CINJ Core Expression Array Facility) for assistance with the microarray analyses.