The combination of methylselenocysteine and irinotecan (CPT-11) is synergistic against FaDu and A253 xenografts. Methylselenocysteine/CPT-11 increased tumor cure rate to 100% in FaDu and to 60% in A253. In this study, the effect of methylselenocysteine on pharmacokinetic and pharmacogenetic profiles of genes relevant to CPT-11 metabolic pathway was evaluated to identify possible mechanisms associated with the observed combinational synergy. Nude mice bearing tumors (FaDu and A253) were treated with methylselenocysteine, CPT-11, and a combination of methylselenocysteine/CPT-11. Samples were collected and analyzed for plasma and intratumor concentration of CPT-11 and 7-ethyl-10-hydroxyl-camptothecin (SN-38) by high-performance liquid chromatography. The intratumor relative expression of genes related to the CPT-11 metabolic pathway was measured by real-time PCR. After methylselenocysteine treatment, the intratumor area under the concentration-time curve of SN-38 increased to a significantly higher level in A253 than in FaDu and was associated with increased expression of CES1 in both tumors. Methylselenocysteine/CPT-11 treatment, compared with CPT-11 alone, resulted in a significant decrease in levels of ABCC1 and DRG1 in FaDu tumors and an increase in levels of CYP3A5 and TNFSF6 in A253 tumors. No statistically significant changes induced by methylselenocysteine/CPT-11 were observed in the levels of other investigated variables. In conclusion, the significant increase in the cure rate after methylselenocysteine/CPT-11 could be related to increased drug delivery into both tumors (CES1), reduced resistance to SN-38 (ABCC1 and DRG1) in FaDu, and induced Fas ligand apoptosis (TNFSF6) in A253. No correlation was observed between cure rate and other investigated variables (transporters, degradation enzymes, DNA repair, and cell survival/death genes) in either tumor.

Irinotecan (CPT-11) is a chemotherapeutic agent widely used in metastatic colorectal cancer, small cell lung cancer, and several other solid tumors (1). CPT-11 causes cell toxicity by stabilizing ternary complexes between the nuclear enzyme topoisomerase I (Top1) and dsDNA, which leads to replication fork arrest and dsDNA breaks (2).

Drug efficacy is influenced by nongenetic (age, organ function, comorbid illnesses, etc.) and genetic (drug metabolism and transport) factors (36). CPT-11 is a water-soluble prodrug that is enzymatically bioactivated by carboxylesterase to its most active metabolite, 7-ethyl-10-hydroxyl-camptothecin (SN-38; refs. 710). Two major isoforms of carboxylesterase have been identified, carboxylesterase-1 (CES1) and carboxylesterase-2 (CES2). CES2 is 26-fold more active than CES1 in converting CPT-11 to SN-38 (11). Although only a small percentage (2–5%) of CPT-11 is converted to SN-38 by liver carboxylesterase (12), clinical data indicate that CPT-11 has substantial antitumor activity (13). Selective activation of the drug within tumor by CES2 increases therapeutic efficacy and reduces systemic toxicity (11).

Two cytochrome P450 enzymes, CYP3A4 and CYP3A5, degrade CPT-11 to compounds that have significantly fewer cytotoxic effects in culture than SN-38 (1, 14). Santos et al. reported that CYP3A4 metabolizes CPT-11 to 7-ethyl-10-[4-N-(5-aminopintanoic acid)-1-piper-idino]carbonyloxycamptothecin, 7-ethyl-10-(4-amino-1-piperidino) carbonyloxycamptothecin, and unknown metabolites (M1, M2, and M3). CYP3A5 metabolizes CPT-11 to a new metabolite, M4 (molecular weight, 558), by de-ethylation of the CPT moiety (15). β-glucuronidase UDP-glucuronosyl transferase 1A1 (UGT1A1) converts SN-38 to the inactive SN-38 glucuronide (ref. 1; Fig. 1).

Figure 1.

CPT-11 metabolic pathway. CPT-11 converting enzymes; CES1 and CES2, SN-38 transporters; ABCC1-2, ABCG2, and ABCB1, CPT-11 degradation enzymes; CYP3A4 and CYP3A5 and SN-38 degradation enzyme; UGT1A1.

Figure 1.

CPT-11 metabolic pathway. CPT-11 converting enzymes; CES1 and CES2, SN-38 transporters; ABCC1-2, ABCG2, and ABCB1, CPT-11 degradation enzymes; CYP3A4 and CYP3A5 and SN-38 degradation enzyme; UGT1A1.

Close modal

The ATP-binding cassette (ABC) transporters make up the largest transporter gene family, have many subfamilies, and bind to a wide array of substrates (16). The energy generated from ABC binding to ATP is used to transport molecules across cell membranes (17). There are seven subfamilies of human ABC genes, which consist of 48 characterized human ABC genes that are responsible for multidrug resistance in certain tumor cell lines (1, 16). The ABCB1 (P-glycoproteins) protein functions as an export pump to reduce the intracellular level of CPT-11 and SN-38. Multidrug-resistant proteins ABCC1 (MRP1), ABCC2 (MRP2), and breast cancer resistance protein (ABCG2; ref. 1) also are export pumps that efflux SN-38 (Fig. 1).

A high level of DNA repair genes in tumor cells has been associated with resistance to certain chemotherapeutic agents. Excision repair cross-complementing (ERCC1, ERCC2, and ERCC6), nucleotide excision repair genes (NER), X-ray repair cross-complementing (XRCC1), and base repair gene (BER) are components of DNA repair pathway that may influence the antitumor activity of CPT-11. The cell division cycle 45 (CDC45L) is required for the initiation of DNA replication. The ADPRT enzyme, known as poly(ADP-ribose) polymerase, is responsible for maintaining genomic integrity by repairing DNA breaks and altered bases in DNA (Fig. 1).

Motwani et al. (18) showed that developmentally regulated GTP-binding protein 1 (DRG1) is a marker for CPT-11 resistance in colon cancer and that its inhibition increases the sensitivity of colon cancer cells to CPT-11. Furthermore, studies have shown that increased levels of ferredoxin reductase may be responsible for initiation of apoptosis in tumor cells (19, 20). Activation of nuclear factor-κB1 (NFκB1) has been implicated in promoting tumor growth as well as antiapoptotic and proangiogenic effects (21, 22). Tumor necrosis factor (ligand) superfamily member 6 (TNFSF6) is a FAS (cell surface receptor) ligand that activates apoptosis signal through caspases (23).

Methylselenocysteine is an organic selenium product that is at various stages of clinical development as a chemopreventive agent. Methylselenocysteine is activated in the liver by β-lyase to its active metabolite methylselenol (24). Methylselenocysteine reportedly induces apoptosis through caspase-3 activation and cleavage of poly(ADP-ribose) polymerase (25, 26), down-regulates inhibitors of apoptosis family proteins, which subsequently enhance apoptosis through Bax cleavage (25), regulates the cell cycle (block cells in S and G1 phase; refs. 24, 27), and reduces DNA synthesis and cell doubling rate (2729).

Two head and neck squamous cell carcinomas, A253 and FaDu, have been characterized previously in this laboratory. A253 is well differentiated and p53 null, with a doubling time of 3 to 3.5 days. FaDu is poorly differentiated and mutant p53, with a doubling time of 2.8 to 3 days. The CES2 protein level is similar in both untreated xenografts when detected by immunohistochemistry (30).

A recently published study from this laboratory showed that treatment with oral methylselenocysteine (0.2 mg/mouse) for 28 days, starting 7 days before administration of i.v. CPT-11 (100 mg/kg) weekly × 4, in FaDu xenografts, increased the complete response rate from 30% (CPT-11 alone) to 100% (methylselenocysteine/CPT-11). In A253 xenografts, the complete response rate increased from 10% (CPT-11 alone) to 60% (methylselenocysteine/CPT-11; ref. 31). These data showed the therapeutic selectivity and efficacy of methylselenocysteine/CPT-11 in head and neck squamous cell carcinoma. Optimal therapeutic selectivity is achieved only when methylselenocysteine is given at least 7 days before CPT-11, suggesting that methylselenocysteine induces alterations over time that are essential for the observed curative effect with subsequent treatment with CPT-11.

Based on these findings, we designed studies to address the following questions: (a) Does methylselenocysteine alter the plasma and intratumor pharmacokinetics of CPT-11 and SN-38? (b) Does methylselenocysteine/CPT-11 have an effect on the intratumor pharmacodynamic of CPT-11 (expression of drug activation enzymes, transporters, degradation enzymes, DNA repair genes, and cell survival/death genes)? (c) Is there a correlation between the observed alterations and the enhanced antitumor activity of CPT-11 by methylselenocysteine?

Mice

Eight- to 12-week-old female athymic nude mice (nu/nu, body weight 20–25 g) were obtained from Harlan Sprague-Dawley, Inc. (Indianapolis, IN). The mice were housed five per cage under specific pathogen-free conditions, with water and food ad libitum, according to an institutionally approved protocol.

Tumors

The head and neck squamous cell carcinoma cell lines (FaDu and A253) were purchased from American Type Culture Collection (Rockville, MD) and maintained as a monolayer in RPMI 1640 supplemented with 10% fetal bovine serum (Life Technologies, Grand Island, NY). The cell lines were free from Mycoplasma as tested every 2 months with the Mycoplasma T.C. Rapid Detection System (Gen-Probe, Inc., San Diego, CA).

Xenografts were initially established by implanting s.c. 106 cultured cells and passed several generations by transplanting ∼50 mg nonnecrotic tumor tissues before treatment, which began when the tumors were ∼200 mg in size (established tumors), ∼1 week after implantation.

Drugs

CPT-11 was supplied by Pharmacia (Kalamazoo, MI) as a ready-to-use clinical formulation solution in 5 mL vials containing 100 mg drug (20 mg/mL). Methylselenocysteine was supplied by Sigma (St. Louis, MO) as a powder in 100 mg/vials and dissolved in 0.9% NaCl for a final concentration of 1 mg/mL.

Drug Doses and Treatments

CPT-11 was given by i.v. injection via the tail vein of animals. Methylselenocysteine was given orally. In this study, CPT-11 was given alone (100 mg/kg) and in combination with methylselenocysteine (0.2 mg/mouse), which was given once daily for 7 days before CPT-11 (100 mg/kg).

Preparation of Tumor Sample for High-Performance Liquid Chromatography

FaDu and A253 tumors were implanted bilaterally in nude mice to eliminate host variability so that both tumors had the same drug exposure from circulation following drug treatment. Five mice, per treatment per time point, with established tumors (∼200 mg) were treated with CPT-11 alone (100 mg/kg) and with methylselenocysteine/CPT-11. Tumors were excised and blood was collected at different times (n = 5 per time point), including untreated controls, 0.5, 1, 2, 4, 8, and 12 hours after CPT-11 treatment alone or in combination. Immediately following collection, ice-cold 5 mL methanol and acetonitrile (1:1) were added to tumor samples and homogenized using a Polytron tissue homogenizer (Brinkmann Instruments, Westbury, NY). Following centrifugation of the homogenate, the supernatant was evaporated to dryness, reconstituted to mobile phase, and subjected to high-performance liquid chromatography. Protein measurement was done on the pellet using Bradford protein assay (32). Plasma was obtained at 4°C immediately following the blood collection and subjected to the same solvent extraction procedure and high-performance liquid chromatography.

CPT-11 and SN-38 Measurements by High-Performance Liquid Chromatography

The lactone forms of CPT-11 and its active metabolite, SN-38, were measured using a validated high-performance liquid chromatography method with fluorescence detection as described by Warner and Burke (33). The separation method was carried out on a Waters Nova-Pak C18 column equipped with a μ Bondapak C18 guard column, with the mobile phase consisting of 20% acetonitrile and 80% triethylamine acetate. Detection was by fluorescence with excitation at 370 nm and emission at 510 nm. The limit of quantitation for both was 2.5 ng/mL. Quality assurance was maintained by simultaneously assaying the quality control samples prepared in bulk, before assay validation.

Pharmacokinetics Data Analysis

Using different doses of CPT-11 and many time points, the pharmacokinetics variables for CPT-11 and SN-38 were determined by standard noncompartmental methods (WinNonLin, version 3.3). The elimination rate constant (Ke) was computed by weighed least squares linear regression of the data points in terminal elimination phase. Half-life was determined as 0.693/Ke. The area under the concentration-time curve (AUC) was determined by the trapezoidal rule.

Extraction of Total RNA from Tumor Xenografts

Twenty-four tumor samples were collected for analysis (n = 3 per treatment per tumor) from untreated controls, 7 days after methylselenocysteine, and 24 hours after single dose of CPT-11 alone and in combination with methylselenocysteine. The total RNA was isolated from each ∼100 mg tumor sample using the Qiagen RNeasy Mini kit (Valencia, CA). RNA samples were suspended in RNase/DNase–free water. The concentration was then measured (0.5–1.2 μg/μL), and the gel document was made (all had clear three bands: 5S, 18S, and 28S), all with an Agilent 2100 analyzer. A260/280OD was within the range of 1.8 to 2.0 nm.

Reverse Transcription

Twenty-four RNA samples were placed in a 96-well PCR plate and incubated in PCR thermocycler block with RNA 10 μg, oligo(dT)20VN (500 ng/μL) 1.0 μL, and RNase-free water ∼38 μL at 70°C for 10 minutes and 25°C for 30 minutes. Then, deoxynucleotide triphosphate (10 mmol/L each) 5.0 μL, reverse transcription buffer (10×) 5.0 μL, RNaseOUT (40 units/μL) 1.0 μL, and RTase (StrataScript) 1.0 μL were added and the reverse transcription reactions were incubated at 42°C for 2 hours. After completing the RT reaction, the cDNAs were adjusted to a concentration of 2.5 ng/μL, pipetted into 384-well optical PCR plates (4.0 μL/well), and air-dried overnight.

Quantitative Real-time PCR

The primers and probes for each of the 21 drug pathway genes have been described previously (34). The reaction system consisted of cDNA 10 ng, TaqMan Universal PCR Master Mix (2×) 5.0 μL, forward primer (10 μmol/L) 0.6 μL, reverse primer (10 μmol/L) 0.6 μL, TaqMan probe (5 μmol/L) 0.4 μL, and DNase-free water ∼10 μL. After incubation at 50°C for 2 minutes and at 95°C for 10 minutes, 40 of 45 cycles were made at 95°C for 20 seconds and at 60°C for 1 minute on ABI Prism SDS System 7900HT (Applied Biosystems, Inc., Foster City, CA). All primers and TaqMan probes used were designed with the Primer Express version 1.5 (Applied Biosystems); the name and primer/probe sequences information is presented in Table 1.

Table 1.

Name and primer/probe sequences of CPT-11 pathway genes and reference genes

Gene symbolDescriptionForward primer 5′–3′Gene symbolReverse primer 5′–3′TaqMan probe 5′–3′
ABCB1 ATP-binding cassette, subfamily B (MDR/TAP), member 1 (MDR1) GCTGGCACAGAAAGGCATCT ABCB1 CAGAGTTCACTGGCGCTTTG TCCAGCCTGGACACTGACCATTGAAA 
ABCC1 ATP-binding cassette, subfamily C (CFTR/MRP), member 1 (MRP1) CCAAGACTCAGACTTGCTAAGAATTACG ABCC1 AATAAATATATGCGTTTTCGCCTAAAAGA CGCCGACTTCAAACCCAGAGAGCATC 
ABCC2 ATP-binding cassette, subfamily C (CFTR/MRP), member 2 (MRP2) AGGGCTCTGCTTCGGAAATC ABCC2 AATGAGGTTGTCTGTCTCTAGATCCA CAGTGGCCTCATCCAGGACCAGGA 
ABCG2 ATP-binding cassette, subfamily G (WHITE), member 2 (BCRP) CAGGTCTGTTGGTCAATCTCACA ABCG2 CATATCGTGGAATGCTGAAGTACTG CCATTGCATCTTGGCTGTCATGGC 
ADPRT ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) CTGTCCCAGGGTCTTCGGAT ADPRT TTGGCACTCTTGGAGACCATG AAGCGCCCGTGACAGGCTACATG 
CDC45L Cell division cycle 45-like (Saccharomyces cerevisiaeTGGACAAGCTGTACCATGGC CDC45L CTGGGAGATGACGAGGTTGG CAGCTGCGAGCCACCCAGCA 
CES1 Carboxylesterase-1 (monocyte/macrophage serine esterase 1) TGAGTTTCAGTACCGTCCAAGCT CES1 CTCATCCCCGTGGTCTCCTA CTCATCAGACATGAAACCCAAGACGGTG 
CES2 Carboxylesterase-2 (intestine, liver) AATCCCAGCTATTGGGAAGGA CES2 CTGGCTGGTCGGTCTCAAAC TGGCCTCAAGCCATCCTCCCATCT 
CYP3A4 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4 TCTCCTTTCATATTTCTGGGAGACA CYP3A4 GCATCGAGACAGTTGGGTGTT TGTTTCCCTACACCTCTTGCATTCCATCCT 
CYP3A5 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5 AAGAAACACAGATCCCCTTGAAATTA CYP3A5 CATCTCTTGAATCCACCTTTAGAACAA ACACGCAAGGACTTCTTCAACCAGAAAAACC 
DRG1 Developmentally regulated GTP-binding protein 1 CCGGACGAACCACAACA DRG1 CTGCCAAAACCAGAAAGAACTG CGTTCCCCATGATCAAGCACCCTACC 
ERCC1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 TACCCCTCGACGAGGATGAG ERCC1 CAGTGGGAAGGCTCTGTGTAGA CCTGGAGTGGCCAAGCCCTTATTCC 
ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (XPD) TTGGCGTCCCCTACGTCTAC ERCC2 CTGGTCCCGCAGGTATTCC CACAGAGCCGCATTCTCAAGGCG 
ERCC6 Excision repair cross-complementing rodent repair deficiency, complementation group 6 (CSB) ACAAGTGCAATTTTTGCAGGAACT ERCC6 GCTCCAAAGGCTGGTTGAATC ATCAGATGTTCAGACACCCAAATGCCATCTAA 
FDXR Ferredoxin reductase AGCAGGGAAGGGATGAGTGTT FDXR GGATCAGCAGAGGTGCAAAGT CCACTCAGACGGACCCAGCCCTT 
NFκB1 Nuclear factor of κ light polypeptide gene enhancer in B cells 1 (p105) AGCAAATAGACGAGCTCCGAGA NFκB1 GGCACCACTGGTCAGAGACTC CGCCGCTGTCGCAGACACTGTC 
TDP1 Tyrosyl-DNA phosphodiesterase AATCTGTCCAAGGCTGCCTG TDP1 CCAAATGCTGAAGGGAGGAA ACCCAGCTGATGATCCGCTCCTACG 
TNFSF6 Tumor necrosis factor (ligand) superfamily, member 6 TGAGCCAGACAAATGGAGGAA TNFSF6 TTTCATGCTTCTCCCTCTTCAC TGGCAGCCCAGAGTTCTATGTTCTTCCGT 
Top1 Topoisomerase (DNA) I GGCGAGTGAATCTAAGGATAATGAA Top1 TGGATATCTTAAAGGGTACAGCGAA ACCATTTTCCCATCATCCTTTGTTCTGAGC 
UGT1A1 UDP-glucuronosyl transferase 1 family, polypeptide A1 TTGGGAGTGCGGGATTCA UGT1A1 AGATAAGATTAAAACTGCCATTTGCA TGGTCCCACCGCTGCCCCTA 
XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 GAACACCAGGAGCCTCCTGAT XRCC1 AAGAAGTGCTTGCCCTGGAA TGCCAGTCCCTGAGCTCCCAGATTT 
ACTB Actin, β CCCTGAGGCACTCTTCCA ACTB GAGTTGAAGGTAGTTTCGTGGATG CCTTCCTTCCTGGGCATGGAGTCCT 
GAPDH Glyceraldehyde-3-phosphate dehydrogenase GAAGGTGAAGGTCGGAGTC GAPDH GAAGATGGTGATGGGATTTC CAAGCTTCCCGTTCTCAGCC 
Gene symbolDescriptionForward primer 5′–3′Gene symbolReverse primer 5′–3′TaqMan probe 5′–3′
ABCB1 ATP-binding cassette, subfamily B (MDR/TAP), member 1 (MDR1) GCTGGCACAGAAAGGCATCT ABCB1 CAGAGTTCACTGGCGCTTTG TCCAGCCTGGACACTGACCATTGAAA 
ABCC1 ATP-binding cassette, subfamily C (CFTR/MRP), member 1 (MRP1) CCAAGACTCAGACTTGCTAAGAATTACG ABCC1 AATAAATATATGCGTTTTCGCCTAAAAGA CGCCGACTTCAAACCCAGAGAGCATC 
ABCC2 ATP-binding cassette, subfamily C (CFTR/MRP), member 2 (MRP2) AGGGCTCTGCTTCGGAAATC ABCC2 AATGAGGTTGTCTGTCTCTAGATCCA CAGTGGCCTCATCCAGGACCAGGA 
ABCG2 ATP-binding cassette, subfamily G (WHITE), member 2 (BCRP) CAGGTCTGTTGGTCAATCTCACA ABCG2 CATATCGTGGAATGCTGAAGTACTG CCATTGCATCTTGGCTGTCATGGC 
ADPRT ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase) CTGTCCCAGGGTCTTCGGAT ADPRT TTGGCACTCTTGGAGACCATG AAGCGCCCGTGACAGGCTACATG 
CDC45L Cell division cycle 45-like (Saccharomyces cerevisiaeTGGACAAGCTGTACCATGGC CDC45L CTGGGAGATGACGAGGTTGG CAGCTGCGAGCCACCCAGCA 
CES1 Carboxylesterase-1 (monocyte/macrophage serine esterase 1) TGAGTTTCAGTACCGTCCAAGCT CES1 CTCATCCCCGTGGTCTCCTA CTCATCAGACATGAAACCCAAGACGGTG 
CES2 Carboxylesterase-2 (intestine, liver) AATCCCAGCTATTGGGAAGGA CES2 CTGGCTGGTCGGTCTCAAAC TGGCCTCAAGCCATCCTCCCATCT 
CYP3A4 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 4 TCTCCTTTCATATTTCTGGGAGACA CYP3A4 GCATCGAGACAGTTGGGTGTT TGTTTCCCTACACCTCTTGCATTCCATCCT 
CYP3A5 Cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5 AAGAAACACAGATCCCCTTGAAATTA CYP3A5 CATCTCTTGAATCCACCTTTAGAACAA ACACGCAAGGACTTCTTCAACCAGAAAAACC 
DRG1 Developmentally regulated GTP-binding protein 1 CCGGACGAACCACAACA DRG1 CTGCCAAAACCAGAAAGAACTG CGTTCCCCATGATCAAGCACCCTACC 
ERCC1 Excision repair cross-complementing rodent repair deficiency, complementation group 1 TACCCCTCGACGAGGATGAG ERCC1 CAGTGGGAAGGCTCTGTGTAGA CCTGGAGTGGCCAAGCCCTTATTCC 
ERCC2 Excision repair cross-complementing rodent repair deficiency, complementation group 2 (XPD) TTGGCGTCCCCTACGTCTAC ERCC2 CTGGTCCCGCAGGTATTCC CACAGAGCCGCATTCTCAAGGCG 
ERCC6 Excision repair cross-complementing rodent repair deficiency, complementation group 6 (CSB) ACAAGTGCAATTTTTGCAGGAACT ERCC6 GCTCCAAAGGCTGGTTGAATC ATCAGATGTTCAGACACCCAAATGCCATCTAA 
FDXR Ferredoxin reductase AGCAGGGAAGGGATGAGTGTT FDXR GGATCAGCAGAGGTGCAAAGT CCACTCAGACGGACCCAGCCCTT 
NFκB1 Nuclear factor of κ light polypeptide gene enhancer in B cells 1 (p105) AGCAAATAGACGAGCTCCGAGA NFκB1 GGCACCACTGGTCAGAGACTC CGCCGCTGTCGCAGACACTGTC 
TDP1 Tyrosyl-DNA phosphodiesterase AATCTGTCCAAGGCTGCCTG TDP1 CCAAATGCTGAAGGGAGGAA ACCCAGCTGATGATCCGCTCCTACG 
TNFSF6 Tumor necrosis factor (ligand) superfamily, member 6 TGAGCCAGACAAATGGAGGAA TNFSF6 TTTCATGCTTCTCCCTCTTCAC TGGCAGCCCAGAGTTCTATGTTCTTCCGT 
Top1 Topoisomerase (DNA) I GGCGAGTGAATCTAAGGATAATGAA Top1 TGGATATCTTAAAGGGTACAGCGAA ACCATTTTCCCATCATCCTTTGTTCTGAGC 
UGT1A1 UDP-glucuronosyl transferase 1 family, polypeptide A1 TTGGGAGTGCGGGATTCA UGT1A1 AGATAAGATTAAAACTGCCATTTGCA TGGTCCCACCGCTGCCCCTA 
XRCC1 X-ray repair complementing defective repair in Chinese hamster cells 1 GAACACCAGGAGCCTCCTGAT XRCC1 AAGAAGTGCTTGCCCTGGAA TGCCAGTCCCTGAGCTCCCAGATTT 
ACTB Actin, β CCCTGAGGCACTCTTCCA ACTB GAGTTGAAGGTAGTTTCGTGGATG CCTTCCTTCCTGGGCATGGAGTCCT 
GAPDH Glyceraldehyde-3-phosphate dehydrogenase GAAGGTGAAGGTCGGAGTC GAPDH GAAGATGGTGATGGGATTTC CAAGCTTCCCGTTCTCAGCC 

NOTE: ACTB is a reference gene; GAPDH is a reference gene.

Pharmacogenetics Data Analysis

The threshold of cycle (CT) value and multicomponent kinetic data were exported from the real-time PCR program for each reaction, and the individual PCR amplification efficiency (E) for each reaction (each sample) was calculated. The relative expression level of a gene was then analyzed using the following formula: Relative level = [(1 + E)CT] reference gene / [(1 + E)CT] target gene (35). Two reference genes, actin β (ACTB) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH), were used; average value of the two genes was taken to normalize the expression level and the final relative level was scaled to a 1× sample, which was the lowest expressed sample in the whole data set (24 samples by 21 pathway genes).

Statistical Analysis

The average value of every evaluated variable and its SD and the SE of ratios were calculated. Statistical analysis was done by comparing the average value of untreated control of every evaluated variable of FaDu versus A253 tumors. In addition, a comparison of the average value of every evaluated variable after methylselenocysteine/CPT-11 treatment with its average value after CPT-11 alone treatment was done. The P was calculated by applying two-tailed distribution unpaired t test. The result of the comparisons was considered statistically significant if P < 0.05.

Pharmacokinetic Profiles of CPT-11 and Its Active Metabolite SN-38 after Treatment with CPT-11 Alone or in Combination with Methylselenocysteine

In the plasma, the AUC of CPT-11 increased from 120.84 to 207.65 μmol/L h (72%) after methylselenocysteine (Table 2), whereas the clearance rate of CPT-11 decreased from 0.8 to 0.45 L/h (44%). The data in Table 2 indicate that methylselenocysteine had no significant impact on the AUC, the clearance rate of SN-38, or the half-life (t1/2) and maximum concentration (Cmax) of CPT-11 and SN-38.

Table 2.

Plasma pharmacokinetics of CPT-11 and SN-38 after CPT-11 treatment with and without methylselenocysteine

Plasma
CPT-11
SN-38
Treatment*CPT-11Methylselenocysteine/CPT-11CPT-11Methylselenocysteine/CPT-11
Cmax (μmol/L) 44.99 ± 4.76 55.29 ± 9.89 5.65 ± 0.58 6.36 ± 0.73 
t1/2 (h) 2.34 ± 0.58 2.21 ± 0.64 6.72 ± 0.43 5.12 ± 1.89 
AUC0–12 h (μmol/L h) 120.84 ± 7.12 207.65 ± 25.54 26.60 ± 3.4 29.23 ± 1.98 
Clearance rate (L/h) 0.80 ± 0.05 0.45 ± 0.06 2.56 ± 0.37 2.58 ± 0.18 
Plasma
CPT-11
SN-38
Treatment*CPT-11Methylselenocysteine/CPT-11CPT-11Methylselenocysteine/CPT-11
Cmax (μmol/L) 44.99 ± 4.76 55.29 ± 9.89 5.65 ± 0.58 6.36 ± 0.73 
t1/2 (h) 2.34 ± 0.58 2.21 ± 0.64 6.72 ± 0.43 5.12 ± 1.89 
AUC0–12 h (μmol/L h) 120.84 ± 7.12 207.65 ± 25.54 26.60 ± 3.4 29.23 ± 1.98 
Clearance rate (L/h) 0.80 ± 0.05 0.45 ± 0.06 2.56 ± 0.37 2.58 ± 0.18 
*

Five mice per time point.

Maximum concentration.

P < 0.05, compared with CPT-11 alone.

In FaDu tumors, the AUC of CPT-11 and SN-38 increased from 288.72 to 329.39 ng/mg h (14%) and from 4.15 to 4.97 ng/mg h (20%), respectively, after methylselenocysteine. The clearance rates decreased by 14% (0.29–0.25 L/h) for CPT-11 and by 19% (19.78–15.9 L/h) for SN-38 after methylselenocysteine (Table 3). However, the methylselenocysteine treatment had no significant impact on the t1/2 and Cmax of CPT-11 and SN-38.

Table 3.

Intratumor pharmacokinetics of CPT-11 and SN-38 in FaDu and A253 after CPT-11 treatment with and without methylselenocysteine

Tumors
FaDu
A253
Treatment*CPT-11Methylselenocysteine/CPT-11CPT-11Methylselenocysteine/CPT-11
Cmax (ng/mg) of CPT-11 46.43 ± 5.61 73.86 ± 29.69 69.51 ± 7.02 62.22 ± 21.03 
Cmax (ng/mg) of SN-38 1.77 ± 0.51 1.30 ± 0.24 1.42 ± 0.81 1.81 ± 0.26 
t1/2 (h) of CPT-11 3.42 ± 0.22 3.69 ± 0.15 3.47 ± 0.14 3.67 ± 0.63 
t1/2 (h) of SN-38 5.78 ± 0.95 4.58 ± 0.61 5.39 ± 0.51 4.37 ± 0.46 
AUC0-12 h (ng/mg h) of CPT-11 288.72 ± 104.22 329.39 ± 65.55 273.05 ± 43.68 349.82 ± 68.06 
AUC0-12 h (ng/mg h) of SN-38 4.15 ± 1.24 4.97 ± 0.90 6.11 ± 1.72 9.91 ± 3.68 
Clearance rate (L/h) of CPT-11 0.29 ± 0.09 0.25 ± 0.05 0.29 ± 0.05 0.24 ± 0.06 
Clearance rate (L/h) of SN-38 19.78 ± 4.72 15.90 ± 3.51 12.92 ± 3.51 8.62 ± 2.79 
Tumors
FaDu
A253
Treatment*CPT-11Methylselenocysteine/CPT-11CPT-11Methylselenocysteine/CPT-11
Cmax (ng/mg) of CPT-11 46.43 ± 5.61 73.86 ± 29.69 69.51 ± 7.02 62.22 ± 21.03 
Cmax (ng/mg) of SN-38 1.77 ± 0.51 1.30 ± 0.24 1.42 ± 0.81 1.81 ± 0.26 
t1/2 (h) of CPT-11 3.42 ± 0.22 3.69 ± 0.15 3.47 ± 0.14 3.67 ± 0.63 
t1/2 (h) of SN-38 5.78 ± 0.95 4.58 ± 0.61 5.39 ± 0.51 4.37 ± 0.46 
AUC0-12 h (ng/mg h) of CPT-11 288.72 ± 104.22 329.39 ± 65.55 273.05 ± 43.68 349.82 ± 68.06 
AUC0-12 h (ng/mg h) of SN-38 4.15 ± 1.24 4.97 ± 0.90 6.11 ± 1.72 9.91 ± 3.68 
Clearance rate (L/h) of CPT-11 0.29 ± 0.09 0.25 ± 0.05 0.29 ± 0.05 0.24 ± 0.06 
Clearance rate (L/h) of SN-38 19.78 ± 4.72 15.90 ± 3.51 12.92 ± 3.51 8.62 ± 2.79 
*

Five mice per time point.

Maximum concentration.

In A253 tumors, the AUC of CPT-11 and SN-38 increased from 273.05 to 349.82 ng/mg h (28%) and from 6.11 to 9.91 ng/mg h (62%), respectively, after methylselenocysteine. The clearance rates decreased by 17% (0.29–0.24 L/h) for CPT-11 and by 33.3% (12.92–8.62 L/h) for SN-38 after methylselenocysteine (Table 3). The methylselenocysteine treatment had no significant impact on the t1/2 and Cmax of CPT-11 and SN-38.

The data in Table 3 indicated that treatment with methylselenocysteine resulted in significant trend of increase in the SN-38 AUC in both FaDu and A253 xenografts. Observed changes in other measured variables were not significantly affected by methylselenocysteine.

Effect of the Combination Treatment on CPT-11 Activating Enzymes

The expression of CES1 in untreated FaDu tumors was higher than in A253 untreated tumors, but the expression of CES2 was significantly higher in A253 than in FaDu (P = 0.006; Table 4).

Table 4.

Comparative analysis of relative gene expression in FaDu versus A253 xenografts in untreated control and after the combinational treatment (n = 3 mice per treatment per tumor)

VariablesFaDu/A253 (untreated control)FaDu/A253 (methylselenocysteine/CPT-11 combination)
Anabolic enzymes   
    CES1 (SN-38) 2.28 ± 0.57 (0.44)* 3.55 ± 0.48 (0.28) 
    CES2 (SN-38) 0.68 ± 0.04 (−1.47) 0.82 ± 0.06 (1.22) 
Catabolic enzymes   
    CYP3A4 (CPT-11) 7.31 ± 0.35 (0.14) 8.49 ± 0.57 (0.12) 
    CYP3A5 (CPT-11) 2.49 ± 1.60 (0.4) 1.37 ± 0.44 (0.73) 
    UGT1A1 (SN-38) 5.38 ± 1.16 (0.19) 4.90 ± 0.77 (0.20) 
ABC genes   
    ABCB1 (CPT-11) 0.91 ± 0.04 (1.09) 0.86 ± 0.2 (1.16) 
    ABCC1 (SN-38) 0.17 ± 0.004 (−6.04) 0.09 ± 0.01 (−11.43) 
    ABCC2 (SN-38) 12.72 ± 1.26 (0.08) 14.20 ± 1.17 (0.07) 
    ABCG2 (SN-38) 0.42 ± 0.02 (−2.38) 0.41 ± 0.04 (−2.43) 
Target enzymes   
    Top1 (SN-38) 2.07 ± 0.18 (0.48) 2.73 ± 0.13 (0.37) 
DNA repair genes   
    TDP1 3.75 ± 0.42 (0.27) 4.98 ± 0.27 (0.20) 
    ERCC1 1.32 ± 0.07 (0.76) 1.65 ± 0.09 (0.61) 
    ERCC2 0.40 ± 0.01 (−2.52) 0.35 ± 0.05 (−2.90) 
    ERCC6 0.37 ± 0.03 (−2.69) 0.31 ± 0.02 (−3.25) 
    XRCC1 0.26 ± 0.01 (−3.80) 0.20 ± 0.02 (−5.10) 
    ADPRT 0.92 ± 0.08 (1.09) 1.53 ± 0.14 (0.66) 
    CDC45L 0.99 ± 0.03 (1.01) 1.46 ± 0.21 (0.68) 
Cell survival/death genes   
    DRG1 0.31 ± 0.02 (−3.19) 0.18 ± 0.02 (−5.58) 
    NFκB1 0.43 ± 0.08 (−2.32) 0.34 ± 0.005 (−2.97) 
    FDXR 0.40 ± 0.01 (−2.53) 0.41 ± 0.04 (−2.45) 
    TNFSF6 2.64 ± 0.85 (0.38) 3.53 ± 0.49 (0.28) 
VariablesFaDu/A253 (untreated control)FaDu/A253 (methylselenocysteine/CPT-11 combination)
Anabolic enzymes   
    CES1 (SN-38) 2.28 ± 0.57 (0.44)* 3.55 ± 0.48 (0.28) 
    CES2 (SN-38) 0.68 ± 0.04 (−1.47) 0.82 ± 0.06 (1.22) 
Catabolic enzymes   
    CYP3A4 (CPT-11) 7.31 ± 0.35 (0.14) 8.49 ± 0.57 (0.12) 
    CYP3A5 (CPT-11) 2.49 ± 1.60 (0.4) 1.37 ± 0.44 (0.73) 
    UGT1A1 (SN-38) 5.38 ± 1.16 (0.19) 4.90 ± 0.77 (0.20) 
ABC genes   
    ABCB1 (CPT-11) 0.91 ± 0.04 (1.09) 0.86 ± 0.2 (1.16) 
    ABCC1 (SN-38) 0.17 ± 0.004 (−6.04) 0.09 ± 0.01 (−11.43) 
    ABCC2 (SN-38) 12.72 ± 1.26 (0.08) 14.20 ± 1.17 (0.07) 
    ABCG2 (SN-38) 0.42 ± 0.02 (−2.38) 0.41 ± 0.04 (−2.43) 
Target enzymes   
    Top1 (SN-38) 2.07 ± 0.18 (0.48) 2.73 ± 0.13 (0.37) 
DNA repair genes   
    TDP1 3.75 ± 0.42 (0.27) 4.98 ± 0.27 (0.20) 
    ERCC1 1.32 ± 0.07 (0.76) 1.65 ± 0.09 (0.61) 
    ERCC2 0.40 ± 0.01 (−2.52) 0.35 ± 0.05 (−2.90) 
    ERCC6 0.37 ± 0.03 (−2.69) 0.31 ± 0.02 (−3.25) 
    XRCC1 0.26 ± 0.01 (−3.80) 0.20 ± 0.02 (−5.10) 
    ADPRT 0.92 ± 0.08 (1.09) 1.53 ± 0.14 (0.66) 
    CDC45L 0.99 ± 0.03 (1.01) 1.46 ± 0.21 (0.68) 
Cell survival/death genes   
    DRG1 0.31 ± 0.02 (−3.19) 0.18 ± 0.02 (−5.58) 
    NFκB1 0.43 ± 0.08 (−2.32) 0.34 ± 0.005 (−2.97) 
    FDXR 0.40 ± 0.01 (−2.53) 0.41 ± 0.04 (−2.45) 
    TNFSF6 2.64 ± 0.85 (0.38) 3.53 ± 0.49 (0.28) 
*

Value of A253/FaDu.

P < 0.05, FaDu combination compared with A253 combination.

P < 0.05, FaDu control compared with A253 control.

In FaDu, methylselenocysteine/CPT-11 treatment resulted in a statistically significant increase of the relative expression level of CES1 but not CES2 when compared with CPT-11 alone (P = 0.02 and 0.1, respectively; Fig. 2A and B). In A253, methylselenocysteine/CPT-11 treatment significantly increased the relative expression level of CES1 but not CES2 when compared with CPT-11 alone (P = 0.03 and 0.1, respectively; Fig. 2A and B).

Figure 2.

Intratumor relative expression of CPT-11 converting and degrading enzymes; CES1, CES2, CYP3A4, CYP3A5, and SN-38 degrading enzyme UGTA1A in both FaDu and A253 xenografts. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. In both xenografts FaDu and A253, the relative expression levels of CPT-11 activating enzymes (CES1 and CES2) were higher after the combination therapy of methylselenocysteine/CPT-11 than CPT-11 or methylselenocysteine alone. The relative expression levels of CYP3A4, CYP3A5, and UGTA1A are higher in FaDu than A253 in the control and after combination treatment of methylselenocysteine/CPT-11.

Figure 2.

Intratumor relative expression of CPT-11 converting and degrading enzymes; CES1, CES2, CYP3A4, CYP3A5, and SN-38 degrading enzyme UGTA1A in both FaDu and A253 xenografts. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. In both xenografts FaDu and A253, the relative expression levels of CPT-11 activating enzymes (CES1 and CES2) were higher after the combination therapy of methylselenocysteine/CPT-11 than CPT-11 or methylselenocysteine alone. The relative expression levels of CYP3A4, CYP3A5, and UGTA1A are higher in FaDu than A253 in the control and after combination treatment of methylselenocysteine/CPT-11.

Close modal

The data in Fig. 2A and B showed that the up-regulation of CES1 by methylselenocysteine/CPT-11 treatment was more pronounced in FaDu than in A253 tumors. Although the methylselenocysteine/CPT-11 treatment resulted in higher level of CES2 expression, the effect was not statistically significant in both tumors when compared with CPT-11 alone.

Effect of the Combination Treatment on CPT-11 and SN-38 Degradation Enzymes

In untreated controls, the relative expression levels of degradation enzymes CYP3A4 and UGT1A1 were significantly higher in FaDu than in A253 tumors (P < 0.001). The CYP3A5 expression level was similar in both tumors (Table 4).

In both tumors, methylselenocysteine/CPT-11 treatment had no statistically significant impact on the gene expression of CYP3A4 and UGT1A1 when compared with CPT-11 alone (Fig. 2C and D). The relative expression of CYP3A5 significantly increased after methylselenocysteine/CPT-11 treatment in A253 tumors (P = 0.01) but not in FaDu tumors when compared with CPT-11 alone (Fig. 2D).

The data in Fig. 2C and D showed that although CYP3A4 and UGT1A1 expression levels in untreated FaDu tumors were significantly higher than in untreated A253 tumors the combination treatment of methylselenocysteine/CPT-11 had no significant effect on any of the CPT-11 and SN-38 degradation enzymes in both tumors when compared with CPT-11 alone.

Effect of the Combination Treatment on CPT-11 and SN-38 Transporters

In the untreated controls, the relative expression of ABCC1 and ABCG2 was significantly higher in A253 than in FaDu (P < 0.001, in both cases), but there was no statistical difference in ABCB1 expression. In contrast, ABCC2 expression was significantly higher in FaDu than in A253 (P < 0.001; Table 4).

The methylselenocysteine/CPT-11 treatment resulted in a statistically significant decrease of the relative expression of ABCC1 in FaDu but not A253 tumors when compared with CPT-11 alone (P = 0.006; Fig. 3B). In both tumors, no statistically significant difference was observed in the level of ABCB1, ABCC2, and ABCG2 after methylselenocysteine/CPT-11 when compared with CPT-11 alone (Fig. 3A, C, and D).

Figure 3.

Intratumor relative expression of CPT-11 and SN-38 transporters in FaDu and A253. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. The relative expression level of ABCB1, ABCC1, and ABCG2 are higher in the A253 control; on the contrary, the relative expression level of ABCC2 is higher in the FaDu control. ABCC1 relative expression level is decreased only in FaDu after methylselenocysteine/CPT-11.

Figure 3.

Intratumor relative expression of CPT-11 and SN-38 transporters in FaDu and A253. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. The relative expression level of ABCB1, ABCC1, and ABCG2 are higher in the A253 control; on the contrary, the relative expression level of ABCC2 is higher in the FaDu control. ABCC1 relative expression level is decreased only in FaDu after methylselenocysteine/CPT-11.

Close modal

The data in Fig. 3 indicated that the relative expression of ABCC1 (dominant efflux pump of SN-38) was significantly higher in A253 than FaDu untreated tumors. The combination treatment significantly down-regulated the level of ABCC1 in FaDu tumors but had no significant effect on other CPT-11 or SN-38 transporters in both tumors when compared with CPT-11 alone.

Effect of the Combination Treatment on Target Enzyme and DNA Repair Genes

The basal levels of Top1 and DNA repair genes (TDP1 and ERCC1) were significantly higher in untreated FaDu than in A253 (P = 0.008, 0.001, and 0.01, respectively). In contrast, the basal levels of DNA repair genes (ERCC2, ERCC6, and XRCC1) were significantly higher in untreated A253 (P < 0.001). No significant changes were observed in the basal levels of ADPRT and CDC45L in both tumors (Table 4).

In both tumors, no statistically significant differences were observed in the levels of Top1 and DNA repair genes after treatment with methylselenocysteine/CPT-11 compared with CPT-11 alone (Fig. 4).

Figure 4.

Intratumor relative expression of CPT-11 target enzyme Top1 and DNA repair genes in FaDu and A253 xenografts. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. A253 untreated tumors have higher expression of ERCC2, ERCC6, and XRCC1 than FaDu. In contrast, the expression of Top1, TDP-1, and ERCC1 were higher in untreated FaDu than in A253. The combination therapy has no effect on Top1 and DNA repair genes.

Figure 4.

Intratumor relative expression of CPT-11 target enzyme Top1 and DNA repair genes in FaDu and A253 xenografts. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. A253 untreated tumors have higher expression of ERCC2, ERCC6, and XRCC1 than FaDu. In contrast, the expression of Top1, TDP-1, and ERCC1 were higher in untreated FaDu than in A253. The combination therapy has no effect on Top1 and DNA repair genes.

Close modal

The data in Fig. 4 showed that Top1, TDP1, and ERCC1 relative expressions were higher in untreated FaDu tumors, but the relative expressions of ERCC2, ERCC6, and XRCC1 were higher in untreated A253 tumors. The combination treatment of methylselenocysteine/CPT-11 had no significant effect on any DNA repair genes in both tumors when compared with CPT-11 alone.

Effect of the Combination Treatment on Cell Survival/Death Genes

The basal levels of DRG1, NFκB1, and ferredoxin reductase were higher in A253 than in FaDu (P = 0.001, 0.05, and 0.002, respectively), but the TNFSF6 level was higher in FaDu (Table 4).

In FaDu, methylselenocysteine/CPT-11 treatment resulted in decreased level of DRG1 when compared with CPT-11 alone (P = 0.04; Fig. 5A) but had no significant impact on the levels of NFκB1, ferredoxin reductase, and TNFSF6 (Fig. 5B–D). In A253, only the TNFSF6 level had a statistically significant increase after the combination treatment when compared with CPT-11 alone (P < 0.005; Fig. 5D).

Figure 5.

Intratumor level of cell survival/death genes in FaDu and A253. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. The relative expressions of DRG1, NFκB1, and ferredoxin reductase are higher in untreated A253 tumors, but TNFSF6 expression is higher in untreated FaDu tumors. The combination treatment decreased DRG1 level in FaDu tumors but increased the TNFSF6 levels in both tumors.

Figure 5.

Intratumor level of cell survival/death genes in FaDu and A253. □, Control; ▪, 7 d after methylselenocysteine; , 24 h after first dose of CPT-11; , 24 h after first methylselenocysteine/CPT-11. The relative expressions of DRG1, NFκB1, and ferredoxin reductase are higher in untreated A253 tumors, but TNFSF6 expression is higher in untreated FaDu tumors. The combination treatment decreased DRG1 level in FaDu tumors but increased the TNFSF6 levels in both tumors.

Close modal

The data in Fig. 5 indicated that cell survival genes DRG1 and NFκB1 expression were higher in untreated A253 tumors, but cell death gene TNFSF6 level was higher in untreated FaDu tumors. The combination treatment of methylselenocysteine/CPT-11 resulted in a significant decrease in the level of DRG1 in FaDu and a significant increase in the level of TNFSF6 in A253 when compared with CPT-11 alone. The combination treatment had no significant effect on NFκB1 or ferredoxin reductase expression in both tumors.

Methylselenocysteine/CPT-11 treatment increased the complete response rate in FaDu xenografts from 30% to 100% and in A253 xenografts from 10% to 60%.

The hypothesis of this study is that the observed therapeutic synergy between methylselenocysteine and CPT-11 is associated in part with enhanced intratumor SN-38 level. This SN-38 enhanced level would be sufficient to affect downstream targets associated with cell survival and death. The combination effect to enhance intratumor SN-38 concentration could be achieved by (a) enhancement of drug uptake/transport into tumor cells, (b) up-regulation of carboxylesterases (CPT-11 activation enzymes), (c) reduction of SN-38 efflux outside the tumor cells, and/or (d) inhibition of enzymes associated with the degradation of SN-38 or CPT-11. To confirm this hypothesis, we evaluated the effect of methylselenocysteine/CPT-11 on the plasma and intratumor pharmacokinetics of CPT-11 and SN-38 as well as the combinational effect on the pharmacodynamic of downstream targets in FaDu and A253 xenografts. To eliminate drug pharmacokinetic variability among individual animals, A253 and FaDu tumors were bilaterally transplanted into the same animal and subjected to identical treatments, and drugs were given at their respective maximum tolerated doses.

The plasma data in Table 2 showed that the AUC of CPT-11 was increased by 72% after the pretreatment with methylselenocysteine when compared with CPT-11 alone. This increase was correlated with the effect of methylselenocysteine on the clearance rate of CPT-11 (decreased by 44%). The plasma AUC of SN-38 also was increased by 10%, but the clearance rate of SN-38 was not changed after the combination treatment. The intratumor concentration of SN-38 increased in both tumor xenografts after pretreatment with methylselenocysteine (20% increase in FaDu and 62% increase in A253) when compared with CPT-11 alone.

In FaDu, the observed increase in the AUC of SN-38 corresponded with a 43% increase of intratumor relative expression of CES1 (P = 0.02) and a 55% decrease in the level of ABCC1 (P = 0.006) after methylselenocysteine/CPT-11 when compared with CPT-11 alone (Table 5). Expression of ABC transporters is associated with resistance to SN-38 in several malignant cell lines (36). In addition, the ABCC1 pump has higher affinity to SN-38 than any other transporters. High level in ABCC1 expression could translate into higher resistance to SN-38 (37). Our data suggest that the increase in the AUC of SN-38 in FaDu tumors may be related to the increased conversion of CPT-11 to SN-38 due in part to the increased level of CES1 and decreased expression of ABCC1. The methylselenocysteine/CPT-11 treatment had no significant impact on degradation enzymes of CPT-11 or SN-38.In the less sensitive A253 tumor, the observed substantial increase (62%) in the AUC of SN-38 after the methylselenocysteine/CPT-11 treatment corresponded with a 31% increase in intratumor expression of CES1 (P = 0.03) when compared with CPT-11 alone. Methylselenocysteine/CPT-11 treatment had no statistically significant impact on any of ABC family transporters or on the degradation enzymes, except for CYP3A5. The expression level of CYP3A5 increased after treatment with methylselenocysteine/CPT-11 when compared with CPT-11 alone (P = 0.01). However, Santos et al. showed that CYP3A5 catalytic activity (produced a new metabolite, M4) is generally weaker than those of CYP3A4 and that CYP3A5 has lower affinity to CPT-11 than CYP3A4 (15). CYP3A5 marginal increased expression does not explain the observed increase in SN-38 concentration, nor does it have an apparent correlation with response rate. These data suggest that methylselenocysteine/CPT-11 treatment enhanced the conversion of CPT-11 to SN-38 but had no effect on the SN-38 efflux and degradation in A253 tumors.

Table 5.

Summary of statistically significant variables changes after the combination treatment of methylselenocysteine and CPT-11 in comparison with CPT-11 alone

VariablesPlasmaFaDuA253
CPT-11 AUC Increase (72%) Increase (14%) Increase (28%) 
SN-38 AUC Increase (10%) Increase (20%) Increase (62%) 
CES1 — Increase (43%)* Increase (31%)* 
ABCC1 — Decease (55%)* Increase (4%) 
DRG1 — Decease (34%)* Increase (6%) 
TNFSF6 — Increase (37%) Increase (24%)* 
CYP3A5 — Increase (11%) Increase (50%)* 
VariablesPlasmaFaDuA253
CPT-11 AUC Increase (72%) Increase (14%) Increase (28%) 
SN-38 AUC Increase (10%) Increase (20%) Increase (62%) 
CES1 — Increase (43%)* Increase (31%)* 
ABCC1 — Decease (55%)* Increase (4%) 
DRG1 — Decease (34%)* Increase (6%) 
TNFSF6 — Increase (37%) Increase (24%)* 
CYP3A5 — Increase (11%) Increase (50%)* 
*

P < 0.05, compared with CPT-11 after methylselenocysteine + CPT-11.

The methylselenocysteine/CPT-11 treatment had no significant effect on the most investigated downstream targets (target gene, DNA repair, and cell survival/death genes), except for DRG1 in FaDu tumors and TNFSF6 in A253 tumors.

DRG1 is a member of a four DRG gene family (38). Motwani et al. suggest that DRG1 plays a direct role in resistance to CPT-11 and its inhibition could provide a mean to increase sensitivity to CPT-11. In this study, the intratumor level of DRG1 decreased by 34% after methylselenocysteine/CPT-11 when compared with CPT-11 alone (P = 0.04; Table 5). This decrease in the intratumor expression of DRG1 may play a role in the improved response rate by lowering the resistance to CPT-11 in FaDu.

TNFSF6 is involved in Fas-induced apoptosis. The 24% increased level of TNFSF6 in A253 tumors (P < 0.005) after methylselenocysteine/CPT-11 could be related to the observed increase in response rate (Table 5).

In brief, this study shows that the increase of complete response rate in FaDu xenografts from 30% to 100% after methylselenocysteine/CPT-11 is associated with multifactorial alterations induced by the combination. This includes (a) increase in intratumor AUC of SN-38, (b) increase in CES1 level, and (c) decrease SN-38 efflux pump (decrease ABCC1). Collectively, these changes could translate into increase in intratumor SN-38 concentration. In part, this SN-38 concentration increase together with the decrease in DRG1 expression level could be responsible for the enhanced complete response rate (100%) in FaDu (Table 5).

In A253, the increase of intratumor AUC of SN-38 and the increase of CES1 level together with the increase of TNFSF6 level are favorable alterations, which could be associated with the increase of complete response rate to 60% after methylselenocysteine/CPT-11 treatment. We reported previously that A253 cells in vitro were ∼3-fold more resistant to SN-38 than FaDu cells (IC50, 0.35 and 0.1 μmol/L, respectively; ref. 39). In addition, the in vivo studies show that the heterogeneous A253 xenografts are more resistant to CPT-11 than the homogeneous FaDu with a cure rate of 0% and 30%, respectively (31). This could be a factor explaining that A253 may need more intratumor drug concentration to achieve the same observed effect in FaDu.

Our data provided clear evidence of difference in some markers level between the untreated controls of FaDu and A253. In A253, overexpression of markers like ABCC1, ABCG2, ERCC2, ERCC6, XRCC1, DRG1, and NFκB1 could serve as poor prognostic indication to CPT-11 treatment.

In conclusion, the molecular alteration reported in this study could be important for the prediction of response to the combination treatment of methylselenocysteine/CPT-11. Future studies of the effect of methylselenocysteine/CPT-11 treatment on the function of the genes relevant to CPT-11 metabolic pathway could provide new and valuable data to further elucidate and verify the basis behind the observed therapeutic synergy of methylselenocysteine/CPT-11 treatment.

Grant support: National Cancer Institute grant CA76561, Pharmacogenetics Research Network GM63340, and Institute Comprehensive Cancer Center Support grant CA 16056.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank Elizabeth S. Buyers and Kevin A. Craig for their valuable assistance with this article.

1
Ma MK, McLeod HL. Lessons learned from the irinotecan metabolic pathway.
Curr Med Chem
2003
;
10
:
41
–9.
2
Rivory LP. Irinotecan (CPT-11): a brief overview.
Clin Exp Pharmacol Physiol
1996
;
23
:
1000
–4.
3
Evans WE, Relling MV. Pharmacogenomics: translating functional genomics into rational therapeutics.
Science
1999
;
286
:
487
–91.
4
Evans WE, Johnson JA. Pharmacogenomics: the inherited basis for interindividual differences in drug response.
Annu Rev Genomics Hum Genet
2001
;
2
:
9
–39.
5
Evans WE, McLeod HL. Pharmacogenomics—drug disposition, drug targets, and side effects.
N Engl J Med
2003
;
348
:
538
–49.
6
McLeod HL, Evans WE. Pharmacogenomics: unlocking the human genome for better drug therapy.
Annu Rev Pharmacol Toxicol
2001
;
41
:
101
–21.
7
Lavelle F, Bissery MC, Andre S, Roquet F, Riou JF. Preclinical evaluation of CPT-11 and its active metabolite SN-38.
Semin Oncol
1996
;
23
:
11
–20.
8
Rivory LP, Bowles MR, Robert J, Pond SM. Conversion of irinotecan (CPT-11) to its active metabolite, 7-ethyl-10-hydroxycamptothecin (SN-38), by human liver carboxylesterase.
Biochem Pharmacol
1996
;
52
:
1103
–11.
9
Wiseman LR, Markham A. Irinotecan. A review of its pharmacological properties and clinical efficacy in the management of advanced colorectal cancer.
Drugs
1996
;
52
:
606
–23.
10
Satoh T, Hosokawa M, Atsumi R, Suzuki W, Hakusui H, Nagai E. Metabolic activation of CPT-11, 7-ethyl-10-4-(1-piperidino)-1-piperidino carbonyloxycamptothecin, a novel antitumor agent, by carboxylesterase.
Biol Pharm Bull
1994
;
17
:
662
–4.
11
Senter PD, Beam KS, Mixan B, Wahl AF. Identification and activities of human carboxylesterases for the activation of CPT-11, a clinically approved anticancer drug.
Bioconjug Chem
2001
;
12
:
1074
–80.
12
Gupta R, Mick R, Ramirez J, et al. Pharmacokinetic and pharmacodynamic evaluation of the topoisomerase inhibitor irinotecan in cancer patients.
J Clin Oncol
1997
;
15
:
1502
–10.
13
Xu G, Zhang W, Ma MK, McLeod HL. Human carboxylesterase 2 is commonly expressed in tumor tissue and is correlated with activation of irinotecan.
Clin Cancer Res
2002
;
8
:
2605
–11.
14
Rivory L, Riou JF, Haaz MC, et al. Identification and properties of major plasmid metabolite of irinotecan (CPT-11) isolated from the plasma of patients.
Cancer Res
1996
;
56
:
3689
–94.
15
Santos A, Zanetta S, Cresteil T, et al. Metabolism of Irinotecan (CPT-11) by CYP2A4 and CYP3A5 in humans.
Clin Cancer Res
2000
;
6
:
2012
–20.
16
Dean M, Hamon Y, Chimini G. The human ATP-binding cassette (ABC) transporter superfamily.
J Lipid Res
2001
;
42
:
1007
–16.
17
Chen CJ, Clark D, Ueda K, Pastan I, Gottesman MM, Roninson IB. Genomic organization of the human multidrug resistance (MDR1) gene and origin of P-glycoproteins.
J Biol Chem
1990
;
5;265
:
506
–14.
18
Motwani M, Sirotnak FM, She Y, Commes T, Schwartz GK. Drg1, a novel target for modulating sensitivity to CPT-11 in colon cancer cells.
Cancer Res
2002
;
62
:
3950
–5.
19
Hwang PM, Bunz F, Yu J, et al. Ferredoxin reductase affects p53-dependent, 5-fluorouracil-induced apoptosis in colorectal cancer cells.
Nat Med
2001
;
7
:
1111
–7.
20
Liu G, Chen X. The ferredoxin reductase gene is regulated by the p53 family and sensitizes cells to oxidative stress-induced apoptosis.
Oncogene
2002
;
21
:
7195
–04.
21
Sharma HW, Narayanan R. The NF-κB transcription factor in oncogenesis [review].
Anticancer Res
1996
;
16
:
589
–96.
22
Rangaswami H, Bulbule A, Kundu GC. Nuclear factor inducing kinase plays crucial role in osteopontin induced MAPK/IKK dependent nuclear factor κB-mediated promatrix metalloproteinase-9 activation.
J Biol Chem
2004
;
279
:
38921
–35.
23
Embree-Ku M, Venturini D, Boekelheide K. Fas is involved in the p53-dependent apoptotic response to ionizing radiation in mouse testis.
Biol Reprod
2002
;
66
:
1456
–61.
24
Ip C. Lessons from basic research in selenium and cancer prevention.
J Nutr
1998
;
128
:
1845
–54.
25
Kim T, Jung U, Cho DY, Chung AS. Se-methylselenocysteine induces apoptosis through activation in HL-60 cells.
Carcinogenesis
2001
;
22
:
559
–65.
26
Yeo JK, Cha SD, Cho CH, et al. Se-methylselenocysteine induces apoptosis through caspase activation and Bax cleavage mediated by calpain SKOV-3 ovarian cancer cells.
Cancer Lett
2002
;
182
:
83
–92.
27
Medina D, Thompson H, Ganther H, Ip C. Se-methylselenocysteine: a new compound for chemoprevention of breast cancer.
Nutr Cancer
2001
;
40
:
12
–27.
28
Thompson HJ, Wilson A, Lu J, et al. Comparison of the effects of an organic and inorganic form of selenium on a mammary carcinoma cell line.
Carcinogenesis
1994
;
15
:
183
–6.
29
Sinha R, Medina D. Inhibition of cdk2 kinase activity by Se-methylselenocysteine in synchronized mouse mammary epithelial cells.
Carcinogenesis
1997
;
18
:
1541
–7.
30
Azrak RG, Cao S, Slocum HK, et al. Therapeutic synergy between irinotecan and 5-fluorouracil against human tumor xenografts.
Clin Cancer Res
2004
;
10
:
1121
–9.
31
Cao S, Durrani FA, Rustum YM. Selective modulation of the therapeutics efficacy of anticancer drugs by selenium containing compounds against human tumor xenografts.
Clin Cancer Res
2004
;
10
:
2561
–9.
32
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding.
Anal Biochem
1976
;
72
:
248
–54.
33
Warner DL, Burke TG. Simple and versatile high-performance liquid chromatography method for the simultaneous quantitation of the lactone and carboxylate forms of camptothecin anticancer drugs.
J Chromatogr B Biomed Sci Appl
1997
;
691
:
161
–71.
34
Yu J, Shannon WD, Watson MA, McLeod HL. Gene expression profiling of the irinotecan pathway in colorectal cancer.
Clin Cancer Res
2005
;
11
:
2053
–62.
35
Liu W, Saint DA. A new quantitative method of real time reverse transcription polymerase chain reaction assay based on simulation of polymerase chain reaction kinetics.
Anal Biochem
2002
;
302
:
52
–9.
36
Jansen WJ, Hulscher TM, van Ark-Otte J, Giaccone G, Pinedo HM, Boven E. CPT-11 sensitivity in relation to the expression of P170-glycoprotein and multidrug resistance-associated protein.
Br J Cancer
1998
;
77
:
359
–65.
37
Chu XY, Suzuki H, Ueda K, Kato Y, Akiyama S, Sugiyama Y. Active efflux of CPT-11 and its metabolites in human KB-derived cell lines.
J Pharmacol Exp Ther
1999
;
288
:
735
–41.
38
Zhou RH, Kokame K, Tsukamoto Y, Yutani C, Kato H, Miyata T. Characterization of the human gene family: a newly identified member, ndrg4, is specifically expressed in brain and heart.
Genomics
2001
;
73
:
86
–7.
39
Bhattacharya A, Tóth K, Mazurchuk R, et al. Lack of microvessels in well differentiated regions of human head and neck squamous cell carcinoma A253 is associated with fMR imaging detectable hypoxia, limited drug delivery and resistance to irinotecan therapy.
Clin Cancer Res
2004
;
10
:
8005
–17.