ONC201 Shows Potent Anticancer Activity Against Medullary Thyroid Cancer via Transcriptional Inhibition of RET, VEGFR2, and IGFBP2

Medullary thyroid carcinoma (MTC) originates from the calcitonin-producing thyroid parafollicular cells (1). Seventy-five percent of patients have lymph node metastasis at diagnosis, and 10% to 15% have distant metastasis (2). The rearranged during transfection (RET) gene encodes a transmembrane tyrosine kinase receptor, mutated in 43% to 70% of sporadic cases (3). The most frequent RET mutation is M918T alteration, which is associated with worse overall survival of patients with MTC (4). In recent years, there has been a paradigm shift in the treatment of MTC, with the FDA approval of multikinase inhibitors (tyrosine kinase inhibitors; TKI), vandetanib (inhibits multiple receptors: RET, EGFR, and VEGF2), and cabozantinib (inhibits RET, C-Met, VEGFR2, and AXL) for the treatment of MTC (5, 6). To date, TKIs have not been curative, and the adverse effects often limit their use, leaving room for improvement (7). Selpercatinib, a specific RET inhibitor, was recently approved by the FDA to treat RET-mutant MTC (8). Selpercatinib showed durable efficacy with mainly low-grade toxicity effects with or without previous vandetanib or cabozantinib treatment (8, 9).

Prior studies from our laboratory demonstrated that activated RET prevents cell death by promoting degradation of ATF4 via direct phosphorylation, thereby circumventing stress-induced apoptosis (10). Although these observations are important in tumorigenesis, the critical regulatory mechanisms driving RET-dependent oncogenesis remain elusive. We hypothesize that RET regulates the expression of proteins involved in MTC's pathogenesis, such as insulin-like growth factor binding 2 (IGFBP2) and VEGFR2 (also known as KDR). IGFBP2, a secreted protein, is elevated in the serum of patients with advanced cancers such as glioblastoma and gastric, prostate, and breast cancer and is associated with progression and metastasis (11–15). IGFBP2 exerts autocrine and paracrine growth modulation of tumor cells and transcriptional regulation of the mesenchymal markers vimentin and Snail and the epithelial marker E-cadherin, promoting an invasive phenotype (16). Furthermore, IGFBP2 mediates resistance to MAPK inhibitors in melanoma (17).

MTC cell lines and tumors have shown dysregulation of receptor tyrosine kinases other than RET and their ligands, including EGFR, VEGFR2, and c-MET (18, 19). Therefore, despite a prominent role for RET in MTC tumorigenesis, it seems possible that cross-talk and direct interactions with other members of the receptor tyrosine kinase network also contribute to tumor development and TKI efficacy.

ONC201 is a first-in-class anticancer small molecule (imipridone) in phase II clinical trials in select advanced cancers (20, 21). ONC201 is first identified from an NCI chemical library screen describes as an imidazo[1,2-a]pyrido[4,3-d]pyrimine derivative and possesses an angular [3,4-e] structure (22). ONC201 triggers cell death in various tumor types through an integrated stress response (ISR) involving the transcription factor ATF4, the transactivator DDIT3 (CHOP), and the proapoptotic protein TRAIL encoded by TNFSF10 and TRAIL receptor, DR5 encoded by TNFSF10B (23, 24). This report demonstrates that RET promotes IGFBP2 and VEGFR2 expression, drivers of tumor growth in MTC xenografts. ONC201 induces cell death by inhibiting RET, IGFBP2, and VEGF2 at the transcriptional level and represents a novel therapeutic option that may benefit all patients with MTC, including those with TKI-refractory disease.

Antibodies specific to RET (D3D8R), IGFBP2 (catalog No. 3922), VEGFR2 (55B11), BBC3 (D30C10), and MCL1 (D35A5), DDIT3 (D46F1), and vinculin were purchased from Cell Signaling Technology. ATF4 antibody (D4B8) was purchased from Abcam. Anti–active caspase 3 (clone 10–1-62) and anti–cleaved PARP (ASP214) were purchased from BD Biosciences. ONC201 was obtained from Onceutics (22).

We purchased TT and 293T cells from ATCC and MZCRC1 cells were provided by Dr. Alex Knuth (National Center of Cancer Care and Research in Doha, Qatar) and were described previously (25, 26). TT cells carry a codon 634 cysteine to tryptophan (C634W) exon 11 RET mutation, and MZCRC1 cells have a codon 918 methionine to threonine (M918T) exon 16 RET mutation verified by sequencing. All cell lines were authenticated by short tandem repeat DNA profiling and tested negative for Mycoplasma using the cytogenetics and cell authentifcation core facility at the MD Anderson Cancer Center (MDACC). Cells used for the experiments were between two and five passages from thawing.

Reverse-phase protein array (RPPA) analyses were performed cell lysates from TT parental cells, and TT cells were stably transfected with nontarget shRNA and two individual RET shRNA and analyzed in the RPPA core at MDACC. Each sample has two biological replicates that were two-fold-serial diluted for five dilutions and arrayed on nitrocellulose and probed with antibodies and visualized by the colorimetric reaction. Relative protein levels for each sample were determined by interpolation to each dilution curves from the standard curve. All the data points were normalized for protein loading and transformed into linear value and used in the bar graph. Linear after normalization values were transformed to log₂ values and the median-centered for Hierarchical Cluster analysis for Heatmap. We stained 168 slides for 152 antibodies. The data for 152 antibodies with quality control scores higher than 0.8 is included in the Heatmap. Heatmap was generated using Cluster3.0 and Java TreeView1.1.1 (27).

Lentiviral vectors (pLKO.1) containing RET and IGFBP2-specific shRNAs or pLK0.1-puro nontarget shRNA control (shRNA insert) do not target any known genes from any species) were purchased from Sigma-Aldrich. Lentiviral control shRNA or RET-shRNAs or IGFBP2-shRNA plasmids were cotransfected into 293T cells along with packaging (VPR8.9) and envelope (VSV-G) plasmids for 2 days. The virus particles containing RET-shRNA, IGFBP2-shRNA, or control shRNA were used to infect TT or MZCRC1 cells. Transfected cells were selected in media containing 2 μg/mL of puromycin (Takara Bio).

Cell viability was measured using an MTT assay with 20,000 cells in a 96-well plate, as described previously (28). For cell-cycle analysis, cells were fixed in ice-cold 70% ethanol, stained with propidium iodide, and analyzed using a Beckman Coulters Gallios flow cytometer. Apoptotic cell death was measured by staining with antibodies against cleaved caspase-3 and cleaved PARP and analyzed using a flow cytometer. The migration assay was performed in 24-well transwell migration chambers with an 8.0-μm pore size (BD Biosciences) as described previously (29).

RNA and cDNA were prepared from cells using a Cells-to-CT kit (Invitrogen). Quantitative PCR was performed as described previously (28). Gene expression values were normalized to HPRT mRNA. According to the manufacturer's instructions, patient-derived samples were used to isolate RNA using an RNeasy kit (Qiagen). The normal thyroid control was purchased from Newcomer Supply. RNA was reverse transcribed into cDNA by using SuperScript III Reverse Transcriptase Kit (Invitrogen). Gene expression values were normalized to GAPDH mRNA. All real-time RT-PCR assays were performed in triplicate in at least two independent experiments.

MZCRC1 cells were treated with ONC201 (3 μmol/L) for 24 hours, and the chromatin immunoprecipitation assays were performed as described previously (28). Formaldehyde-fixed cells were immunoprecipitated overnight with anti-ATF4 antibody, H3K9ac antibody, or rabbit immunoglobulin G. Quantitative real-time PCR SYBR Green was used to determine the fold enrichment of immunoprecipitated material relative to immunoglobulin G with gene-specific primers at the specified regions.

Primers used for ChIP assay: forward-240 bp-ACCCGCGAGTTATCCGTATTC; reverse-240 bp-CCGTCCCTCCGCACTCTT; forward 1.3 Kb-CTTCAATTTCAGCTCCGACTCA; reverse 1.3 Kb-GGTAGAGAGGTGATGTGGTGGTT; forward 2 Kb GCCACAGTCAACTGGATTTCC; reverse-2 Kb-CAGAGTGCAGGATGCTTGCA.

The study group consisted of 52 patients diagnosed with MTC who underwent surgery at MDACC (Houston, TX). Primary tumors were stained with IGFBP2, as described previously (30). The fraction of IGFBP2-positive tumor cells, as well as the staining intensity, were assessed. IGFBP2 score (H-score) was calculated by multiplying the percentage of stained tumor cells by the staining intensity (1–4), obtaining a range of 1–400 (30). An H score of less than 20 was considered low, and above 20 was considered high. Clinical and histopathologic characteristics of the study population are shown in Supplementary Table S1.

Five-week-old male NOD-SCID gamma mice (Jackson laboratory) are maintained under pathogen-free conditions. A total of 5 × 10⁶ TT and MZCRC1 cells in 100 μL of PBS/50% Matrigel were subcutaneously injected into the rear flanks of mice. When tumors reached 100 mm³, the mice were randomly divided into two groups (eight mice per group) and treated with either control vehicle or ONC201 (120 mg/kg/week) by oral gavage. Every week, tumor volumes were measured with a caliper and calculated as V = A × B2 × 0.5326 (A = long axis, B = short axis), and mice were weighed. At the end of the experiments, the mice were euthanized, and the tumors were harvested and weighed. The animal protocol was approved by the Institutional Animal Care and Use Committee at MDACC (Houston, TX).

This study is a retrospective study of 52 patients who underwent surgery between 1986 to 2016 at MDACC (Houston, TX) with approval from the Institutional Review Board. TNM staging was based on the American Joint Committee on Cancer 7th edition staging criteria (31). Overall survival was measured from the date of diagnosis until death from any cause. RET germline mutation (exon 16) status was determined by sequencing. Nineteen of the 52 sporadic MTCs (36%) in this cohort showed a somatic RET^M918T mutation. Disease status was censored at the last evaluation or time of death. Overall survival was measured from the date of diagnosis, defined as the date of initial surgery, until death from any cause.

All data were expressed as mean ± SD. Data were analyzed with GraphPad Prism 7 software using the indicated tests. Statistical significance was indicated as follows: *, P < 0.05; **, P < 0.01; ***, P < 0.001; and ****, P < 0.0001. For patient-related data, unadjusted survival distributions were estimated by the Kaplan–Meier method and compared using the log-rank test. Firth penalized Cox regression models were fitted when there was no observed event (i.e., death) for a covariate-defined subgroup. All statistical analyses were performed using R version 3.5.1.

To uncover additional signaling molecules regulated by RET, we performed a reverse-phase protein array analysis of TT cells subjected to stable RET knockdown using independent short hairpins. This antibody-based array included 152 antibodies to detect total protein levels or specific posttranslational modifications of protein. We identified subsets of proteins with differential expression between control shRNA and two shRNA-RET cell lines. We observed downregulation of AKT-p473, Claudin 7, IGFBP2, MAPK-T202-Y204, S6-S240-S244, S6-S235-S236, and VEGFR2 and upregulation of 4E-BP1, ACC1, BAX, cleaved caspase 7, IGF-1R (Fig. 1A and B). We chose to study IGFBP2 and VEGFR2 that showed a substantial difference in expression profiles between RET knockdown and con shRNA. The validation of RPPA by Western blot analysis demonstrated that RET depletion reduced the protein levels of IGFBP2 and VEGFR2 (Fig. 1C). As expected from earlier studies (10), RET-depleted cells showed the upregulated expression of ATF4 in RET-shRNA cells as well as the ATF4 target DDIT3 (CHOP) (Fig. 1C). To examine whether RET regulates IGFBP2 and VEGFR2 at the transcriptional level, we examined the VEGFR2 and IGFBP2 mRNA levels in RET-depleted cells. In two independently selected TT and MZCRC1 cell pools, we found that RET depletion was associated with the downregulation of IGFBP2 and VEGFR2 at the mRNA level (P < 0.0001, two-way ANOVA, Dunnett multiple comparison test; Fig. 1D and E).

IGFBP2 is elevated in the serum of patients with advanced cancers such as glioblastoma, gastric, prostate, and breast cancer and is associated with progression and metastasis (11–14). To determine the role of endogenous IGFBP2 in the pathogenesis of MTC, we generated stable IGFBP2 knockdown cells using independent short hairpins in both TT and MZCRC1 cell lines. We observed that IGFBP2 knockdown decreased cell survival and migration of TT cells (Fig. 2A–C) (P < 0.0001, two-way ANOVA, Dunnett multiple comparison test) and decreased cell survival of MZCRC cells (Supplementary Fig. S1A and S1B)

A role for IGFBP2 in MTC has not been identified. To investigate the clinical significance of IGFBP2 in MTC, we examined the expression of IGFBP2 in a cohort of 52 MTC tumor tissues by IHC (Fig. 2D). The median follow-up time was 98.2 [interquartile range (IQR), 37.9–134.4)] months. High IGFBP2 expression (H-score>20) was detected in 26 of 52 MTC specimens (50%), of which seven had a concurrent RET ^M918T mutation. (Supplementary Table S1). The expression levels of IGFBP2 were increased in patients with pT3 and pT4 primary tumors relative to those with pT1 and pT2 tumors (P = 0.005) and increased in M1 (P = 0.016; Fig. 2E and F). The elevated IGFBP2 expression in primary tumors was associated with shorter survival in patients with MTC [HR, 0.12; 95% confidence interval (CI), 0.03–0.53; P = 0.005; Fig. 2G]. The median overall survival was 107 months (95% CI, 87.7–not reached) in patients whose tumors had high levels of IGFBP2 but was undefined in patients whose tumors had low IGFBP2 protein expression. These findings validate the clinical importance of IGFBP2 in MTC and make a compelling argument for future studies to understand the regulation of IGFBP2 expression and the function.

The analysis of VEGFR2 expression levels in the 318 cell lines representing various cancers in the GlaxoSmithKline data set (E-MTAB-37) showed higher expression of VEGFR2 in both MTC cell lines than in any other cell line (Fig. 3A). The RET-mediated upregulation of VEGFR2 suggests that the VEGF signaling pathway plays a biologically relevant role in MTC cell survival. Therefore, we examined the possible existence of an autocrine loop involving VEGFR2 in MTC cells. To this end, control shRNA or RET-shRNA TT and MZCRC1 cells were serum-starved and then treated with an increasing dose of recombinant VEGFA for 72 hours. Using the MTT viability assay, we found that VEGF stimulates MTC cell survival by 20% to 40%, and RET-depleted cells did not respond to VEGFA while control cells did (Fig. 3B and C).

Then, to investigate a potential association between RET and VEGFR2 mRNA levels in primary tumors, we examined the mRNA expression of VEGFR2 in 15 MTC tumor tissues (seven MTC with RET-M918T mutation and eight MTC without RET-M918T mutation). The range of VEGFR2 mRNA increase was 1.13–105 fold compared with the normal thyroid, and the mean of VEGFR2 mRNA expression was higher in MTCs with a RET M918T mutation compared with MTC tumors without a RET M918T mutation but did not reach significance (P = 0.09; Fig. 3D).

We analyzed the protein levels of RET and VEGFR2 in nine primary MTCs with or without RET-M918T mutation. Western blot analysis showed a positive association of RET and VEGFR2 protein levels across the primary tumors regardless of RET mutational status (Pearson r = 0.91, r² = 0.84, P = 0.0005; Fig. 3E and F); these results suggest that RET promotes VEGFR2 expression in MTC.

ONC201 is a small-molecule, p53-independent inducer of TRAIL and the integrated stress response pathway, involving ATF4, the transactivator DDIT3, and the TRAIL receptor DR5 with antiproliferative and proapoptotic properties against a wide range of malignant but not normal cells (23). Our laboratory previously identified a crucial role of RET in preventing apoptotic cell death through direct interaction to facilitate degradation of ATF4, a universal stress-responsive gene, and an essential effector of the integrated stress response pathway (10). Therefore, we hypothesized that a small-molecule inducer of ATF4 could resensitize cancer cells to stress-induced apoptosis in MTC. ONC201 treatment at various concentrations led to a dose-dependent reduction of TT and MZCRC1 MTC cells' cell viability as assessed by MTT assay (EC₅₀: 5 μmol/L; Fig. 4A). Cell-cycle analysis showed a dose-dependent increase in the sub-G₁ population in ONC201-treated TT and MZCRC1 cells (Fig. 4B, Supplementary Fig. S2). ONC201 treatment of MTC cells for 72 hours increased cell death, as demonstrated by quantification of cleaved caspase 3 and cleaved PARP (Fig. 4C). As expected, ONC201 increased the protein levels of ATF4 and ATF4 targets, including BBC3 and DDIT3, but decreased RET protein levels and survival factor MCL1, all in a dose-dependent manner in MTC cells (Fig. 4D and E). ONC201 also decreased the expression of IGFBP2 and VEGFR2 in these cells (Fig. 4D and E). To determine whether ONC201 regulates the expression of RET and its targets at the transcriptional level, we examined the effect of this compound on mRNA levels of these genes by quantitative real-time PCR. We observed that ONC201 decreased the mRNA levels of RET, IGFBP2, and VEGFR2 in a dose-dependent manner, more efficiently in MZCRC1 cells than in TT cells (Fig. 5A–C). Moreover, MZCRC1 cells treated with ONC201 (3 μmol/L) for 72 hours had 2.4-fold increased ATF4 mRNA levels (Fig. 5D). The treatment also increased the expression of reported ATF4 target genes (28), including BBC3 (5.9-fold), DDIT3 (65-fold), DUSP8 (1.7-fold), MKNK2 (2-fold), KLF9 (2-fold), LZTFL1 (4-fold), and SESN2 (6-fold).

To determine whether IGFBP2 expression was functionally crucial for sensitivity to ONC201, we treated IGFBP2-depleted MTC cells with ONC201 and measured cell survival. IGFBP2 knockdown increased cell sensitivity to ONC201 (Fig. 5E). Thus, these results suggest that high expression of IGFBP2 may cause resistance to ONC201-induced cell death.

The ConTra V3 web server (32) has predicted several binding sites of ATF4 in the IGFBP2 promoter (-219, -396, -1318, -1433, -1652; ATF4 binding sequence: GTGACGT[AC][AG]-3′; Supplementary Fig. S3); we therefore examined whether ATF4 mediates RET regulation of IGFBP2 transcription. To test whether IGFBP2 is a direct target of ATF4, we examined the binding of ATF4 to the IGFBP2 promoter. As shown by chromatin immunoprecipitation assay, using specific primers for several subregions covering promoter and enhancer regions of the IGFBP2 promoter showed that ATF4 bound the IGFBP2 promoter and enhancer regions in MTC cells (Fig. 5F). ATF4 occupancy was significantly increased at the IGFBP2 promoter but decreased at the enhancer regions in MZCRC1 cells treated with ONC201 compared with untreated cells (Fig. 5F). The recruitment of H3K9ac to the IGFBP2 promoter was decreased in cells treated with ONC201, suggesting repression of IGFBP2 (Fig. 5G). Therefore, RET may promote IGFBP2 expression through repression of ATF4 transcriptional activity.

To evaluate the anticancer activity of ONC201, we administered ONC201 orally to male Nod-SCID gamma mice bearing TT and MZCRC1 xenograft tumors. TT and MZCRC1 cell xenografts were treated with ONC201 weekly by oral gavage at 120 mg/kg for eight weeks. ONC201 decreased tumor growth by 80%-90% (P < 0.0001; Fig. 6A and B). At the end of treatment, tumors were significantly smaller in ONC201-treated mice compared with control vehicle-treated mice. (Supplementary Fig. S4A and S4C). We observed no overt toxicity of treatment or significant weight changes during the treatment period (Supplementary Fig. S4B and S4D). In ONC201-treated tumors, the protein levels of RET, IGFBP2, and VEGFR2 were decreased compared with untreated mice (Fig. 6C and D). The proliferation index, Ki-67, was decreased by 30% in ONC201-treated tumors compared with untreated tumors, indicating decreased cell proliferation (Fig. 6E). IHC analysis showed an 80% decrease in IGFBP2 expression in ONC201-treated compared with control tumors (Fig. 6F). CD31 tumor staining showed that the number of vessels was decreased by 63% in ONC201-treated compared with untreated mice (Fig. 6G). These results demonstrate preclinical single-agent efficacy of ONC201 in MTC and downregulation of a key driver of MTC, RET, along with its molecular targets VEGFR2 and IGFBP2.

In this study, our results indicate that RET protooncogene promotes the expression of VEGFR2 and IGFBP2 in MTC. We demonstrate that IGFBP2 promotes cell survival and migration of MTC cells and that high IGFBP2 expression is associated with poor overall survival, higher T category, and distant metastasis, suggesting a central role in the pathogenesis of MTC. Also, our findings demonstrate that small-molecule ONC201 inhibits RET, VEGFR2, and IGFBP2 expression leading to increased apoptotic cell death and inhibition of tumor growth.

Increasing evidence suggests that IGFBP2 promotes cell survival and an aggressive phenotype in many malignancies (33). Our data show that RET promotes IGFBP2 expression, which, in turn, contributes to increased cell survival, progression, and resistance to therapy. These results suggest that IGFBP2, known to be elevated in patients with advanced cancers and associated with progression, may serve as a novel biomarker of aggressive MTC that could be quantified in serum or tumor tissues. IGFBP2 may act in other ways, as it is translocated into the nucleus and binds to the VEGF gene's promoter region, leading to increased VEGF mRNA expression (34). Das and colleagues reported that secreted IGFBP2 activated the PI3K/AKT pathway, leading to the upregulation of the proangiogenic factor VEGFA thereby triggering angiogenesis (35). Moreover, IGFBP2 promotes vasculogenic mimicry formation, that isi.e., the fluid-conducting channels formed by aggressive gliomas (36). We found that VEGFA increased the survival of MTC cells and that this increase was abrogated by depletion of RET, suggesting the involvement of an autocrine loop with VEGFA and VEGFR2, leading to increased cell survival, cell proliferation, and angiogenesis in MTC tumors.

As noted earlier, EGFR and VEGFR2 are upregulated in metastatic MTC compared with primary tumors (19). Our studies showed a positive association between RET protein levels and VEGFR2 protein levels in MTC tumors, confirming our data in MTC cell lines showing RET depletion in both TT(RET-W634T) and MZCRC1(RET-M918T) downregulates VEGFR2 mRNA levels suggesting that RET activation promotes VEGFR2 transcription.

The current standard of care for MTC is a combination of surgery and multi TKIs. These TKIs tend to be static rather than cidal, leading to secondary RET mutations (such as RET V804) that confer resistance (37). Although there is clear evidence that both first and second generations of TKIs cause tumor size reduction with increased MTC cell death, these effects are invariably incomplete leading to tumor regrowth after TKI discontinuation. Thus, a novel compound that strongly downregulates RET expression could be beneficial for refractory MTC. Furthermore, TKIs that target VEGFR2 selectively with little RET activity (e.g., axitinib) have significant efficacy in MTC, suggesting that inhibition of VEGF receptor signaling contributes to anti-MTC response (38). Our results establish a link between RET activity and expression of VEGFR2, identifying a regulatory loop between RET and VEGFR2 expression. To date, all multikinase inhibitors, including cabozantinib, vandetanib, mostenib, nintedanib, inhibit RET, or VEGFR2 activity without affecting RET or VEGFR2 protein levels (39–41). However, dinaciclib, a CDK1/2/5/9 inhibitor that reduces CDK9, is shown to reduce RET protein and RET mRNA levels and induce apoptosis in MTC cells (42).

ONC201 is currently in early-phase clinical trials for several cancers, including leukemia, lymphoma, glioblastoma, and prostate cancer, without severe toxicity reported to date (20). ONC201 has many favorable characteristics for an anticancer drug, including oral, infrequent administration, and an excellent safety profile. ONC201 activates the integrated stress response pathway through ATF4 and its target DDIT3 (23, 43, 44). We have previously shown that RET promotes cell survival through phosphorylation-dependent degradation of ATF4 and that overexpression of ATF4 leads to RET ubiquitination (30, 45). Here, we showed that ONC201 strongly increased the transcription of ATF4 and ATF4 targets, including DDIT3, BBC3, DUSP8, MKNK2, KLF9, LZTFL1, and SESN2 with known proapoptotic and tumor suppressor function (46–48). We showed that ATF4 recruits to the promoter and enhancer region of the IGFBP2 gene and ATF4 occupancy at the IGFBP2 promoter are enhanced in MTC cells treated with ONC201 compared with untreated cells, whereas H3K9Ac recruitment was significantly decreased, suggesting that ATF4 may repress IGFBP2 transcription. Thus, RET may promote IGFBP2 transcription through repression of ATF4 transcriptional activity.

Moreover, targeting RET and VEGFR2 at the transcriptional level by ONC201 may represent a novel, and potent therapeutic approach in both RET mutated or nonmutated tumors. MTC is a highly vascular tumor in a growth factor–rich microenvironment, and RET inhibition may have profound effects on VEGF-dependent biological processes. Moreover, ONC201 may decrease blood vessels' growth in MTC by inhibiting VEGFR2 expression and disturbing a VEGF/VEGFR2 autocrine loop. In summary, our results identified a novel ONC201 mechanism of action through regulation of RET and its targets, VEGFR2 and IGFBP2; this mechanism can be translated directly into the clinical research goals and provide a promising strategy for treatment in MTC.

R. Dadu reported grants from Exelixis, Eisai, Merck, and AstraZeneca; in addition, R. Dadu reported personal fees from Exelixis and personal fees from Bayer outside the submitted work. R.S. Tarapore is an employee and stockholder of Oncoceutics that has provided the research material ONC201. J.E. Allen reported nonfinancial support and other from Oncoceutics during the conduct of the study; in addition, J.E. Allen had a patent for ONC201 and derivatives pending, issued, licensed, and with royalties paid from Oncoceutics. M.D. Williams reported grants from NIH during the conduct of the study. R.F. Gagel reported other from Novo Nordisk outside the submitted work. No potential conflicts of interest were disclosed by the other authors.

R. Bagheri-Yarmand: Conceptualization, resources, data curation, software, formal analysis, supervision, funding acquisition, validation, investigation, visualization, methodology, writing–original draft, project administration, writing–review and editing. R. Dadu: Investigation, acquired patient database. L. Ye: Methodology. Y.S. Jebaraj: Methodology. J.A. Martinez: Methodology. J. Ma: Software, statistical analysis. R.S. Tarapore: Resources, provided ONC201. J.E. Allen: Resources. S.I. Sherman: Writing–review and editing. M.D. Williams: Investigation, writing–review and editing. R.F. Gagel: Resources, supervision, funding acquisition, writing–review and editing.

We thank Krishna Sinha for the helpful discussion. We thank Sarah Bronson in Scientific Publications, Research Medical Library, at The University of Texas MD Anderson Cancer Center for editing the manuscript.

This work was supported by the NIH through grants P50CA168505/DRP (to R. Bagheri-Yarmand) and used RPPA-functional proteomics, flowcytometry and cellular imaging, cytogenetics and cell authentication, and cell research histology cores that are supported by the Cancer Center Support Grant (P30CA01667).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.