Pancreatic ductal adenocarcinoma (PDAC) is one of the most chemotherapy- and radiotherapy-resistant tumors. The c-Met and Hedgehog (Hh) pathways have been shown previously by our group to be key regulatory pathways in the primary tumor growth and metastases formation. Targeting both the HGF/c-Met and Hh pathways has shown promising results in preclinical studies; however, the benefits were not readily translated into clinical trials with PDAC patients. In this study, utilizing mouse models of PDAC, we showed that inhibition of either HGF/c-Met or Hh pathways sensitize the PDAC tumors to gemcitabine, resulting in decreased primary tumor volume as well as significant reduction of metastatic tumor burden. However, prolonged treatment of single HGF/c-Met or Hh inhibitor leads to resistance to these single inhibitors, likely because the single c-Met treatment leads to enhanced expression of Shh, and vice versa. Targeting both the HGF/c-Met and Hh pathways simultaneously overcame the resistance to the single-inhibitor treatment and led to a more potent antitumor effect in combination with the chemotherapy treatment. Mol Cancer Ther; 16(11); 2399–409. ©2017 AACR.

Pancreatic ductal adenocarcinoma (PDAC) has the worst prognosis of any major malignancy, with 5-year survival of about 5% (1, 2), and is one of the most chemotherapy- and radiotherapy-resistant tumors (2, 3). PDAC is characterized by very dense stroma that makes up anywhere from 60% to 90% of the total tumor volume (4). The stromal compartment is made up of a variety of different cells and proteins that act together to develop an environment that is suppressive to the immune system, drug resistant, and protumorigenic (5). Although there have been numerous new therapies developed for other cancers, little progression has been made finding new therapies for PDAC despite promising results from preclinical studies.

It is well documented that c-Met receptor and its ligand HGF are upregulated in PDAC (6). Upregulation of c-Met and HGF is detected early in PDAC development and promotes tumorigenesis in conjunction with other oncogenic signals (7). Because HGF is exclusively secreted by stromal fibroblasts (8) and stromal expression of HGF was correlated with decreased disease-free survival (9), activation of c-Met in neoplastic cells is believed to be subject to the regulation of signals from the stroma. More recently, HGF/c-Met has been investigated as a therapeutic target for PDAC. The combination of gemcitabine and crizotinib, a small-molecule c-Met inhibitor, was tested in murine models and was shown to enhance the intratumoral delivery of gemcitabine and result in tumor reduction of the PDAC xenograft (10). Moreover, Jin and colleagues showed that antibody targeting of c-Met receptor in an orthotopic mouse model of PDAC led to decreased tumor burden and prolonged survival (11). More recently, HGF/c-Met inhibitors have been tested in multiple early-phase clinical trials, which have shown promising results in a variety of solid cancers (10). Unfortunately, the phase II trial of cabozantinib showed minimal benefits in patients with PDAC, despite promising results in subjects with other solid tumors (12, 13).

The hedgehog (Hh) pathway, specifically the activating ligand, Sonic hedgehog (Shh), is overexpressed by PDAC tumor cells; however, its function is restricted to the stromal compartment (14–16). It has been noted that Hh pathway activation and Smo receptor overexpression only occur in cancer-associated fibroblasts but not the neoplastic cells (17). It was subsequently reported that targeting Hh pathway in murine models of PDAC depletes stroma and sensitizes primary tumors to gemcitabine, leading to tumor shrinkage (18, 19). However, targeting the Hh pathway in patients with PDAC showed no additional benefit when added to the standard-of-care chemotherapy treatments (20).

Although targeting both the HGF/c-Met and Hh pathways has shown promising results in preclinical studies, the benefits were not readily translated into clinical trials with PDAC patients (20–23). Thus, we investigated the mechanisms of resistance to the single inhibitor of HGF/c-Met or Hh pathway and determined whether targeting both the HGF/c-Met and Hh pathways simultaneously would overcome the resistance to single inhibitor treatment and lead to a more potent antitumor effect in combination with chemotherapy treatment.

Cell culture

The murine pancreatic tumor cell lines KPC and mouse cancer-associated fibroblasts (mCAF) were established in accordance with the Johns Hopkins Medical Institution Institutional Review Board (JHMI IRB)-approved protocols, obtained between 2011 and 2015, authenticated by DNA and gene expression profiling, and cultured as described previously (24, 25). Briefly, cells were maintained in RPMI1640 medium (Gibco) supplemented with 10% FBS (Gibco), 2 mmol/L l-glutamine (Gibco), 1% nonessential amino acids (Gibco), 1 mmol/L sodium pyruvate (Gibco), 50 U/mL penicillin, and 50 μg/mL streptomycin (Gibco). The KPC cells were grown at 37°C in 5% CO2.

Mouse models of PDAC

All animal experiments conformed to the guidelines of the Animal Care and Use Committee of the Johns Hopkins University (Baltimore, MD), and animals were maintained in accordance with the guidelines of the American Association of Laboratory Animal Care. All mice were monitored twice a day.

A genetically engineered mouse model of PDAC, designated KPC mice, was previously established through a knock-in of pancreatic-specific, conditional alleles of the KRASG12D and TP53R172H mutations on a mixed 129/SvJae/C57Bl/6 background. These mice, when crossed with PDX-1-CRE+/+ mice, develop PanIN lesions that progress stepwise, similar to human disease, into PDAC (26).

The mouse pancreatic orthotopic model was described previously (27). In brief, 2 × 106 KPC cells were subcutaneously injected into the flanks of syngeneic female C57Bl/6 mice. After 1 to 2 weeks, the subcutaneous tumors were harvested and cut into approximately 1-mm3 pieces. New syngeneic female C57Bl/6 mice, ages 8 to 10 weeks, were anesthetized. The abdomen was opened via a left subcostal incision. A small pocket was prepared inside the pancreas using microscissors, into which one piece of the subcutaneous tumor was implanted. The incision in the pancreas was closed with a suture. The abdominal wall was sutured, and the skin was adapted using wound clips.

c-Met and Hh inhibitor and gemcitabine treatments

For the in vivo studies, the Hh signaling pathway inhibitor (28) NVP-LDE225 (provided by Novartis) was used at 50 mg/kg and the HGF/c-Met inhibitor INCB28060 (purchased from AbMole; refs. 29, 30) was used at 1 mg/kg, and both inhibitors were resuspended in DMSO. DMSO was used as a vehicle control for all treatments. The KPC and orthotopic transplant model mice were dosed daily by oral (31) gavage with NVP-LDE225, INCB28060, NVP-LDE225 + INCB28060 (at the same dose as their corresponsive single inhibitor treatments) or DMSO for 7, 14, or 21 days as indicated in the treatment schemas (Figs. 1, 3, and 4). In vitro experiments utilizing the abovementioned inhibitors were described previously (25). Gemcitabine (Sigma-Aldrich) was reconstituted in deionized and distilled water at 20 mg/mL and 100 μL administered via intraperitoneal injection into respective mice.

Figure 1.

Short-term inhibition of HGF/c-Met or Hh signaling enhances the sensitivity of PDAC tumors to gemcitabine in transgenic and orthotopic mouse models of PDAC. A, Schematic representation of 1-week treatment regimen in the transgenic (KPC) and orthotopic mouse models of PDAC. Day 0 represents the day of the orthotopic implantation of primary pancreatic tumors. Mice in the orthotopic model were subjected to ultrasound on postoperative day 5 to establish baseline tumor data. Daily treatment by oral gavage with inhibitor(s) or vehicle control was initiated on the day after ultrasound. In the KPC mouse model, ultrasound was performed 1 day prior to treatment initiation. In both models, gemcitabine was administered biweekly by intraperitoneal injection. Second ultrasound was performed on the last day of treatment. Mice from all groups were euthanized on the last day of treatment and the panreata and livers were harvested for analysis. B and C, The KPC (B) and orthotopic (C) mouse models of PDAC were treated with daily Hh and/or HGF/c-Met inhibitors and biweekly gemcitabine as shown in A. Tumor volumes were obtained at baseline and on the last day of treatment. The data show tumor volume fold changes calculated as a ratio by comparison of the posttreatment tumor volume to the baseline tumor volume. Data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem, gemcitabine (n = 8); Hh-Hh inhibitor + gemcitabine (n = 9); c-Met-HGF/c-Met inhibitor + gemcitabine (n = 7); DMSO-vehicle control (n = 14); Hh + c-Met + gemcitabine (n = 8). * p < 0.05, ** p < 0.01 *** P < 0.001; **** P < 0.0001; n.s., non significant; (unpaired Student t test).

Figure 1.

Short-term inhibition of HGF/c-Met or Hh signaling enhances the sensitivity of PDAC tumors to gemcitabine in transgenic and orthotopic mouse models of PDAC. A, Schematic representation of 1-week treatment regimen in the transgenic (KPC) and orthotopic mouse models of PDAC. Day 0 represents the day of the orthotopic implantation of primary pancreatic tumors. Mice in the orthotopic model were subjected to ultrasound on postoperative day 5 to establish baseline tumor data. Daily treatment by oral gavage with inhibitor(s) or vehicle control was initiated on the day after ultrasound. In the KPC mouse model, ultrasound was performed 1 day prior to treatment initiation. In both models, gemcitabine was administered biweekly by intraperitoneal injection. Second ultrasound was performed on the last day of treatment. Mice from all groups were euthanized on the last day of treatment and the panreata and livers were harvested for analysis. B and C, The KPC (B) and orthotopic (C) mouse models of PDAC were treated with daily Hh and/or HGF/c-Met inhibitors and biweekly gemcitabine as shown in A. Tumor volumes were obtained at baseline and on the last day of treatment. The data show tumor volume fold changes calculated as a ratio by comparison of the posttreatment tumor volume to the baseline tumor volume. Data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem, gemcitabine (n = 8); Hh-Hh inhibitor + gemcitabine (n = 9); c-Met-HGF/c-Met inhibitor + gemcitabine (n = 7); DMSO-vehicle control (n = 14); Hh + c-Met + gemcitabine (n = 8). * p < 0.05, ** p < 0.01 *** P < 0.001; **** P < 0.0001; n.s., non significant; (unpaired Student t test).

Close modal

Ultrasound and tumor measurement

KPC mice of 12 to 14 weeks were examined by ultrasound using the VEVO 770 (VisualSonics) small animal ultrasound to confirm primary tumors. Mice bearing tumors of similar sizes were chosen for the study. Orthotopic mice were examined by ultrasound 5 days after tumor implantation to confirm the presence of the tumor and establish a baseline tumor volume. Ultrasound on the mice was performed again on day 7 of treatment in all experiments and on treatment day 14 and 21 in experiments with 14- and 21-day treatments. Tumor volume was calculated from the following formula: [L (long axes) × S2 (short axes)]/2. In total, three images of each tumor were captured, and the image with the largest value was used to calculate the tumor volume. Tumor volume fold change was determined for each 7 days of treatment by calculating the ratio of tumor volume from week 1/baseline, week 2/week 1, and week 3/week 1.

TUNEL assay

The TUNEL (terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick end labeling) assay was performed according to the manufacturer's instructions (Roche). Briefly, the slides were baked at 62.5°C for 30 minutes to melt the paraffin. Then, the slides were hydrated and proteinase K was added for 30 minutes at room temperature to expose the tissue. Following 5-minute wash in PBS, the TUNEL reaction solution was added to slides and positive control (DNAse I–mediated DNA breakage) and incubated for 60 minutes at 37°C, protected from light. For negative control, label solution only was added to a slide and incubated as above. Then, all slides were washed 3 times in PBS (5 minutes for each wash). After the washes, converted POD was added to the slides, and the slides were incubated again for 60 minutes at 37°C, protected from light. Following another 3 washes in PBS (5 minutes each), DAB was added to develop the reaction (10 minutes). Finally, the slides were washed as above, dehydrated, mounted, and subjected to analysis.

IHC and Immunofluorescence

IHC staining for Shh, c-Met, E-cadherin, IGF-1, and Ki67 were performed by hand. Tissue blocks with poor quality were excluded from the study. The slides for all stainings were hydrated; antigen retrieval was performed in a pressure cooker with citrate buffer (pH 6.0) for Shh and Ki67, in a steamer with citrate buffer (pH 6.0) for c-Met and IGF-1 and with Tris-EDTA buffer (pH 9.0) for E-cadherin. Then, the slides were blocked in peroxidase, avidin, and biotin block sequentially. Goat-anti-Shh (R&D), rabbit-anti-c-Met (Santa Cruz Biotechnology), rabbit anti-IGF-1 (Abcam), rabbit anti-E-Cadherin (Abcam), or rabbit anti-Ki67 (Abcam) primary antibodies at 1:50 (Shh, c-Met, E-cadherin), 1: 500 (Ki67), and 4 μg/mL (IGF-1) were added, and the slides were incubated for 1 hour at room temperature. Then, rabbit anti-goat or goat anti-rabbit biotinylated secondary antibodies (Vector Laboratories), respectively, were added for 30 minutes at room temperature. The signal was amplified and detected using the ABC Vectastain Kit (Vector Laboratories) according to the manufacturer's instructions. The slides were developed using DAB and counterstained by hematoxylin. Finally, the slides were dehydrated and mounted. All IHC slides were analyzed and scored by a pathologist. Immunofluorescence staining of c-Met and Shh was described in Supplementary Materials and Methods.

shRNA knockdown of c-Met

Viral supernatants were produced as previously described using shRNA against mouse c-Met or scrambled shRNA control (Dharmacon; ref. 27). Then, KPC cells were plated at 50% confluency and allowed to adhere for 24 hours. On the day of viral infection, the KPC media were aspirated and replaced with appropriately tittered viral supernatant (1mL/1 well of 6-well plate) with polybrene (8 μg/mL). The infection was allowed to proceed for 24 hours. After 24-hour infection, the cells were treated with appropriate inhibitors or vehicle control for additional 24 hours. Then, the cells were harvested and Annexin V expression was analyzed as described previously (32). Knockdown of c-Met was confirmed by qRT-PCR as described below.

qRT-PCR

The RNeasy Micro Kit (Qiagen Inc.) was used to extract total RNA from cell pellets. The RNA was then converted to cDNA using the Superscript III First Strand Synthesis Supermix Kit (Life Technologies). qPCR was performed on the StepOnePlus Real Time PCR System (Life Technologies) and analyzed by the StepOne software V2.1. The expression of c-Met, HGF, and Shh was measured by SYBR Green–based qPCR. All gene expression was normalized to the expression of GAPDH. All PCR reactions were performed in triplicate. The primers used for RT-PCR are as follow:

  • c-Met: F-5′TGTCCGATACTCGTCACTGC3′

  • R-5′CATTTTTACGGACCCAACCA 3′(Invitrogen),

  • Shh: F-5′GGCCAAGGCATTTAACTTGT

  • R-5′CCAATTACAACCCCGACATC3′(Invitrogen),

  • GAPDH: F-5′TTGATGGCAACAATCTCCAC3′,

  • R-5′CGTCCCGTAGACAAAATGGT 3′ (Invitrogen).

Coculture assay

Treatment utilizing the transwell system (BD Biosciences) was performed by plating KPC cells in the bottom chamber and mCAFs in the top chamber to spatially separate the cell types. c-Met was knocked down from KPC cells, whereas the mCAFs were kept in a separate 6-well plate(s) during infection. After 24-hour infection, the cells were treated in no serum media as described previously (25). After 24-hour treatment, KPC cells were harvested and Annexin V analyzed.

Statistical analysis

Statistical analysis and graphing was performed using GraphPad Prism version 6.0 software (GraphPad Software). The data are presented as the means ± SEM. Student t test was used to compare differences between groups. Fisher exact test was used to compare differences between treatment groups in the metastasis study and apoptosis study. For all analyses, a P value of less than 0.05 was considered statistically significant.

Short-term inhibition of HGF/c-Met or Hh signaling enhances the sensitivity of PDAC tumors to gemcitabine in transgenic and orthotopic mouse models of PDAC

To understand the discrepancy in the efficacies observed between preclinical mouse studies and clinical studies of Hh inhibitors and HGF/c-Met inhibitors for treating PDACs, we examined both inhibitors in mouse models of PDAC. To this end, we utilized two mouse models of PDAC. The first is a genetically engineered PDAC mouse model with knock-in alleles of both KrasG12D and p53R172H mutants (KPC mice), which exhibits a multistage tumorigenesis that progresses from normal, through PanIN lesions, to invasive and metastatic PDAC (26). The second is an orthotopic implant model where tumors are grown subcutaneously from a cell line (the KPC cells) derived from KPC mice. Then, tumors of similar size are implanted orthotopically into the pancreas of syngeneic mice (24). The treatment schema is shown in Fig. 1A. Briefly, mice in both models were subjected to the small animal ultrasound examination to obtain baseline tumor volume. On the second day following the ultrasound, mice began daily treatment of either Hh inhibitor or HGF/c-Met inhibitor together with biweekly gemcitabine injection for a course of 7 days. On the last day of treatment, the mice were subjected to a second ultrasound to determine tumor volume. After the ultrasound, the mice were euthanized and their pancreata were harvested for analysis. In both models, the treatment of gemcitabine alone showed a modest, however not significant decrease of primary tumor growth when compared with the vehicle treatment. Addition of Hh inhibitor to the gemcitabine resulted in a further trend of tumor shrinkage when compared with gemcitabine treatment alone. Addition of c-Met inhibitor to the gemcitabine however did not result in additional tumor shrinkage. The additional effect on tumor shrinkage observed with Hh inhibitor but not the c-Met inhibitor can be explained by the targets of the inhibitors. The Hh inhibitor affects stroma, whereas the c-Met inhibitor works predominantly on the neoplastic cells (25). The data suggest that combination of both inhibitors with gemcitabine shows a trend in shrinkage of primary tumor volume in both mouse models of PDAC after 1 week of treatment regimen (Fig. 1B and C).

To assess whether the observed tumor shrinkage is due to tumor cell death, but not a decrease in the stroma compartment, we performed terminal deoxynucleotidyl transferase (TdT) dUTP nick-end labeling (TUNEL assay) staining on the primary tumors harvested from the KPC and the orthotopic mouse models (Fig. 1A) to evaluate tumor cell apoptosis. Tumors from neither model showed significant difference in tumor cell apoptosis in the gemcitabine treatment group when compared with the vehicle treatment (Fig. 2A and B). However, we observed an increased apoptosis in PDACs treated with gemcitabine in combination with c-Met inhibitor. In contrast, little enhanced apoptotic activity was seen in the tumors treated by the combination of gemcitabine and Hh inhibitor compared with gemcitabine alone, suggesting that the observed tumor shrinkage by ultrasound may represent a decrease in the stromal component. The apoptotic activity in tumors treated by gemcitabine and c-Met inhibitor was similar to that in tumors treated by gemcitabine and both inhibitors (Fig. 2A and B). Taken together, following 1 week of treatment, there are some enhancements in antitumor activity by adding c-Met or Hh inhibitor or both to gemcitabine. Although the enhancement is modest in our study, it is consistent with the published preclinical studies.

Figure 2.

Combination of Hh and/or HGF/c-Met inhibitor(s) with gemcitabine in short-term treatment regimen results in enhancement tumoral cell death in the transgenic (KPC) and orthotopic mouse models. A and B, The KPC (A) and orthotopic (B) mouse models of PDAC were treated with Hh and/or HGF/c-Met inhibitor(s) and biweekly gemcitabine as shown in Fig. 1A. Primary tumors from both mouse models were harvested on the last day of treatment and subjected to TUNEL staining for apoptotic cells. Representative images for each treatment group in both models are shown. The images are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 14), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Figure 2.

Combination of Hh and/or HGF/c-Met inhibitor(s) with gemcitabine in short-term treatment regimen results in enhancement tumoral cell death in the transgenic (KPC) and orthotopic mouse models. A and B, The KPC (A) and orthotopic (B) mouse models of PDAC were treated with Hh and/or HGF/c-Met inhibitor(s) and biweekly gemcitabine as shown in Fig. 1A. Primary tumors from both mouse models were harvested on the last day of treatment and subjected to TUNEL staining for apoptotic cells. Representative images for each treatment group in both models are shown. The images are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 14), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Close modal

Prolonged treatment of single HGF/c-Met or Hh inhibitor leads to resistance, which can be overcome by the combination of both c-Met and Hh inhibitors

Next, we examined whether resistance to the c-Met and Hh inhibitors is developed after a longer course of treatment. To this end, we treated the orthotopic model for 2 weeks and KPC mice for 3 weeks. Mice in the orthotopic model could not be treated for more than 2 weeks due to the aggressive nature of this model (24, 25). We subjected those mice to ultrasound examination to obtain baseline tumor volumes. The treatment regimen was initiated on the second day following ultrasound and consisted of daily treatment of Hh inhibitor, HGF/c-Met inhibitor, or vehicle control together with biweekly gemcitabine administration. Second ultrasound was performed 7 days after the first one. For KPC mice, the last ultrasound was performed on the last day of 21-day treatment, and for the orthotopic model, the last ultrasound was performed on the last day of 14-day treatment (Figs. 3A and 4A). Interestingly, gemcitabine treatment had no effect on tumor size in the KPC mice (Fig. 3B); however, it did result in significant reduction of primary tumors in the orthotopic model (Fig. 4B). Gemcitabine is in the family of nucleoside analogue medications, and it works by blocking the creation of new DNA (33). We therefore examined the proliferation capacity of both the KPC and orthotopic tumors and showed that the activity of gemcitabine with or without Hh or c-Met inhibitor does not appear to correlate with the proliferation status of the tumors (Supplementary Fig. S1). Moreover, c-Met but not Hh inhibitor further enhanced the antitumor response of gemcitabine in the KPC but not the orthotopic model. More importantly, the combination of c-Met and Hh inhibitors significantly enhanced the tumor response to gemcitabine in both the KPC and orthotopic mouse models (Figs. 3B and 4B). We did not observe significant toxicities with the treatments, as we did not observe any weight loss in the mice. Treatment with single target inhibitor shows no benefit in terms of tumor shrinkage (25). We observed large variability of tumor growth in the control group and the gemcitabine-alone group. This may be explained by our recent finding showing intertumoral heterogeneity of stromal signaling, namely the HGF/c-Met and Shh/IGF-1/IGF-1R pathways in mouse models of PDAC (25). The large variability in growth of untreated tumors and tumors treated by gemcitabine alone may be because some tumors express high Shh signaling, whereas other tumors express high c-Met signaling. However, when the tumors are treated by stroma-targeting agents, their responses to gemcitabine become more uniform. To determine the effect of the treatment regimen, we analyzed the apoptosis of tumor cell via the TUNEL assay following more than 1 week of treatment. As expected, gemcitabine only group shows a minimal increase in tumor cell death when compared with the vehicle treatment (Fig. 3C). Moreover, the addition of single inhibitor seems to have no effect on the incidence of apoptotic tumor cells, suggesting that the resistance to single inhibitors is developed following a longer course (14 or 21 days) of treatment. Importantly, only dual inhibition of both Hh and HGF/c-Met pathways shows increased sensitivity to gemcitabine as demonstrated by the significantly increased tumor cell death (Fig. 3C). These results suggest that the resistance to the c-Met and Hh inhibitor is developed following a prolonged treatment of each individual inhibitor; however, the resistance may be overcome by combining both c-Met and Hh inhibitors.

Figure 3.

Prolonged combination treatment of transgenic mouse model (KPC) with Hh and HGF/c-Met inhibitors in combination with gemcitabine leads to reduction in primary tumor volume and increased apoptosis. A, Schematic representation of 3-week treatment regimen in the KPC mouse model of PDAC. Baseline tumor volume was determined one day before treatment, following weekly ultrasounds until the last day of treatment. Mice were treated daily by oral gavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly via intraperitoneal injection. B, The change in tumor volume (calculated as ratio between week 3 and baseline tumor volume) is shown. C, Semiquantification of TUNEL staining for apoptotic cells in KPC mouse model after 3 weeks of treatment (as shown in A). The scoring method used score between 0 and 3, where 0 is no positive staining and 3 is high positive staining. The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 7), Hh-Hh inhibitor + gemcitabine (n = 6), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 5), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 4). ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 (unpaired Student t test).

Figure 3.

Prolonged combination treatment of transgenic mouse model (KPC) with Hh and HGF/c-Met inhibitors in combination with gemcitabine leads to reduction in primary tumor volume and increased apoptosis. A, Schematic representation of 3-week treatment regimen in the KPC mouse model of PDAC. Baseline tumor volume was determined one day before treatment, following weekly ultrasounds until the last day of treatment. Mice were treated daily by oral gavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly via intraperitoneal injection. B, The change in tumor volume (calculated as ratio between week 3 and baseline tumor volume) is shown. C, Semiquantification of TUNEL staining for apoptotic cells in KPC mouse model after 3 weeks of treatment (as shown in A). The scoring method used score between 0 and 3, where 0 is no positive staining and 3 is high positive staining. The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 7), Hh-Hh inhibitor + gemcitabine (n = 6), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 5), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 4). ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 (unpaired Student t test).

Close modal
Figure 4.

Prolonged combination treatment of orthotopic mouse model with \Hh and HGF/c-Met inhibitors in combination gemcitabine leads to reduction in primary tumor volume and metastatic burden. A, Schematic representation of 2-week treatment regimen in the orthotopic mouse model of PDAC. Baseline tumor volume was determined on postoperative day 5, following by weekly ultrasounds until the last day of treatment. Mice were treated daily beginning one day after the first ultrasound by oral gavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly via intraperitoneal injection. In the metastasis study (C), livers, lungs, gut, and peritoneum were harvested for gross and histologic analysis of metastases. B, The change in tumor volume (calculated as ratio between week 3 and baseline tumor volume) is shown. Data are representative of one experiment. C, Summary of total numbers of metastases formed (gross and histologic) in each group. The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 7), Hh-Hh inhibitor + gemcitabine (n = 8), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 10), DMSO-vehicle control (n = 6), Hh + c-Met + gemcitabine (n = 8). ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 (unpaired Student t test in B and Fisher exact test in C).

Figure 4.

Prolonged combination treatment of orthotopic mouse model with \Hh and HGF/c-Met inhibitors in combination gemcitabine leads to reduction in primary tumor volume and metastatic burden. A, Schematic representation of 2-week treatment regimen in the orthotopic mouse model of PDAC. Baseline tumor volume was determined on postoperative day 5, following by weekly ultrasounds until the last day of treatment. Mice were treated daily beginning one day after the first ultrasound by oral gavage with Hh and/or HGF/c-Met inhibitors or vehicle control. Gemcitabine was administered biweekly via intraperitoneal injection. In the metastasis study (C), livers, lungs, gut, and peritoneum were harvested for gross and histologic analysis of metastases. B, The change in tumor volume (calculated as ratio between week 3 and baseline tumor volume) is shown. Data are representative of one experiment. C, Summary of total numbers of metastases formed (gross and histologic) in each group. The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 7), Hh-Hh inhibitor + gemcitabine (n = 8), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 10), DMSO-vehicle control (n = 6), Hh + c-Met + gemcitabine (n = 8). ns, not significant; *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 (unpaired Student t test in B and Fisher exact test in C).

Close modal

Next, we wanted to determine whether prolonged combination treatment of dual stromal inhibitors and gemcitabine has an effect on incidence of metastasis. We utilized the orthotopic model for this part of the study, as it allows for the establishment of primary tumors of similar size (24). We previously showed that untreated mice become morbid and die between day 17 and day 25 with a median survival of 21 days (25). Thus, following 2-week treatment (Fig. 4A), we chose to stop the experiment on day 19 before the majority of mice would have died, specifically, before there were no more than 2 dead mice in each treatment group. We euthanized all the mice and harvested their livers, gut, lungs, and peritoneum for further analysis. Gross examination followed by histologic examination of the metastasis formed revealed that single-stromal agents in combination with gemcitabine show a trend in the reduction of metastases formation, which is consistent with literature reports (Fig. 4C; refs. 34, 35). Importantly, the group with dual inhibitor treatment in addition to gemcitabine showed no metastases (Fig. 4C). This result suggests that the combination of c-Met and Hh inhibitors in addition to gemcitabine has significantly suppressed metastasis formation.

Single c-Met or Hh inhibitor treatment leads to enhanced expression of the other target, and the combination of both c-Met and Hh inhibitors suppresses the expression of both targets more effectively

We then sought to understand the lack of effect of Hh or c-Met inhibition on primary tumor volume by examining the expression of their targets in PDACs from treated mice. We performed IHC staining on primary tumors from both the KPC (Fig. 5A) and the orthotopic (Fig. 5B) mouse models that have been treated with gemcitabine alone or in combination with the inhibitors for one week (Fig. 1A). As anticipated, either single c-Met or Hh inhibitor in combination with gemcitabine lead to decrease of the c-Met and Shh expression, respectively (Fig. 5; Supplementary Fig. S2). However, in the mice treated with c-Met inhibitor, the expression of Shh was enhanced, and in mice treated with Hh inhibitor, the expression of c-Met was enhanced following one week of treatment. Similar results were observed in PDACs from the mice treated for three weeks (Supplementary Fig. S3). These results suggest that the ineffectiveness of these inhibitors in further sensitizing PDAC to the gemcitabine treatment beyond one week may be attributed to the activation of alternative pathways. Consistent with this notion, inhibition of both c-Met and Hh pathways along with gemcitabine treatment shows a decrease in the expression of both c-Met and Shh when compared with the gemcitabine-alone treatment group.

Figure 5.

Single c-Met or Hh inhibitor treatment leads to the enhanced expression of the other target and the combination of both c-Met and Hh inhibitors suppresses the expression of both targets more effectively. A and B, Representative IHC images of primary tumors from the transgenic mouse model-KPC stained for expression of Shh (A) and c-Met (B) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome by combination treatment of Hh and c-Met inhibitors with gemcitabine. C and D, Representative IHC images of primary tumors from the orthotopic mouse model stained for expression of Shh (C) and c-Met (D) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome by combination treatment of Hh and c-Met inhibitors with gemcitabine. Mice in both models were treated for 1 week (as shown in Fig. 1A). The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Arrows, positive staining. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Figure 5.

Single c-Met or Hh inhibitor treatment leads to the enhanced expression of the other target and the combination of both c-Met and Hh inhibitors suppresses the expression of both targets more effectively. A and B, Representative IHC images of primary tumors from the transgenic mouse model-KPC stained for expression of Shh (A) and c-Met (B) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome by combination treatment of Hh and c-Met inhibitors with gemcitabine. C and D, Representative IHC images of primary tumors from the orthotopic mouse model stained for expression of Shh (C) and c-Met (D) showing upregulation of Shh in the c-Met treatment group and vice versa, that can be overcome by combination treatment of Hh and c-Met inhibitors with gemcitabine. Mice in both models were treated for 1 week (as shown in Fig. 1A). The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Arrows, positive staining. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Close modal

Compensatory overexpression/activation of alternative pathways may account for single-target resistance in PDAC

To further investigate the mechanism of resistance to gemcitabine in combination with one inhibitor, we first examined the effect of Shh inhibitor and c-Met inhibitor on KPC tumor cells and mCAF cells, respectively. As shown in Fig. 6A, Shh inhibitor decreased the expression of Shh, but increased the expression of HGF from mCAF cells. In addition, c-Met inhibitor decreased the expression of c-Met, but increased the expression of Shh from the KPC tumor cells. This result suggests that when Shh is inhibited, the HGF/c-Met pathway is activated as a compensation, and when c-Met is inhibited, the Shh expression is induced. Second, we confirmed that inhibition of c-Met and/or Shh via the pharmaceutical agents utilized in the study, leads to blockade of their respective pathways by analyzing downstream targets of each pathway (Fig. 6B and C). Our recently published study placed IGF-1 downstream of Shh (25). Analysis of IGF-1 expression in PDAC tumors from orthotopic mouse model confirmed that expression of the protein is decreased in samples treated with Hh inhibitor but not in the c-Met–treated samples when compared with vehicle control. As expected, combination treatment resulted in decreased expression of IGF-1. Moreover, no difference in the amount of IGF-1 was noted between the vehicle control and gemcitabine groups (Fig. 6B). E-Cadherin is downstream of both HGF/c-Met and Shh pathways (5, 25, 36); therefore, either inhibitor was able to activate E-cadherin. When both inhibitors were used, the expression of E-cadherin was higher than that seen with single inhibitors (Fig. 6C). Third, we tested the selectivity of c-Met inhibitor utilizing tumor cells with c-Met knockdown by shRNA. As shown in Table 1, when c-Met is knocked down (Supplementary Fig. S4A), c-Met inhibitor is no longer capable of increasing apoptosis, although c-Met knockdown itself can induce apoptosis. Interestingly, Shh inhibitor also failed to increase the apoptotic rate in cells with c-Met knockdown, suggesting that the effect of the combination of c-Met and Shh inhibitors also depends on c-Met. Moreover, this finding suggests that c-Met can not only mediate the effect of Hh, but it also implies that knockdown and small molecule targeting of c-Met has a different effect on Shh expression (Fig. 6A; Supplementary Fig. S4B).

Figure 6.

Compensatory overexpression/activation of alternative pathways explains single target resistance in PDAC. A, qRT-PCR analysis of c-Met, Shh, and GAPDH (control) in KPC tumor cells after c-Met inhibitor treatment and qRT-PCR analysis of Shh, HGF, and GAPDH (control) in mCAFs after Hh inhibitor treatment. The gene was normalized to GAPDH and is shown as a fold change. B and C, Representative IHC images of primary tumors from the orthotopic mouse model stained for expression of IGF-1 (B) and E-cadherin (C). Mice were treated for 1 week (as shown in Fig. 1A). The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Figure 6.

Compensatory overexpression/activation of alternative pathways explains single target resistance in PDAC. A, qRT-PCR analysis of c-Met, Shh, and GAPDH (control) in KPC tumor cells after c-Met inhibitor treatment and qRT-PCR analysis of Shh, HGF, and GAPDH (control) in mCAFs after Hh inhibitor treatment. The gene was normalized to GAPDH and is shown as a fold change. B and C, Representative IHC images of primary tumors from the orthotopic mouse model stained for expression of IGF-1 (B) and E-cadherin (C). Mice were treated for 1 week (as shown in Fig. 1A). The data are representative of one experiment. Mice that died before the completion of the planned treatment or whose quality of tumor was not adequate for analysis due to necrosis were excluded. Gem-gemcitabine (n = 8), Hh-Hh inhibitor + gemcitabine (n = 9), c-Met- HGF/c-Met inhibitor + gemcitabine (n = 7), DMSO-vehicle control (n = 9), Hh + c-Met + gemcitabine (n = 8). Scale bar, 200 μm.

Close modal
Table 1.

Summary of the rate of apoptosis in KPC cells with/without c-Met knockdown after inhibitor treatment

c-Met statusTreatment groupPercentage of Annexin V–positive cells (±SEM)
shRNA-Ctrl DMSO 10.59 ± 0.23 
 c-Met 22.36 ± 1.09 
 Hh 36.47 ± 0.85 
shRNA-c-Met DMSO 69.19 ± 2.56 
 c-Met 70.26 ± 0.98 
 Hh 71.17 ± 1.12 
c-Met statusTreatment groupPercentage of Annexin V–positive cells (±SEM)
shRNA-Ctrl DMSO 10.59 ± 0.23 
 c-Met 22.36 ± 1.09 
 Hh 36.47 ± 0.85 
shRNA-c-Met DMSO 69.19 ± 2.56 
 c-Met 70.26 ± 0.98 
 Hh 71.17 ± 1.12 

NOTE: Fisher test was performed. There is a statistically significant difference (P < 0.0001) between the DMSO-treated and Hh inhibitor–treated KPC tumor cells transfected with shRNA-Ctrl. There is no statistical difference between treatments of cells transfected with c-Met shRNA. Data are shown as the mean ± SEM.

PDAC is still one of the deadliest cancers worldwide with limited therapeutic options (2). Here, we demonstrate that combination of targeted stromal pathway inhibition of the c-Met and Hh pathways along with gemcitabine treatment lead to significant reduction of primary tumor volume and diminished metastases formation in mouse models of PDAC. We also provide evidence that this dual stromal therapy overcomes single-agent resistance and increases gemcitabine sensitivity.

This study not only confirms the prior finding but also provides an additional mechanistic explanation to the affectivity of dual stromal inhibition in terms of the decrease in PDAC tumor burden. It also explains why single stromal agent clinical trials fail to show efficacy in human subjects (37). One of the reasons is the development of resistance to those agents by overexpression of other, nontargeted pathways. We demonstrated that the upregulation of those nontargeted protumorigenic pathways tends to be more prominent in longer term treatments.

The use of PDAC mouse models, although very informative, has some limitations. Mice with implanted tumors have a very short lifespan (∼3 weeks) without treatments; thus, we used the “2-week” treatment course to mimic the long course of treatment. Although KPC spontaneous tumor models could be treated for a longer course, we found that the mice could not tolerate a prolonged course of treatment with daily oral gavage and were concerned about inadvertent effect from oral gavage. Those limitations lead to difficulty in accessing survival benefit in these studies. Nevertheless, the data presented in these studies support further testing of the combination of Hh and c-Met inhibitors in clinical trials.

Numerous studies reported the benefit of stromal modulation in enhancing chemosensitivity in mouse models of PDAC (19, 38–41); however, the use of Hh inhibitor in combination with chemotherapy agents in clinical trials with human subjects failed to show benefit (20–23). The importance of Hh and c-Met pathways as potential PDAC targets has been well documented (25, 42–44). The role of Hh signaling in PDAC has been rather controversial. Some studies show that targeting the pathway is beneficial in PDAC (45), whereas others documented that activation of Hh signaling can slow tumorigenesis (46). We recently published a study showing that expression of Shh and HGF is heterogeneous in the tumor microenvironment of PDAC, and only blockade of both pathways has a beneficial effect on metastasis of PDAC (25). This current study offers an insight into the lack of success of trials as well it begins to answer the opposing reports in current literature on the role of Hh pathway by showing that combinational targeted therapy results in PDAC tumor sensitization to gemcitabine and overcomes the resistance mechanism of single-agent targeted therapies. Targeting c-Met with cabozantinib was shown to increase gemcitabine efficacy on cultured pancreatic tumor cells. The fact that cabozantinib reduced stem cell markers and also self-renewal potential of PDAC cells may account for the mechanism of inhibition of c-Met in overcoming the resistance of PDAC to chemotherapy (43, 44). Our recent study described the role of stroma in c-Met inhibition (25), which provides a separate mechanism to overcoming resistance to chemotherapy, although we show that inhibition of c-Met is compensated by increased levels of another stromal pathway, namely the Hh pathway. As Hh signaling is also involved in self-renewal of PDAC, it is possible that the combination of Hh and c-Met inhibition overcomes the resistance in PDAC to gemcitabine through inhibiting the self-renewal potential of PDAC. Further studies are warranted to determine the exact molecular mechanism underlying the role of c-Met and Hh signaling in chemotherapy resistance in PDAC.

No potential conflicts of interest were disclosed.

Conception and design: A.A. Rucki, R.A. Anders, L. Zheng

Development of methodology: A.A. Rucki, Q. Xiao, R. Sharma, R.A. Anders

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): A.A. Rucki, Q. Xiao, J. Chen, X. Che, J. Kleponis, R.A. Anders

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): A.A. Rucki, Q. Xiao, X. Che, L. Zheng

Writing, review, and/or revision of the manuscript: A.A. Rucki, R. Sharma, E.M. Jaffee, L. Zheng

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): A.A. Rucki, S. Muth, J. Kleponis

Study supervision: E.M. Jaffee, L. Zheng

This work was supported in part by NIH R01 CA169702 (to L. Zheng), NIH K23 CA148964-01 (to L. Zheng), Viragh Foundation, the Skip Viragh Pancreatic Cancer Center at Johns Hopkins (to E.M. Jaffee and L. Zheng), Lefkofsky Family Foundation (to L. Zheng), the NCI SPORE in Gastrointestinal Cancers P50 CA062924 (to E.M. Jaffee and L. Zheng), and a Lustgarten Foundation grant (to L. Zheng).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Bond-Smith
G
,
Banga
N
,
Hammond
TM
,
Imber
CJ
. 
Pancreatic adenocarcinoma
.
BMJ
2012
;
344
:
e2476
.
2.
Siegel
R
,
Ma
J
,
Zou
Z
,
Jemal
A
. 
Cancer statistics, 2014
.
CA Cancer J Clin
2014
;
64
:
9
29
.
3.
Warshaw
AL
,
Fernandez-del Castillo
C
. 
Pancreatic carcinoma
.
N Engl J Med
1992
;
326
:
455
65
.
4.
Maitra
A
,
Hruban
RH
. 
Pancreatic cancer
.
Ann Rev Pathol
2008
;
3
:
157
88
.
5.
Rucki
AA
,
Zheng
L
. 
Pancreatic cancer stroma: understanding biology leads to new therapeutic strategies
.
World J Gastroenterol
2014
;
20
:
2237
46
.
6.
Jones
S
,
Zhang
X
,
Parsons
DW
,
Lin
JC
,
Leary
RJ
,
Angenendt
P
, et al
Core signaling pathways in human pancreatic cancers revealed by global genomic analyses
.
Science
2008
;
321
:
1801
6
.
7.
Yu
J
,
Ohuchida
K
,
Mizumoto
K
,
Ishikawa
N
,
Ogura
Y
,
Yamada
D
, et al
Overexpression of c-met in the early stage of pancreatic carcinogenesis; altered expression is not sufficient for progression from chronic pancreatitis to pancreatic cancer
.
World J Gastroenterol
2006
;
12
:
3878
82
.
8.
Ide
T
,
Kitajima
Y
,
Miyoshi
A
,
Ohtsuka
T
,
Mitsuno
M
,
Ohtaka
K
, et al
Tumor-stromal cell interaction under hypoxia increases the invasiveness of pancreatic cancer cells through the hepatocyte growth factor/c-Met pathway
.
Int J Cancer
2006
;
119
:
2750
9
.
9.
Ide
T
,
Kitajima
Y
,
Miyoshi
A
,
Ohtsuka
T
,
Mitsuno
M
,
Ohtaka
K
, et al
The hypoxic environment in tumor-stromal cells accelerates pancreatic cancer progression via the activation of paracrine hepatocyte growth factor/c-Met signaling
.
Ann Surg Oncol
2007
;
14
:
2600
7
.
10.
Avan
A
,
Caretti
V
,
Funel
N
,
Galvani
E
,
Maftouh
M
,
Honeywell
RJ
, et al
Crizotinib inhibits metabolic inactivation of gemcitabine in c-Met-driven pancreatic carcinoma
.
Cancer Res
2013
;
73
:
6745
56
.
11.
Jin
H
,
Yang
R
,
Zheng
Z
,
Romero
M
,
Ross
J
,
Bou-Reslan
H
, et al
MetMAb, the one-armed 5D5 anti-c-Met antibody, inhibits orthotopic pancreatic tumor growth and improves survival
.
Cancer Res
2008
;
68
:
4360
8
.
12.
Yap
TA
,
Olmos
D
,
Brunetto
AT
,
Tunariu
N
,
Barriuso
J
,
Riisnaes
R
, et al
Phase I trial of a selective c-MET inhibitor ARQ 197 incorporating proof of mechanism pharmacodynamic studies
.
J Clin Oncol
2011
;
29
:
1271
9
.
13.
Sharma
N
,
Adjei
AA
. 
In the clinic: ongoing clinical trials evaluating c-MET-inhibiting drugs
.
Ther Adv Med Oncol
2011
;
3
:
S37
50
.
14.
Tian
H
,
Callahan
CA
,
DuPree
KJ
,
Darbonne
WC
,
Ahn
CP
,
Scales
SJ
, et al
Hedgehog signaling is restricted to the stromal compartment during pancreatic carcinogenesis
.
Proc Natl Acad Sci U S A
2009
;
106
:
4254
9
.
15.
Li
X
,
Ma
Q
,
Duan
W
,
Liu
H
,
Xu
H
,
Wu
E
. 
Paracrine sonic hedgehog signaling derived from tumor epithelial cells: a key regulator in the pancreatic tumor microenvironment
.
Crit Rev Eukaryotic Gene Exp
2012
;
22
:
97
108
.
16.
Bailey
JM
,
Swanson
BJ
,
Hamada
T
,
Eggers
JP
,
Singh
PK
,
Caffery
T
, et al
Sonic hedgehog promotes desmoplasia in pancreatic cancer
.
Clin Cancer Res
2008
;
14
:
5995
6004
.
17.
Walter
K
,
Omura
N
,
Hong
SM
,
Griffith
M
,
Vincent
A
,
Borges
M
, et al
Overexpression of smoothened activates the sonic hedgehog signaling pathway in pancreatic cancer-associated fibroblasts
.
Clin Cancer Res
2010
;
16
:
1781
9
.
18.
Khan
S
,
Ebeling
MC
,
Chauhan
N
,
Thompson
PA
,
Gara
RK
,
Ganju
A
, et al
Ormeloxifene suppresses desmoplasia and enhances sensitivity of gemcitabine in pancreatic cancer
.
Cancer Res
2015
;
75
:
2292
304
.
19.
Olive
KP
,
Jacobetz
MA
,
Davidson
CJ
,
Gopinathan
A
,
McIntyre
D
,
Honess
D
, et al
Inhibition of Hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer
.
Science
2009
;
324
:
1457
61
.
20.
Kim
EJ
,
Sahai
V
,
Abel
EV
,
Griffith
KA
,
Greenson
JK
,
Takebe
N
, et al
Pilot clinical trial of hedgehog pathway inhibitor GDC-0449 (vismodegib) in combination with gemcitabine in patients with metastatic pancreatic adenocarcinoma
.
Clin Cancer Res
2014
;
20
:
5937
45
.
21.
Pant
S
,
Saleh
M
,
Bendell
J
,
Infante
JR
,
Jones
S
,
Kurkjian
CD
, et al
A phase I dose escalation study of oral c-MET inhibitor tivantinib (ARQ 197) in combination with gemcitabine in patients with solid tumors
.
Ann Oncol
2014
;
25
:
1416
21
.
22.
Catenacci
DV
,
Junttila
MR
,
Karrison
T
,
Bahary
N
,
Horiba
MN
,
Nattam
SR
, et al
Randomized phase Ib/II study of gemcitabine plus placebo or vismodegib, a hedgehog pathway inhibitor, in patients with metastatic pancreatic cancer
.
J Clin Oncol
2015
;
33
:
4284
92
.
23.
Michaud
NR
,
Wang
Y
,
McEachern
KA
,
Jordan
JJ
,
Mazzola
AM
,
Hernandez
A
, et al
Novel neutralizing hedgehog antibody MEDI-5304 exhibits antitumor activity by inhibiting paracrine hedgehog signaling
.
Mol Cancer Ther
2014
;
13
:
386
98
.
24.
Foley
K
,
Rucki
AA
,
Xiao
Q
,
Zhou
D
,
Leubner
A
,
Mo
G
, et al
Semaphorin 3D autocrine signaling mediates the metastatic role of annexin A2 in pancreatic cancer
.
Sci Signal
2015
;
8
:
ra77
.
25.
Rucki
AA
,
Foley
K
,
Zhang
P
,
Xiao
Q
,
Kleponis
J
,
Wu
AA
, et al
Heterogeneous stromal signaling within the tumor microenvironment controls the metastasis of pancreatic cancer
.
Cancer Res
2017
;
77
:
41
52
.
26.
Hingorani
SR
,
Wang
L
,
Multani
AS
,
Combs
C
,
Deramaudt
TB
,
Hruban
RH
, et al
Trp53R172H and KrasG12D cooperate to promote chromosomal instability and widely metastatic pancreatic ductal adenocarcinoma in mice
.
Cancer Cell
2005
;
7
:
469
83
.
27.
Zheng
L
,
Foley
K
,
Huang
L
,
Leubner
A
,
Mo
G
,
Olino
K
, et al
Tyrosine 23 phosphorylation-dependent cell-surface localization of annexin A2 is required for invasion and metastases of pancreatic cancer
.
PLoS One
2011
;
6
:
e19390
.
28.
Pan
S
,
Wu
X
,
Jiang
J
,
Gao
W
,
Wan
Y
,
Cheng
D
, et al
Discovery of NVP-LDE225, a potent and selective smoothened antagonist
.
ACS Med Chem Lett
2010
;
1
:
130
4
.
29.
Liu
X
,
Wang
Q
,
Yang
G
,
Marando
C
,
Koblish
HK
,
Hall
LM
, et al
A novel kinase inhibitor, INCB28060, blocks c-MET-dependent signaling, neoplastic activities, and cross-talk with EGFR and HER-3
.
Clin Cancer Res
2011
;
17
:
7127
38
.
30.
Weng
L
,
Qiao
L
,
Zhou
J
,
Liu
P
,
Pan
Y
, 
inventorsp; Incyte Corporation, assignee. Salts of 2-fluoro-N-methyl-4-[7-(quinolin-6-yl-methyl)-imidazo[1,2-b][1,2,4]triazin-2-yl]benzamide and processes related to preparing the same
.
Europe Patent WO 2009143211
. 
2009
Mar 4.
31.
Al-Muhsen
S
,
Letuve
S
,
Vazquez-Tello
A
,
Pureza
MA
,
Al-Jahdali
H
,
Bahammam
AS
, et al
Th17 cytokines induce pro-fibrotic cytokines release from human eosinophils
.
Resp Res
2013
;
14
:
34
.
32.
Black
CM
,
Armstrong
TD
,
Jaffee
EM
. 
Apoptosis-regulated low-avidity cancer-specific CD8(+) T cells can be rescued to eliminate HER2/neu-expressing tumors by costimulatory agonists in tolerized mice
.
Cancer Immunol Res
2014
;
2
:
307
19
.
33.
Burris
HA
,
Moore
MJ
 3rd
,
Andersen
J
,
Green
MR
,
Rothenberg
ML
,
Modiano
MR
, et al
Improvements in survival and clinical benefit with gemcitabine as first-line therapy for patients with advanced pancreas cancer: a randomized trial
.
J Clin Oncol
1997
;
15
:
2403
13
.
34.
Ogunwobi
OO
,
Puszyk
W
,
Dong
HJ
,
Liu
C
. 
Epigenetic upregulation of HGF and c-Met drives metastasis in hepatocellular carcinoma
.
PLoS one
2013
;
8
:
e63765
.
35.
Hanna
A
,
Shevde
LA
. 
Hedgehog signaling: modulation of cancer properies and tumor mircroenvironment
.
Mol Cancer
2016
;
15
:
24
.
36.
Penchev
VR
,
Rasheed
ZA
,
Maitra
A
,
Matsui
W
. 
Heterogeneity and targeting of pancreatic cancer stem cells
.
Clin Cancer Res
2012
;
18
:
4277
84
.
37.
Kundranda
M
,
Kachaamy
T
. 
Promising new therapies in advanced pancreatic adenocarcinomas
.
Future Oncol
2014
;
10
:
2629
41
.
38.
Quint
K
,
Tonigold
M
,
Di Fazio
P
,
Montalbano
R
,
Lingelbach
S
,
Ruckert
F
, et al
Pancreatic cancer cells surviving gemcitabine treatment express markers of stem cell differentiation and epithelial-mesenchymal transition
.
Int J Oncol
2012
;
41
:
2093
102
.
39.
Huang
FT
,
Zhuan-Sun
YX
,
Zhuang
YY
,
Wei
SL
,
Tang
J
,
Chen
WB
, et al
Inhibition of hedgehog signaling depresses self-renewal of pancreatic cancer stem cells and reverses chemoresistance
.
Int J Oncol
2012
;
41
:
1707
14
.
40.
Bahra
M
,
Kamphues
C
,
Boas-Knoop
S
,
Lippert
S
,
Esendik
U
,
Schuller
U
, et al
Combination of hedgehog signaling blockage and chemotherapy leads to tumor reduction in pancreatic adenocarcinomas
.
Pancreas
2012
;
41
:
222
9
.
41.
Noguchi
K
,
Eguchi
H
,
Konno
M
,
Kawamoto
K
,
Nishida
N
,
Koseki
J
, et al
Susceptibility of pancreatic cancer stem cells to reprogramming
.
Cancer Sci
2015
;
106
:
1182
7
.
42.
Onishi
H
,
Katano
M
. 
Hedgehog signaling pathway as a new therapeutic target in pancreatic cancer
.
World J Gastroenterol
2014
;
20
:
2335
42
.
43.
Hage
C
,
Rausch
V
,
Giese
N
,
Giese
T
,
Schonsiegel
F
,
Labsch
S
, et al
The novel c-Met inhibitor cabozantinib overcomes gemcitabine resistance and stem cell signaling in pancreatic cancer
.
Cell Death Dis
2013
;
4
:
e627
.
44.
Li
C
,
Wu
JJ
,
Hynes
M
,
Dosch
J
,
Sarkar
B
,
Welling
TH
, et al
c-Met is a marker of pancreatic cancer stem cells and therapeutic target
.
Gastroenterology
2011
;
141
:
2218
27.e5
.
45.
Thayer
SP
,
di Magliano
MP
,
Heiser
PW
,
Nielsen
CM
,
Roberts
DJ
,
Lauwers
GY
, et al
Hedgehog is an early and late mediator of pancreatic cancer tumorigenesis
.
Nature
2003
;
425
:
851
6
.
46.
Lee
JJ
,
Perera
RM
,
Wang
H
,
Wu
DC
,
Liu
XS
,
Han
S
, et al
Stromal response to Hedgehog signaling restrains pancreatic cancer progression
.
Proc Natl Acad Sci U S A
2014
;
111
:
E3091
100
.