Isorhapontigenin (ISO) is a new derivative of stilbene compound that was isolated from the Chinese herb Gnetum Cleistostachyum and has been used for treatment of bladder cancers for centuries. In our current studies, we have explored the potential inhibitory effect and molecular mechanisms underlying isorhapontigenin anticancer effects on anchorage-independent growth of human bladder cancer cell lines. We found that isorhapontigenin showed a significant inhibitory effect on human bladder cancer cell growth and was accompanied with related cell cycle G0–G1 arrest as well as downregulation of cyclin D1 expression at the transcriptional level in UMUC3 and RT112 cells. Further studies identified that isorhapontigenin downregulated cyclin D1 gene transcription via inhibition of specific protein 1 (SP1) transactivation. Moreover, ectopic expression of GFP-cyclin D1 rendered UMUC3 cells resistant to induction of cell-cycle G0–G1 arrest and inhibition of cancer cell anchorage-independent growth by isorhapontigenin treatment. Together, our studies show that isorhapontigenin is an active compound that mediates Gnetum Cleistostachyum's induction of cell-cycle G0–G1 arrest and inhibition of cancer cell anchorage-independent growth through downregulating SP1/cyclin D1 axis in bladder cancer cells. Our studies provide a novel insight into understanding the anticancer activity of the Chinese herb Gnetum Cleistostachyum and its isolate isorhapontigenin. Mol Cancer Ther; 12(8); 1492–503. ©2013 AACR.

Bladder cancer is one of the most common cancers in the Western world and the fifth most common cancer in the United States (1). According to the American Cancer Society, 73,510 new cases of bladder cancer are expected to be diagnosed and 14,880 patients will die from this disease in the United States in 2012. Because high-grade invasive bladder cancers can progress to life threatening metastases and are responsible for almost 100% of death from this disease (2, 3), identifying a natural compound that specifically inhibits bladder cancer invasion and metastasis is of tremendous importance for potentially reducing mortality as a result of this disease. Previous studies have addressed the clinical relevance of cyclin D1 alteration in bladder cancer development (4, 5). A significant proportion of bladder cancer cases showed that overexpression of the cyclin D1 gene and increased cyclin D1 expression were associated with poor prognosis and decreased postoperative patient survival (4, 6). Aberrant cyclin D1 expression has been observed early in carcinogenesis as well (7). Cyclin D1 is a key cell-cycle regulatory protein, playing a critical role in the G1-to-S transition of the cell-cycle progression through binding to cyclin-dependent kinase 4 (CDK4) to phosphorylate (8) and inactivate the retinoblastoma protein (pRb; ref. 9), heterozygous deletion of which occurs in approximately 50% of human muscle-invasive bladder cancer. Thus, identifying a new anticancer drug targeting and downregulating cyclin D1 expression and function is one of the first priorities in the field of anticancer research.

Because the multifaced biologic activities of natural oligostibenes, in the past 2 decades, more and more attention has been focused on the anticancer activities of this kind of compound (10, 11). Isorhapontigenin (ISO) is a new derivative of stilbene compound that was isolated from the Chinese herb Gnetum Cleistostachyum, which has been used for treatment of bladder cancers for centuries (12). To determine the anticancer activity and mechanisms of this Chinese herb, in this study, the potential anticancer activity, inhibition of cyclin D1 expression as well as molecular events implicated in these activities were elucidated in human bladder cancer cells.

Plasmids, antibodies, and reagents

The GFP-tagged cyclin D1 expression construct was described in our previous publication (13). The cyclin D1 promoter-driven luciferase reporter (cyclin D1 Luc) came from Dr. Anil Rustgi (Gastroenterology Division, University of Pennsylvania, PA; ref. 14). Human cyclin D1 −163 and −163 mSP1 (point mutation at −130 of SP1 binding site) promoter-driven luciferase reporter was a gift from Dr. Richard G. Pestell (Kimmel Cancer Center, Thomas Jefferson University, PA; ref. 15). The transcription factor Specific protein 1 (SP1) luciferase reporter, containing 3 consensus SPl binding sites, was kindly provided by Dr. Farnham Peggy J (McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI; ref. 16). The antibodies against p53, P-ATFII, were purchased from Cell Signaling Technology. The antibodies against CDK4, CDK6, FOS (C-FOS), cyclin A, cyclin B1, cyclin D1, cyclin E, p21, and SP1 were obtained from Santa Cruz Biotechnology. The antibodies against c-Jun, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), nuclear factor kappa B (NF-κB) p65, p-c-Jun Ser 63, p-c-Jun Ser 73, and p-NF-κB p65 were obtained from Cell Signaling Technology. The antibody against heat shock factor-1 (HSF-1) was obtained from Stressgen Biotechnologies Inc.. The antibody against p27 was obtained from Abcam Inc.. Isorhapontigenin with purity more than 99% was obtained from Dr. Qi Hou (Institute of Materia Medica, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China). Isorhapontigenin was dissolved in dimethyl sulfoxide (DMSO) to make a stock concentration at 10 mmol/L and the same concentration (0.1%, v/v) of DMSO was used as a negative control in all experiments.

Cell culture and transfection

Human bladder cancer cell line RT4, RT112, and UMUC3 were provided by Dr. Xue-Ru Wu (Departments of Urology and Pathology, New York University School of Medicine, New York, NY; ref. 17). Normal mouse epidermal cell line Cl41 cells were provided by Dr. Zigang Dong (Hormel Institute, University of Minnesota, Austin, MN; ref. 18–20) and was cultured with Eagle's Minimum Essential Medium with 5% FBS, 2 mmol/L l-glutamine, and 25 μg/mL gentamycin. All cell lines were subjected to DNA tests and authenticated before utilization for researches. UMUC3 cells were maintained at 37°C in a 5% CO2 incubator in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS, and RT112 cells were cultured with RPMI-1640 supplemented with 10% FBS. Stable cotransfections were carried out with specific cDNA constructs and/or pSuper vector using PolyJet DNA In Vitro Transfection Reagent (SignaGen Laboratories) according to the manufacturer's instructions and our previous studies (21).

Cell-cycle analysis

UMUC3 cells were cultured in each well of 6-well plates to 70% to 80% confluence with normal culture medium. The cell culture medium was replaced with 0.1% FBS DMEM with 2 mmol/L l-glutamine and 25 μg gentamycin and cultured for 24 hours. The cells were then exposed to isorhapontigenin (5 μmol/L) for the indicated time. The isorhapontigenin-treated and control cells were harvested and fixed in 75% ethanol overnight. The cells were then suspended in staining buffer [containing 0.1% Triton X-100, 0.2 mg/mL RNase A, and 50 μg/mL propidium iodide (PI)] at 4°C for 1 hour and then DNA content was determined by flow cytometry using a Epics XL flow cytometer (Beckman Coulter Inc.) and EXPO32 software as previously described in ref. 13.

Anchorage-independent growth assay

The potential isorhapontigenin inhibitory effect of anchorage-independent growth (soft agar assay) on human bladder cancer cells was determined in UMUC3 cell line (21). In brief, 1 × 104 UMUC3 cells were exposed to various concentrations of isorhapontigenin in 10% FBS Basal Medium Eagle (BME) containing 0.33% soft agar and were seeded over bottom layer of 0.5% agar in 10% FBS/BME in each well of 6-well plates. The cultures were maintained at 37°C in 5% CO2 incubator for 21 days and the cell colonies with more than 32 cells were scored, as described in our previous studies (21, 22). Colonies were observed and counted under microscope. The results were presented as mean ± SD of colony number per 10,000 seeded cells in soft agar from 3 independent experiment wells.

Animal experiment and isorhapontigenin pharmacokinetics analysis in vivo

Thirty Wistar male mice, weighing 20 to 25 g, were purchased from Experimental Animal Center of the Chinese Academy of Military Medical Sciences and kept under controlled conditions with a 12-hour light cycle with accessing water ad libitum overnight. Mice were then administered with isorhapontigenin (150 mg/kg) via gastric gavage. Three mice were sacrificed and blood samples were taken at each time points of 0.033, 0.083, 0.17, 0.25, 0.5, 0.75, 1, 1.5, 2, and 4 hours after isorhapontigenin was given. The serum was collected from each mouse by centrifuging of blood sample at 4,000 rpm for 30 minutes and stored at −20°C for further analyses. To determine pharmacokinetics of isorhapontigenin in serum of mice, a 50 μL aliquot of each serum sample was transferred to 1.5 mL polypropylene tubes, and 300 μL methanol (LC grade) was added to each sample with vortex for 5 minutes. After centrifugation for 10 minutes at 10,000 rpm, the supernatant was filtered through 0.45 μm filter membrane and then applied to the liquid chromatography/tandem mass spectrometry (LC/MS-MS). The LC/MS-MS system that was used consisted of an Applied Biosystems Sciex QTrap 5500 mass spectrometer (Thornhill) coupled to a Shimadzu UPLC system (Shimadzu). Isorhapontigenin and IS naringenin were separated on a Shimpack C18 ODS column (150 mm × 2.3 mm id, 3 μm particle size) with a gradient elution of the mobile phase system consisting of 0.1% acetic acid solution (A) and methanol (B). The elution program was conducted with flow rate at 0.2 mL/minute under column temperature at 30°C. The mass spectrometer was conducted using electrospray ionization (ESI) with an ionspray voltage of −4,500 V and 550°C. The negative ion multiple-reaction-monitoring (MRM) mode analysis was conducted using nitrogen as the collision gas. Precursor/product ion pairs for isorhapontigenin and naringenin were m/z 257.0/241.1 and m/z 271.1/151.1. Data acquisition and processing were carried out using Sciex Analyst 1.5.1 software package (SCIEX).

Western blotting assay

After the cells were exposed to the indicated concentration of isorhapontigenin or for the indicated time with 5 μmol/L isorhapontigenin, cells were extracted in a cell lysis buffer (10 mmol/L Tris-HCl (pH 7.4), 1% SDS, and 1 mmol/L Na3VO4) and total protein was quantified with a DC protein assay kit (Bio-Rad). The membranes were probed with the indicated primary antibodies and the AP-conjugated second antibody. Signals were detected by the ECF Western blotting system, as previously described (23).

Reverse transcription PCR

Total RNA was extracted with TRIzol reagent (Invitrogen Corp.) after isorhapontigenin treatment and the cDNAs were synthesized with the Thermo-Script RT-PCR system (Invitrogen Corp.). The mRNA amount present in the cells was measured by semiquantitative reverse transcription (RT)-PCR. The primers were 5′- AGAAGGCTGGGGCTCATTTG -3′ and 5′- AGGGGCCATCCACAGTCTTC -3′ for human GAPDH, and 5′- GAGGTCTGCGAGGAACA GAAGTG-3′ and 5′-GAGGGCGGATTGGAAATGAACTTC-3′ for human cyclin D1. The PCR products were separated on 2% agarose gels and stained with ethidium bromide, and the results were imagined with Alpha Innotech SP Image system (Alpha Innotech Corporation), as previously described (13, 21).

Luciferase assay

UMUC3 cells with stable transfection of the cyclin D1 promoter–driven luciferase reporter or SP1 luciferase reporter were seeded into 96-well plates (1 × 104 per well) and subjected to the isorhapontigenin treatments when cell density reached 80% to 90% confluence. The cells were extracted with lysis buffer [25 mmol/L Tris-phosphate (pH 7.8), 2 mmol/L EDTA, 1% Triton X-100, and 10% glycerol], and the luciferase activity was determined by the microplate luminometer (Microplate Luminometer LB 96V, Berthold GmbH & Co.) using the luciferase assay system (Promega Corp.) as described in our previous studies (24).

Nuclear extract preparation

UMUC3 cells were seeded into 10 cm culture dishes and treated either with DMSO or 5 μmol/L isorhapontigenin for 12 hours. The nuclear proteins were extracted according to the protocol of Nuclear/Cytosol Fractionation Kit (BioVision Technologies). Preparation of nuclear extracts was assessed as previously described in ref. 25 and nuclear extracts were stored at −80°C until they were used.

Chromatin immunoprecipitation assay

The chromatin immunoprecipitation (ChIP) assay was conducted with an EZ-ChIP kit (Millipore Technologies) according to the manufacturer's instructions. Briefly, UMUC3 cells were untreated or treated with isorhapontigenin (5 μmol/L) for 12 hours. Then genomic DNA and the proteins were isolated in the same manner as in our previous publication (26). To specifically amplify the region containing the putative responsive elements on the human cyclin D1 promoter, PCR was conducted with the following pair of primers as follows: 5′-TTCTCTGCCCGGCTTTGATCTC-3′ (from −92 to −73) and 5′-CTCTCTGCTACTGCG CCAACA- 3′ (from +7 to +27; ref. 15). The PCR products were separated on 2% agarose gels and stained with ethidium bromide, and the images were scanned with a UV light.

Bioinformatic analysis

Cyclin D1 promoter region was analyzed for potential transcription factor binding sites using TFANSFAC Transcription Factor Binding Sites Software (Version 7.0).

Statistical methods

Student t test was used to determine the significance of differences between different groups. The differences were considered to be significant at P < 0.05.

Isorhapontigenin inhibited cell proliferation and anchorage-independent growth, and induced G0–G1 growth arrest in human bladder cancer UMUC3 cell line

The chemical structure of isorhapontigenin is a chemical compound 4-methoxyresveratrol with a molecular weight of 258 as described in our published study (Fig. 1A; ref. 21). To evaluate the potential inhibition of isorhapontigenin in human bladder cancer, we first examined the effects of isorhapontigenin on cell viability in noncancerous Cl41 cells, noninvasive human bladder tumor cell line RT4, and high invasive human bladder cancer cell line UMUC3. As shown in Fig. 1B, UMUC3 and RT4 cells with isorhapontigenin treatment at concentration of 5 to 60 μmol/L for 48 hours resulted in significant reduction of cell viability in a concentration-dependent manner in ATPase activity assays. The IC50 of the UMUC3 and RT4 cell lines was 22.4 ± 3.3 μmol/L (n = 3) and 38.6 ± 2.9 μmol/L (n = 3) respectively, whereas there was no obvious reduction of cell viability in normal Cl41 cells. The cell morphology showed that isorhapontigenin at 20 μmol/L induced UMUC3 cells undergoing markedly morphologic changes such as shrinkage, rounding, detachment, and membrane blebbing (Fig. 1C), which is consistent with our most recent findings that isorhapontigenin induced apoptosis in UMUC3 and other invasive bladder cancer cells at 20 μmol/L (21). More importantly, isorhapontigenin at concentration of 5 μmol/L did show inhibition of cell proliferation (Fig. 1B and C) without induction of observable apoptosis in UMUC3 cells (Fig. 1D). This notion was further verified with the results obtained from cell-cycle and apoptotic analyses by flow cytometry. Exposure of subconfluent UMUC3 cells to 5 μmol/L isorhapontigenin led to significant induction of G0–G1 growth arrest at both 12 (47.58% vs. 57.98%) and 24 hours (47.58% vs. 62.62%; Fig. 1D and E) respectively, whereas it did not induce any increases of apoptotic cells (Fig. 1D). These results suggested that the inhibition of high invasive bladder cancer MUMC3 cell proliferation by low concentration (5 μmol/L) of isorhapontigenin was associated with its induction of cell G0–G1 growth arrest. To determine whether a low concentration of isorhapontigenin was able to inhibit anchorage-independent growth of bladder cancer cells, UMUC3 was exposed to isorhapontigenin in soft agar. As shown in Fig. 2A and B, isorhapontigenin also markedly inhibited anchorage-independent growth in a concentration-dependent manner at concentration as low as 5 μmol/L (P < 0.01), indicating that isorhapontigenin induction of cell G0–G1 growth arrest might be associated with its anticancer activity in high invasive human bladder cancers.

Figure 1.

Isorhapontigenin (ISO) induced cell-cycle G0–G1 arrest of human bladder cancer. A, the chemical structure of isorhapontigenin. B, incubation with the isorhapontigenin caused concentration-dependent growth effects on UMUC3, RT4, and Cl41 cells in vitro, as observed in ATPase assays. Results are presented from 3 independent experiments in the presence of varying concentrations of ISO for 48 hours. C, these morphology changes were observed in UMUC3 cells exposed to different concentrations of isorhapontigenin for 24 hours. D and E, flow-cytometry analysis of cell-cycle alteration in UMUC3 cells upon ISO treatment. UMUC3 cells were treated with 5 μmol/L isorhapontigenin at indicated time. The result represents one of 3 independent experiments.

Figure 1.

Isorhapontigenin (ISO) induced cell-cycle G0–G1 arrest of human bladder cancer. A, the chemical structure of isorhapontigenin. B, incubation with the isorhapontigenin caused concentration-dependent growth effects on UMUC3, RT4, and Cl41 cells in vitro, as observed in ATPase assays. Results are presented from 3 independent experiments in the presence of varying concentrations of ISO for 48 hours. C, these morphology changes were observed in UMUC3 cells exposed to different concentrations of isorhapontigenin for 24 hours. D and E, flow-cytometry analysis of cell-cycle alteration in UMUC3 cells upon ISO treatment. UMUC3 cells were treated with 5 μmol/L isorhapontigenin at indicated time. The result represents one of 3 independent experiments.

Close modal
Figure 2.

Isorhapontigenin inhibited cell proliferation in human bladder cancer cells. A, representative images of colonies of UMUC3 cells in soft agar assay without or with various concentrations of isorhapontigenin. B, quantification of results of colony formation of UMUC3 cells in soft agar assay obtained from 3 independent experiments. Colonies were visualized and counted under a microscope with size more than 32 cells of each colony. C, isorhapontigenin concentration versus time curve in serum of mice (n = 3).

Figure 2.

Isorhapontigenin inhibited cell proliferation in human bladder cancer cells. A, representative images of colonies of UMUC3 cells in soft agar assay without or with various concentrations of isorhapontigenin. B, quantification of results of colony formation of UMUC3 cells in soft agar assay obtained from 3 independent experiments. Colonies were visualized and counted under a microscope with size more than 32 cells of each colony. C, isorhapontigenin concentration versus time curve in serum of mice (n = 3).

Close modal

To determine whether isorhapontigenin concentrations (5–20 μmol/L) used in current in vitro studies are reachable animal models in vivo, 30 Wistar male mice were administered via gastric gavage with isorhapontigenin (150 mg/kg). Blood samples from each group (n = 3) were taken at each time points of 0.033, 0.083, 0.17, 0.25, 0.5, 0.75, 1, 1.5, 2, and 4 hours after isorhapontigenin was given. The serum was collected for determination of isorhapontigenin concentration in serum of mice using LC/MS-MS system. The mean of isorhapontigenin concentration versus time profiles was shown in Table 1 and the corresponding curve is shown in Fig. 2C following oral administration of 150 mg/kg of isorhapontigenin. The pharmacokinetic parameters of isorhapontigenin were obtained by DAS 3.0 computer software analysis using noncompartmental model and summarized in Table 2. Maximum observed concentration (Cmax) at 12.35 μg/mL (47.9 μmol/L) in mouse serum rapidly reached at 0.17 hours (10 minutes). The elimination half-time of isorhapontigenin was 1.7 hours and the MRT was 0.7 hours in vivo. The results showed that isorhapontigenin oral administration could result in a rapid absorption in mice, and 5 to 20 μmol/L of isorhapontigenin concentrations applied in current in vitro studies are reachable in vivo mice.

Table 1.

Serum isorhapontigenin concentration versus time in mouse serum after administration of 150 mg/kg body weight (n = 3)

Time(hour)Caverage ± SD (μg/mL)
0.033 6.80 ± 2.10 
0.083 10.74 ± 3.52 
0.170 12.35 ± 4.79 
0.250 9.23 ± 4.84 
0.500 6.22 ± 3.60 
0.750 0.83 ± 0.80 
1.000 0.29 ± 0.24 
1.500 0.28 ± 0.14 
2.000 0.17 ± 0.12 
4.000 0.03 ± 0.01 
Time(hour)Caverage ± SD (μg/mL)
0.033 6.80 ± 2.10 
0.083 10.74 ± 3.52 
0.170 12.35 ± 4.79 
0.250 9.23 ± 4.84 
0.500 6.22 ± 3.60 
0.750 0.83 ± 0.80 
1.000 0.29 ± 0.24 
1.500 0.28 ± 0.14 
2.000 0.17 ± 0.12 
4.000 0.03 ± 0.01 
Table 2.

Noncompartmental pharmacokinetic parameters of isorhapontigenin

ParameterUnitValue ± SD
AUC(0−t)a μg/mL × hour 6.09 ± 2.81 
AUC(0−∞) a μg/mL × hour 6.10 ± 2.80 
MRT(0−t)b hour 0.70 ± 0.20 
t1/2zc hour 1.72 ± 0.27 
Tmaxd hour 0.14 ± 0.05 
CLz/Fe L/hour/kg 27.7 ± 10.3 
Cmaxf μg/mL 12.7 ± 6.5 
ParameterUnitValue ± SD
AUC(0−t)a μg/mL × hour 6.09 ± 2.81 
AUC(0−∞) a μg/mL × hour 6.10 ± 2.80 
MRT(0−t)b hour 0.70 ± 0.20 
t1/2zc hour 1.72 ± 0.27 
Tmaxd hour 0.14 ± 0.05 
CLz/Fe L/hour/kg 27.7 ± 10.3 
Cmaxf μg/mL 12.7 ± 6.5 

aAUC (0−t) and AUC (0−∞), area under the curve from the time of dosing to the last measurable concentration or the time of the last observation.

bMRT(0−t), mean residence time.

ct1/2z, terminal half-life.

dTmax, time of maximum observed concentration.

eCLz/F, apparent clearance.

fCmax, maximum observed concentration.

Isorhapontigenin treatment downregulated cyclin D1 protein expression in human bladder cancer cells

The results above showed that isorhapontigenin pretreatment led to a G0–G1 phase growth arrest. To elucidate the molecular mechanisms underlying this biological effect of isorhapontigenin, we determined the alteration in cyclin D1 expression upon isorhapontigenin treatment. Treatment of UMUC3 with different concentrations of isorhapontigenin for 24 hours resulted in a concentration-dependent reduction of cyclin D1 protein expression compared with the DMSO-treated cells (Fig. 3A and E), whereas it did not show observable inhibition of other cycle regulators, including cyclin A, cyclin E, cyclin B1, CDK4, CDK6, p53, p27, and p21 (Fig. 3A). As isorhapontigenin at 5 μmol/L showed the induction of cell-cycle arrest without any apoptotic effect, it was used for the time course investigation and in the following experiment. Similarly, the isorhapontigenin showed a markedly inhibition of cyclin D1 expression in a high-grade RT112 cell line (Fig. 3B), a slight inhibition in a low-grade human RT4 cell line (Fig. 3C), and marginal induction of cyclin D1 in a normal Cl41 cell line (Fig. 3D). The significant reduction of cyclin D1 expression by isorhapontigenin could be observed as early as 6 hours upon isorhapontigenin treatment in both UMUC3 cells (Fig. 4A and B) and RT112 cells (Fig. 4C). Consistently, expression of cyclin A, cyclin E, CDK4, CDK6, p53, p27, and p21 were not affected under the same experimental conditions and cyclin B1 expression was slightly reduced at 24 hours of treatment by isorhapontigenin in UMUC3 cells (Fig. 4A). These results suggest that isorhapontigenin downregulates cyclin D1 expression, and that might be associated with its induction of G0–G1 growth arrest in human bladder cancer cells.

Figure 3.

Isorhapontigenin downregulated cyclin D1 protein expression. A–D, protein expressions, as indicated in UMUC3, RT112, RT4, and Cl41 cells, were determined with Western blotting after cells were treated with indicated concentrations of isorhapontigenin for 24 hours. E, quantitative analysis of cyclin D1 expression relative to GADPH (ratio of cyclin D1/GAPDH) in isorhapontigenin-treated UMUC3 cells using the scanning software. *, indicates a significant difference from medium control (P < 0.01, n = 3).

Figure 3.

Isorhapontigenin downregulated cyclin D1 protein expression. A–D, protein expressions, as indicated in UMUC3, RT112, RT4, and Cl41 cells, were determined with Western blotting after cells were treated with indicated concentrations of isorhapontigenin for 24 hours. E, quantitative analysis of cyclin D1 expression relative to GADPH (ratio of cyclin D1/GAPDH) in isorhapontigenin-treated UMUC3 cells using the scanning software. *, indicates a significant difference from medium control (P < 0.01, n = 3).

Close modal
Figure 4.

Isorhapontigenin downregulated cyclin D1 protein expression in UMUC3 and RT112 cells. Protein expression as indicated in UMUC3 (A) and RT112 (C) cells were determined with Western blotting after cells were treated with 5 μmol/L of isorhapontigenin for the indicated time periods. GAPDH was used as the protein loading control. B, quantitative analysis of cyclin D1 expression relative to GADPH (ratio of cyclin D1/GAPDH) in 5 μmol/L isorhapontigenin-treated UMUC3 cells using the scanning software. * and **, significant difference from medium control (n = 3).

Figure 4.

Isorhapontigenin downregulated cyclin D1 protein expression in UMUC3 and RT112 cells. Protein expression as indicated in UMUC3 (A) and RT112 (C) cells were determined with Western blotting after cells were treated with 5 μmol/L of isorhapontigenin for the indicated time periods. GAPDH was used as the protein loading control. B, quantitative analysis of cyclin D1 expression relative to GADPH (ratio of cyclin D1/GAPDH) in 5 μmol/L isorhapontigenin-treated UMUC3 cells using the scanning software. * and **, significant difference from medium control (n = 3).

Close modal

Ectopic expression of GFP-cyclin D1 in UMUC3 cells rendered the transfectant resistant to G0–G1 growth arrest induction and anchorage-independent growth inhibition by isorhapontigenin

To evaluate the contribution of cyclin D1 downregulation by isorhapontigenin to cell-cycle and anchorage-independent growth regulation, we stably transfected GFP-cyclin D1 expression construct into UMUC3 cells and the stable transfectant UMUC3 (GFP-cyclin D1) was established, as indicated in Fig. 5A. UMUC3 (GFP-cyclin D1) and its vector control transfectant UMUC3 (GFP) were exposed to isorhapontigenin for determination of ectopic expression of GFP-cyclin D1 on regulation of cell-cycle and anchorage-independent growth. As shown in Fig. 5A, isorhapontigenin treatment only downregulated endogenous cyclin D1 protein expression, and not exogenous GFP-cyclin D1 expression. Consistent with isorhapontigenin effects on endogenous cyclin D1 and exogenous GFP-cyclin D1 protein expression, isorhapontigenin-induced a G0–G1 growth arrest in UMUC3(GFP) cells (62.74% vs. 74.60%) was impaired by ectopic expression of GFP-cyclin D1 in UMUC3(GFP-cyclin D1) cells (51.01% vs. 54.61%; Fig. 5B). More importantly, isorhapontigenin inhibition of anchorage-independent growth in UMUC3 (GFP) cells was reversed by ectopic expression of GFP-cyclin D1 in UMUC3 cells (Fig. 5C). These results show that downregulating of cyclin D1 expression mediates isorhapontigenin induction of G0–G1 growth arrest and inhibition of anchorage-independent growth of UMUC3 cells.

Figure 5.

Ectopic expression of GFP-cyclin D1 was not inhibited by isorhapontigenin and was able to reverse isorhapontigenin-mediated induction G0–G1 growth arrest and inhibition of anchorage-independent growth in UMUC3 cells. UMUC3 stable transfectants, as indicated, were treated with isorhapontigenin for 24 hours. The cells were extracted for Western blotting (A) or subjected to cell-cycle analysis using flow-cytometry assay (B). C, UMUC3 stable transfectants as indicated were subjected to anchorage-independent growth in soft agar in the absence or presence of ISO.

Figure 5.

Ectopic expression of GFP-cyclin D1 was not inhibited by isorhapontigenin and was able to reverse isorhapontigenin-mediated induction G0–G1 growth arrest and inhibition of anchorage-independent growth in UMUC3 cells. UMUC3 stable transfectants, as indicated, were treated with isorhapontigenin for 24 hours. The cells were extracted for Western blotting (A) or subjected to cell-cycle analysis using flow-cytometry assay (B). C, UMUC3 stable transfectants as indicated were subjected to anchorage-independent growth in soft agar in the absence or presence of ISO.

Close modal

Isorhapontigenin downregulated cyclin D1 expression at transcriptional level

Our above results that isorhapontigenin treatment only downregulated endogenous cyclin D1 protein expression but not exogenous GFP-cyclin D1 expression, excluded the possibility of isorhapontigenin inhibiting cyclin D1 expression at regulation of protein stability. To further elucidate the underlying mechanisms of isorhapontigenin-induced downregulation of cyclin D1 protein expression, we examined the effect of isorhapontigenin on cyclin D1 mRNA expression. As shown in Fig. 6A and B, UMUC3 cells treatment with isorhapontigenin resulted in a marked reduction of cyclin D1 mRNA in concentration- and time-dependent manners, which was consistent with the results obtained at protein levels. These results indicate that isorhapontigenin treatment attenuates cyclin D1 expression at either the transcription level or mRNA stability level. To test whether transcription was involved in cyclin D1 downregulation by isorhapontigenin, the cyclin D1 promoter-driven luciferase reporter was stably transfected into UMUC3 cells. The results showed that treatment of UMUC3 cells with isorhapontigenin led to a marked inhibition of cyclin D1 promoter transcriptional activity in a time-dependent manner (Fig. 6C). These results indicated that isorhapontigenin mainly regulated the cyclin D1 protein expression at the transcriptional level.

Figure 6.

Isorhapontigenin downregulated cyclin D1 transcription and SP1 protein expression. A and B, total RNA isolated from the UMUC3 cells treated with the indicated concentration of ISO for 24 hours (A) or 5 μmol/L ISO for indicated time periods (B) were subjected to RT-PCR for the determination of cyclin D1 expression level. The GAPDH was used as a loading control. C, UMUC3 stably transfected with cyclin D1 promoter-driven luciferase reporter was treated with ISO (5 μmol/L) for indicated times to determine the inhibitory effect of isorhapontigenin on cyclin D1 promoter transcriptional activity. *, P < 0.01. D, cytoplasmic and nuclear extracts were isolated from the UMUC3 cells treated with either 0.1% DMSO or 5 μmol/L isorhapontigenin for 12 hours and were subjected to Western blotting, with the specific antibodies as indicated. GADPH was used as protein loading control. E, quantitative analysis of SP1 in nuclear relative to c-Jun expression (ratio of SP1/c-Jun) in 5 μmol/L isorhapontigenin-treated UMUC3 cells using the scanning software. *, significant difference from medium control (n = 3).

Figure 6.

Isorhapontigenin downregulated cyclin D1 transcription and SP1 protein expression. A and B, total RNA isolated from the UMUC3 cells treated with the indicated concentration of ISO for 24 hours (A) or 5 μmol/L ISO for indicated time periods (B) were subjected to RT-PCR for the determination of cyclin D1 expression level. The GAPDH was used as a loading control. C, UMUC3 stably transfected with cyclin D1 promoter-driven luciferase reporter was treated with ISO (5 μmol/L) for indicated times to determine the inhibitory effect of isorhapontigenin on cyclin D1 promoter transcriptional activity. *, P < 0.01. D, cytoplasmic and nuclear extracts were isolated from the UMUC3 cells treated with either 0.1% DMSO or 5 μmol/L isorhapontigenin for 12 hours and were subjected to Western blotting, with the specific antibodies as indicated. GADPH was used as protein loading control. E, quantitative analysis of SP1 in nuclear relative to c-Jun expression (ratio of SP1/c-Jun) in 5 μmol/L isorhapontigenin-treated UMUC3 cells using the scanning software. *, significant difference from medium control (n = 3).

Close modal

Isorhapontigenin downregulated transcription factor SP1 expression

To identify the related nuclear transcription factors responsible for the downregulation of cyclin D1 by isorhapontigenin, we used the TFANSFAC Transcription Factor Binding Sites Software (Version 7.0) to bio-informatic analysis of the cyclin D1 promoter region. The results revealed that promoter region of the human cyclin D1 gene contained multiple putative DNA-binding sites of transcription factors, including Activator protein 1 (AP-1), HSF-1, activating transcription factor 2 (ATFII), NF-κB, and SP1. We further determined protein expression and nuclear translocation of those transcription factor components upon isorhapontigenin treatment. The results showed that isorhapontigenin (5 μmol/L) treatment only downregulated SP1 protein expression (Fig. 6D and E), whereas it did not show any observable inhibition of other transcription factor expression, activation, or nuclear translocation, including c-FOS, p-c-JUN(ser 73), p-c-JUN(ser63), c-JUN, HSF-1, p-ATFII, p-NF-κB p65, or NF-κB p65 (Fig. 6D), thus suggesting that SP1 was a major transcription factor that might be targeted by isorhapontigenin for downregulation of cyclin D1 transcription. To determine the effect of isorhapontigenin on SP1-depedent transcriptional activity, SP1-luciferase reporter was transfected into UMUC3 cells to establish the stable transfectant. Isorhapontigenin treatment led to a dramatically inhibition of SP1-dependent transcriptional activity in a time-dependent manner (Fig. 7B). These results indicated that isorhapontigenin not only inhibited SP1 protein expression and its nuclear translocation, it also inhibited its dependent transcriptional activity.

Figure 7.

SP1 was a major target of isorhapontigenin for its inhibition of cyclin D1 transcription. A, schematic representation of the transcription factor SP1-binding sites in the human cyclin D1 promoter region. B, the inhibition of SP1-dependent transactivation by ISO. SP1-luciferase reporter plasmid that contains 3 SP1 consensus binding sites was stably cotransfected with PRL-TK-Luciferase expression vector and pSuper gene into UMUC3 cells. Cells were exposed to isorhapontigenin (5 μmol/L) for indicated time periods. Luciferase activity was determined by the Dual-Luciferase Reporter Assay System, and the results are presented as relative SP1 activity of means ± SE from 3 independent experiments. *, P < 0.01. C, WT cyclin D1 luciferase reporter, −163 cyclin D1 and its mutant SP1 −163 cyclin D1 were cotransfected with pSuper plasmid into UMUC3 cells, respectively, and the stable transfectants were exposed to isorhapontigenin (5 μmol/L) for determination of cyclin D1 promoter activity. D, ChIP assay was used to determine ISO effect on SP1 binding activity to the cyclin D1 promoter region, as described in Materials and Methods. E, the proposed model for ISO regulation of cyclin D1 expression and G0–G1 cell growth arrest.

Figure 7.

SP1 was a major target of isorhapontigenin for its inhibition of cyclin D1 transcription. A, schematic representation of the transcription factor SP1-binding sites in the human cyclin D1 promoter region. B, the inhibition of SP1-dependent transactivation by ISO. SP1-luciferase reporter plasmid that contains 3 SP1 consensus binding sites was stably cotransfected with PRL-TK-Luciferase expression vector and pSuper gene into UMUC3 cells. Cells were exposed to isorhapontigenin (5 μmol/L) for indicated time periods. Luciferase activity was determined by the Dual-Luciferase Reporter Assay System, and the results are presented as relative SP1 activity of means ± SE from 3 independent experiments. *, P < 0.01. C, WT cyclin D1 luciferase reporter, −163 cyclin D1 and its mutant SP1 −163 cyclin D1 were cotransfected with pSuper plasmid into UMUC3 cells, respectively, and the stable transfectants were exposed to isorhapontigenin (5 μmol/L) for determination of cyclin D1 promoter activity. D, ChIP assay was used to determine ISO effect on SP1 binding activity to the cyclin D1 promoter region, as described in Materials and Methods. E, the proposed model for ISO regulation of cyclin D1 expression and G0–G1 cell growth arrest.

Close modal

The transcription factor SP1 binding sites in cyclin D1 promoter region was represented in schematic diagram in Fig. 7A. Previous studies reported that deletion of the promoter sequentially from −163 to −22 dramatically reduced cyclin D1 promoter activity (15). To identify the promoter regions that were necessary for isorhapontigenin downregulating cyclin D1 expression, and to understand the mechanisms that regulate this expression, the wild-type −163 cyclin D1(WT- Cyclin D1-Luc) and mutated −163 SP1 cyclin D1 (SP1mut-Cyclin D1-Luc) luciferase reporters were cotransfected with pSuper plasmid into UMUC3 cells, respectively, and the stable transfectants UMUC3/WT-Cyclin D1-Luc and UMUC3/SP1mut-Cyclin D1-Luc, were established. As shown in Fig. 7C, isorhapontigenin treatment inhibited cyclin D1 transcription in UMUC3/WT cyclin D1-Luc transfectant, whereas this treatment did not show a significant inhibition of cyclin D1 transcription in UMUC3/SP1mut-cyclin D1-Luc transfectant, suggesting that isorhapontigenin's inhibition of cyclin D1 transcription was specifically targeting SP1.

Isorhapontigenin impaired SP1 binding to its binding site in cyclin D1 promoter

To test whether downregulation of the SP1 level by isorhapontigenin was associated with its specific binding to cyclin D1 promoter in vivo, we conducted ChIP assays followed by PCR with primers, specifically targeting SP1 binding region from −92 to +27 in the human cyclin D1 promoter in UMUC3 cells (15). As shown in Fig. 7D, SP1 showed its binding to cyclin D1 promoter region between −92 to +27, and this binding was impaired in the cells treated with isorhapontigenin (5 μmol/L). Taken together, the above results showed that isorhapontigenin inhibited cyclin D1 promoter transcription activity in WT cyclin D1 reporter, but not in SP1-mutant reporter (Fig. 7C). We anticipated that downregulation of cyclin D1 transcription induced by isorhapontigenin was mediated by its targeting and inhibiting SP1 expression, transactivation, and specific binding to SP1 binding sites of cyclin D1 promoter region as summarized in Fig. 7E.

Isorhapontigenin is isolated from the Gnetum Cleistostachyum, and belongs to a group of naturally occurring polyhydroxy stilbenes (27). Several studies have indicated that isorhapontigenin exhibits an inhibitory effect on oxidized low-density lipoprotein (oxLDL)-induced proliferation and mitogenesis of bovine aortic smooth muscle cells (28). Isorhapontigenin also inhibits cardiac hypertrophy by anti-oxidative activity and attenuating oxidative stress-mediated signaling pathways (29). Isorhapontigenin has been used for treatment of bladder cancers for centuries. There are reports of side effects from super-high dose (6,000 mg/kg/d) application of the Chinese herb Gnetum Cleistostachyum in clinical patients (30), which include dry mouth and dizziness, followed by blurred vision, dry nasopharynx, and stomach pain. Our most recently published results also indicate that isorhapontigenin at concentration over 20 μmol/L show apoptosis in human bladder cancer cells via downregulation of XIAP expression, whereas at concentration at lower than 20 μmol/L, such as the concentration used in the current studies, do not show cytotoxic effect on human bladder cancer cell lines (21). Moreover, the pharmacokinetics of isorhapontigenin in mice indicated that the maximum observed concentration (Cmax) could reach to 47.9 μmol/L in mouse serum, suggesting that 5 to 20 μmol/L of isorhapontigenin concentrations applied in current in vitro studies are relevant to in vivo, and further providing crucial information in future isorhapontigenin application in either animal studies or clinical trials.

We find that isorhapontigenin at concentration within 20 to 60 μmol/L exhibits a significant inhibitory effect on anchorage-independent growth, a marked apoptotic induction, as well as downregulation of X-linked inhibitor of apoptosis protein (XIAP) in human bladder cancer cells, whereas overexpression of exogenous HA-XIAP reverses the apoptotic effects and colony formation inhibition by isorhapontigenin at concentration of 20 to 60 μmol/L (21). In the current studies, we explored the potential inhibitory effect of isorhapontigenin at nonapoptotic low concentration on anchorage-independent growth, cell-cycle alteration, and the molecular mechanisms underlying these biologic effects in high-grade bladder cancer cell lines, UMUC3 and RT112 cells. We found that isorhapontigenin not only inhibited anchorage-independent cell growth of cancer cell lines, it also induced cell-cycle G0–G1 arrest in a non–cell death concentration of 5 μmol/L in high-grade bladder cancer cell lines, UMUC3 and RT112 cells, whereas it only showed a slight inhibition of cyclin D1 expression in low-grade human bladder tumor RT4 cells. Moreover, we observed that isorhapontigenin had no inhibitory effect on cell proliferation and cyclin D1 expression in noncancerous Cl41 cells, suggesting that isorhapontigenin might have a strong inhibitory effect on invasive cancers, rather than low-grade and noncancerous cells. Further studies indicated that the isorhapontigenin anticancer activity was mediated by its downregulation of cyclin D1 expression via direct inhibition of SP1 transactivation and binding activity to cyclin D1 promoter region.

Growing evidence had indicated that cell-cycle alterations occur in responses of cells to various carcinogens (31, 32). Cyclin D1 is one of the key regulators in the control of cell-cycle progression from G0–G1 to S-phase, and inducible cyclin D1 forms a complex with CDK4/6, which phosphorylates the retinoblastoma tumor suppressor protein (33), sequestrates pRb growth inhibitory effects on E2F and enables E2F transcription factors to transcriptional regulate genes required for entry into the DNA synthetic phase (S) of the cell division cycle (34). Cyclin D1 overexpression prevails over that of cyclin D2 and D3 (35), and overexpression of cyclin D1 is one of the cancer features and is responsible for inducing excessive cellular proliferation in many human cancers, including bladder cancer (4), breast (36), cervix (37), colon (38), prostate (39), and skin cancer (40). Thus, cyclin D1 is one of the most frequently altered cell-cycle–regulating protein in cancers and therefore, is a potential therapeutic target (41, 42). For example, Meng and colleagues showed that cyclin D1-associated protein, PACSIN 2, regulates cell spreading and migration, both of which are dependent on cyclin D1 expression (43). Li and colleagues showed cyclin D1-deficient mouse embryo fibroblasts (MEF) exhibited increased adhesion and decreased motility compared with wild-type MEFs (44). Molecular approaches for targeting cyclin D1 expression include cyclin D1α isoform (full-length cyclin D1) with a small-molecule CDK4/6 inhibitor PD0332991 (45), siRNA(42, 46), genomic deletion of cyclin D1 gene (43), and modulation of glycogen synthase kinase 3β (GSK3β) activity (47). However, the major limitations of these genomic therapies are their poor stability, poor membrane permeability, and inadequate stable transfection efficiency (48). While there are no chemical inhibitors targeting cyclin D1 so far, identifying and exploring a natural compound that specifically downregulates cyclin D1 expression is of tremendous importance for cancer therapy and the reduction of mortality as a result of cancers. In current studies, we identified that isorhapontigenin at a concentration as low as 5 μmol/L was able to downregulate cyclin D1 expression at the transcriptional level. At this level, isorhapontigenin exhibited its induction of G0–G1 cell-cycle arrest and inhibition of anchorage-independent growth of human high-grade bladder cancer cells, without affecting cell viability or the other cell-cycle regulators, including cyclin A, cyclin B, cyclin E, CDK4, and CDK6. These findings show isorhapontigenin as a novel mechanism-based cancer therapeutic agent against human bladder cancer, and provide a basis for possible clinical trials exploring the usefulness of isorhapontigenin as a preventive and therapeutic agent against bladder and other cancers with abnormal expression of cyclin D1 in patients.

Cyclin D1 levels could be regulated at transcriptional and posttranscriptional levels (49). The signaling pathways that have been reported to regulate cyclin D1 expression include NF-κB (50), SP1 (15, 51), ras/mitogen-activated protein kinases (MAPK; ref. 52), phosphoinositide 3-kinase (PI3K)/Akt (53, 54), and GSK3β/β-catenin (55). Cyclin D1 promoter was first reported almost 20 years ago (56, 57), and many transcription factors have been identified to directly bind to, or otherwise regulate, the cyclin D1 promoter (36, 58). SP1 was an important transcription factor involved in the regulation of many gene expression and cellular functions, including cyclin D1 (5, 15, 51, 59). Here, we show that the isorhapontigenin-mediated transcriptional downregulation of the cyclin D1 gene was achieved by inhibition of transcription factor SP1. Our results indicate that isorhapontigenin treatment downregulated cyclin D1 expression, accompanied by its inhibition of transcription factor SP1 expression, transactivation, and binding activity to the cyclin D1 promoter region. Our studies further showed that putative SP1 binding sites were between −92 and +27 bp with the 5′-untranslated region, which is consistent with the previous finding regarding SP1-mediated regulation of cyclin D1 expression (15). On the basis of our results obtained from ChIP assay, SP1 was found to be a major participant transcription factor binding to the GC-box site of the cyclin D1 promoter and downregulating cyclin D1 transcription upon isorhapontigenin treatment.

In summary, our studies show that isorhapontigenin is an active compound that is responsible for Gnetum Cleistostachyum inhibition of bladder cancer cell anchorage-independent growth. This anticancer activity of isorhapontigenin is mediated by its downregulation of cyclin D1 expression, and in turn, its induction of cell-cycle G0–G1 arrest via specific targeting of transcription factor SP1 in bladder cancer cells. Our studies provide a novel insight into understanding the anticancer activity of the Chinese herb Gnetum Cleistostachyum isolate, isorhapontigenin, as proposed in Fig. 7E. Although in vivo animal verification and extensive in vitro studies will be required for further translational application of isorhapontigenin in the management of clinical patients, particularly gene models with highly expressed cyclin D1, the understanding of the molecular mechanisms responsible for isorhapontigenin action would provide valuable information for the design of more effective strategies for use of isorhapontigenin in therapy and prevention of high-grade bladder cancers, to substantially impact the field of bladder cancer therapy.

No potential conflicts of interest were disclosed.

Conception and design: Y. Fang, Q. Hou, X.R. Wu, C. Huang

Development of methodology: Y. Fang, Q. Hou, C. Ma, J. Li

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): Y. Fang, Z. Cao, Q. Hou, J. Li, X.R. Wu

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): Y. Fang, Q. Hou, X.R. Wu, C. Huang

Writing, review, and/or revision of the manuscript: Y. Fang, Q. Hou, X.R. Wu, C. Huang

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): Y. Fang, Q. Hou, C. Yao

Study supervision: Q. Hou, C. Huang

The authors thank Dr. Peggy J. Farnham from McArdle Laboratory for Cancer Research, University of Wisconsin for the gift of transcription factor Spl luciferase reporter; Dr. Anil Rustgi from Gastroenterology Division, University of Pennsylvania, for the cyclin D1 promoter-driven luciferase reporter; and Dr. Richard G. Pestell from the Department of Cancer Biology and Medical Oncology, Kimmel Cancer Center, Thomas Jefferson University, for generous gift of human cyclin D1 −163 and −163 mSP1 promoter-driven luciferase reporter.

This work was partially supported by grants from NIH/NCI CA112557 (C. Huang), CA177665 (C. Huang), NIH/NIEHS ES000260 (C. Huang), and NSFC 81229002 (C. Huang).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Holick
CN
,
Giovannucci
EL
,
Stampfer
MJ
,
Michaud
DS
. 
A prospective study of fish, marine fatty acids, and bladder cancer risk among men and women (United States)
.
Cancer Causes Control
2006
;
17
:
1163
73
.
2.
Gerullis
H
,
Ecke
TH
,
Janusch
B
,
Arndt
C
,
Heidari
M
,
Oniani
J
, et al
Long-term response in advanced bladder cancer involving the use of temsirolimus and vinflunine after platin resistance
.
Anticancer Drugs
2011
;
22
:
940
3
.
3.
Kaufman
DS
,
Shipley
WU
,
Feldman
AS
. 
Bladder cancer
.
Lancet
2009
;
374
:
239
49
.
4.
Shariat
SF
,
Ashfaq
R
,
Sagalowsky
AI
,
Lotan
Y
. 
Correlation of cyclin D1 and E1 expression with bladder cancer presence, invasion, progression, and metastasis
.
Hum Pathol
2006
;
37
:
1568
76
.
5.
Ikoma
T
,
Ozawa
S
,
Suzuki
K
,
Kondo
T
,
Maehata
Y
,
Lee
MC
, et al
Calcium-calmodulin signaling induced by epithelial cell differentiation upregulates BRAK/CXCL14 expression via the binding of SP1 to the BRAK promoter region
.
Biochem Biophys Res Commun
2012
;
420
:
217
22
.
6.
Yuan
L
,
Gu
X
,
Shao
J
,
Wang
M
,
Wang
M
,
Zhu
Q
, et al
Cyclin D1 G870A polymorphism is associated with risk and clinicopathologic characteristics of bladder cancer
.
DNA Cell Biol
2010
;
29
:
611
7
.
7.
Lin
DI
,
Lessie
MD
,
Gladden
AB
,
Bassing
CH
,
Wagner
KU
,
Diehl
JA
. 
Disruption of cyclin D1 nuclear export and proteolysis accelerates mammary carcinogenesis
.
Oncogene
2008
;
27
:
1231
42
.
8.
Ciznadija
D
,
Liu
Y
,
Pyonteck
SM
,
Holland
EC
,
Koff
A
. 
Cyclin D1 and cdk4 mediate development of neurologically destructive oligodendroglioma
.
Cancer Res
2011
;
71
:
6174
83
.
9.
Tashiro
E
,
Maruki
H
,
Minato
Y
,
Doki
Y
,
Weinstein
IB
,
Imoto
M
. 
Overexpression of cyclin D1 contributes to malignancy by up-regulation of fibroblast growth factor receptor 1 via the pRB/E2F pathway
.
Cancer Res
2003
;
63
:
424
31
.
10.
Yamada
M
,
Hayashi
K
,
Ikeda
S
,
Tsutsui
K
,
Ito
T
,
Iinuma
M
, et al
Inhibitory activity of plant stilbene oligomers against DNA topoisomerase II
.
Biol Pharm Bull
2006
;
29
:
1504
7
.
11.
Hagiwara
K
,
Kosaka
N
,
Yoshioka
Y
,
Takahashi
RU
,
Takeshita
F
,
Ochiya
T
. 
Stilbene derivatives promote Ago2-dependent tumour-suppressive microRNA activity
.
Sci Rep
2012
;
2
:
314
.
12.
Huang
KS
,
Wang
YH
,
Li
RL
,
Lin
M
. 
Stilbene dimers from the lianas of Gnetum hainanense
.
Phytochemistry
2000
;
54
:
875
81
.
13.
Ouyang
W
,
Ma
Q
,
Li
J
,
Zhang
D
,
Liu
ZG
,
Rustgi
AK
, et al
Cyclin D1 induction through IkappaB kinase beta/nuclear factor-kappaB pathway is responsible for arsenite-induced increased cell cycle G1-S phase transition in human keratinocytes
.
Cancer Res
2005
;
65
:
9287
93
.
14.
Jenkins
TD
,
Mueller
A
,
Odze
R
,
Shahsafaei
A
,
Zukerberg
LR
,
Kent
R
, et al
Cyclin D1 overexpression combined with N-nitrosomethylbenzylamine increases dysplasia and cellular proliferation in murine esophageal squamous epithelium
.
Oncogene
1999
;
18
:
59
66
.
15.
Marampon
F
,
Casimiro
MC
,
Fu
M PM
,
Popov
VM
,
Lindsay
J
,
Zani
BM
, et al
Nerve Growth factor regulation of cyclin D1 in PC12 cells through a p21RAS extracellular signal-regulated kinase pathway requires cooperative interactions between Sp1 and nuclear factor-kappaB
.
Mol Biol Cell
2008
;
19
:
2566
78
.
16.
Slansky
JE
,
Li
Y
,
Kaelin
WG
,
Farnham
PJ
. 
A protein synthesis-dependent increase in E2F1 mRNA correlates with growth regulation of the dihydrofolate reductase promoter
.
Mol Cell Biol
1993
;
13
:
1610
8
.
17.
Huang
HY
,
Shariat
SF
,
Sun
TT
,
Lepor
H
,
Shapiro
E
,
Hsieh
JT
, et al
Persistent uroplakin expression in advanced urothelial carcinomas: implications in urothelial tumor progression and clinical outcome
.
Hum Pathol
2007
;
38
:
1703
13
.
18.
Huang
C
,
Ma
WY
,
Ryan
CA
,
Dong
Z
. 
Proteinase inhibitors I and II from potatoes specifically block UV-induced activator protein-1 activation through a pathway that is independent of extracellular signal-regulated kinases, c-Jun N-terminal kinases, and P38 kinase
.
Proc Natl Acad Sci U S A
1997
;
94
:
11957
62
.
19.
Huang
C
,
Ma
WY
,
Young
MR
,
Colburn
N
,
D
Z
. 
Shortage of mitogen-activated protein kinase is responsible for resistance to AP-1 transactivation and transformation in mouse JB6 cells
.
Proc Natl Acad Sci U S A
1998
;
95
:
156
61
.
20.
Huang
C
,
Ma
WY
,
Dong
Z
. 
Requirement for phosphatidylinositol 3-kinase in epidermal growth factor-induced AP-1 transactivation and transformation in JB6 P +cells
.
Mol Cell Biol
1996
;
16
:
6427
35
.
21.
Fang
Y
,
Yu
Y
,
Hou
Q
,
Zhen
X
,
Zhang
M
,
Zhang
D
, et al
The Chinese herb isolate isorhapontigenin induces apoptosis in human cancer cells by downregulating overexpression of antiapoptotic protein XIAP
.
J Biol Chem
2012
;
287
:
35234
43
.
22.
Zhang
D
,
Li
J
,
Costa
M
,
Gao
J
,
Huang
C
. 
JNK1 mediates degradation HIF-1alpha by a VHL-independent mechanism that involves the chaperones Hsp90/Hsp70
.
Cancer Res
2010
;
70
:
813
23
.
23.
Zhang
D
,
Li
J
,
Zhang
M
,
Gao
G
,
Zuo
Z
,
Yu
Y
, et al
The Requirement of c-Jun N-terminal kinase2 in Regulation of hypoxia inducing factor-1&[alpha] mRNA Stability
.
J Biol Chem
2012
;
287
:
34361
71
.
24.
Li
J
,
Chen
H
,
Tang
MS
,
Shi
X
,
Amin
S
,
Desai
D
, et al
PI-3K and Akt are mediators of AP-1 induction by 5-MCDE in mouse epidermal Cl41 cells
.
J Cell Biol
2004
;
165
:
77
86
.
25.
Song
L
,
Li
J
,
Zhang
D
,
Liu
ZG
,
Ye
J
,
Zhan
Q
, et al
IKKbeta programs to turn on the GADD45alpha-MKK4-JNK apoptotic cascade specifically via p50 NF-kappaB in arsenite response
.
J Cell Biol
2006
;
175
:
607
17
.
26.
Song
L
,
Gao
M
,
Dong
W
,
Hu
M
,
Li
J
,
Shi
X
, et al
p85alpha mediates p53 K370 acetylation by p300 and regulates its promoter-specific transactivity in the cellular UVB response
.
Oncogene
2011
;
30
:
1360
71
.
27.
Huang
KS
,
Zhou
S
,
Lin
M
,
Wang
YH
. 
An isorhapontigenin tetramer and a novel stilbene dimer from Gnetum hainanense
.
Planta Med
2002
;
68
:
916
20
.
28.
Liu
Y
,
Liu
G
. 
Isorhapontigenin and resveratrol suppress oxLDL-induced proliferation and activation of ERK1/2 mitogen-activated protein kinases of bovine aortic smooth muscle cells
.
Biochem Pharmacol
2004
;
67
:
777
85
.
29.
Li
HL
,
Wang
AB
,
Huang
Y
,
Liu
DP
,
Wei
C
,
Williams
GM
, et al
Isorhapontigenin, a new resveratrol analog, attenuates cardiac hypertrophy via blocking signaling transduction pathways
.
Free Radic Biol Med
2005
;
38
:
243
57
.
30.
China Pharmaceutical University
,
editor
.
Chinese medicine Cihai (Volume 2)
.
China Medical Science and Technology Press
1997
:
2365
66
.
31.
Sherr
CJ
. 
Cancer cell cycles
.
Science
1996
;
274
:
1672
7
.
32.
Lee
CC
,
Yamamoto
S
,
Wanibuchi
H
,
Wada
S
,
Sugimura
K
,
Kishimoto
T
, et al
Cyclin D1 overexpression in rat two-stage bladder carcinogenesis and its relationship with oncogenes, tumor suppressor genes, and cell proliferation
.
Cancer Res
1997
;
57
:
4765
76
.
33.
Keenan
SM
,
Lents
NH
,
Baldassare
JJ
. 
Expression of cyclin E renders cyclin D-CDK4 dispensable for inactivation of the retinoblastoma tumor suppressor protein, activation of E2F, and G1-S phase progression
.
J Biol Chem
2004
;
279
:
5387
96
.
34.
Singh
RP
,
Agarwal
C
,
Agarwal
R
. 
Inositol hexaphosphate inhibits growth, and induces G1 arrest and apoptotic death of prostate carcinoma DU145 cells: modulation of CDKI-CDK-cyclin and pRb-related protein-E2F complexes
.
Carcinogenesis
2003
;
24
:
555
63
.
35.
Kim
JK
,
Diehl
JA
. 
Nuclear cyclin D1: an oncogenic driver in human cancer
.
J Cell Physiol
2009
;
220
:
292
6
.
36.
Rajabi
H
,
Ahmad
R
,
Jin
C
,
Kosugi
M
,
Alam
M
,
Joshi
MD
, et al
MUC1-C oncoprotein induces TCF7L2 transcription factor activation and promotes cyclin D1 expression in human breast cancer cells
.
J Biol Chem
2012
;
287
:
10703
13
.
37.
Satinder
K
,
Chander
SR
,
Pushpinder
K
,
Indu
G
,
Veena
J
. 
Cyclin D1 (G870A) polymorphism and risk of cervix cancer: a case control study in north Indian population
.
Mol Cell Biochem
2008
;
315
:
151
7
.
38.
Ogino
S
,
Nosho
K
,
Irahara
N
,
Kure
S
,
Shima
K
,
Baba
Y
, et al
A cohort study of cyclin D1 expression and prognosis in 602 colon cancer cases
.
Clin Cancer Res
2009
;
15
:
4431
8
.
39.
Fleischmann
A
,
Rocha
C
,
Saxer-Sekulic
N
,
Zlobec
I
,
Sauter
G
,
Thalmann
GN
. 
High-level cytoplasmic cyclin D1 expression in lymph node metastases from prostate cancer independently predicts early biochemical failure and death in surgically treated patients
.
Histopathology
2011
;
58
:
781
9
.
40.
Burnworth
B
,
Popp
S
,
Stark
HJ
,
Steinkraus
V
,
Bröcker
EB
,
Hartschuh
W
, et al
Gain of 11q/cyclin D1 overexpression is an essential early step in skin cancer development and causes abnormal tissue organization and differentiation
.
Oncogene
2006
;
25
:
4399
412
.
41.
Kristt
D
,
Turner
I
,
Koren
R
,
Ramadan
E
,
Gal
R
. 
Overexpression of cyclin D1 mRNA in colorectal carcinomas and relationship to clinicopathological features: an in situ hybridization analysis
.
Pathol Oncol Res
2000
;
6
:
65
70
.
42.
Lehn
S
,
Tobin
NP
,
Berglund
P
,
Nilsson
K
,
Sims
AH
,
Jirström
K
, et al
Down-regulation of the oncogene cyclin D1 increases migratory capacity in breast cancer and is linked to unfavorable prognostic features
.
Am J Pathol
2010
;
177
:
2886
97
.
43.
Meng
H
,
Tian
L
,
Zhou
J
,
Li
Z
,
Jiao
X
,
Li
WW
, et al
PACSIN 2 represses cellular migration through direct association with cyclin D1 but not its alternate splice form cyclin D1b
.
Cell Cycle
2011
;
10
:
73
81
.
44.
Li
Z
,
Wang
C
,
Jiao
X
,
Lu
Y
,
Fu
M
,
Quong
AA
, et al
Cyclin D1 regulates cellular migration through the inhibition of thrombospondin 1 and ROCK signaling
.
Mol Cell Biol
2006
;
26
:
4240
56
.
45.
Marzec
M
,
Kasprzycka
M
,
Lai
R
,
Gladden
AB
,
Wlodarski
P
,
Tomczak
E
, et al
Mantle cell lymphoma cells express predominantly cyclin D1a isoform and are highly sensitive to selective inhibition of CDK4 kinase activity
.
Blood
2006
;
108
:
1744
50
.
46.
Xiao
Y
,
Wang
J
,
Lu
J
,
Liu
Y
,
Wang
Y
,
Gao
Y
, et al
Down-regulation of cyclin D1 by small interfering RNA inhibits cell growth and induces apoptosis of laryngeal squamous cell carcinoma
.
Am J Otolaryngol
2011
;
32
:
541
6
.
47.
Yang
K
,
Guo
Y
,
Stacey
WC
,
Harwalkar
J
,
Fretthold
J
,
Hitomi
M
, et al
Glycogen synthase kinase 3 has a limited role in cell cycle regulation of cyclin D1 levels
.
BMC Cell Biol
2006
;
30
:
33
.
48.
Nie
J
,
Liu
L
,
Zheng
W
,
Chen
L
,
Wu
X
,
Xu
Y
, et al
microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting Cyclin D1 and Bcl-2
.
Carcinogenesis
2012
;
33
:
220
5
.
49.
Musgrove
EA
. 
Cyclins: roles in mitogenic signaling and oncogenic transformation
.
Growth Factors
2006
;
24
:
13
9
.
50.
Klein
EA
,
Yang
C
,
Kazanietz
MG
,
Assoian
RK
. 
NFkappaB-independent signaling to the cyclin D1 gene by Rac
.
Cell Cycle
2007
;
6
:
1115
21
.
51.
Bartusel
T
,
Schubert
S
,
Klempnauer
KH
. 
Regulation of the cyclin D1 and cyclin A1 promoters by B-Myb is mediated by Sp1 binding sites
.
Gene
2005
;
351
:
171
80
.
52.
Liu
Y
,
Hock
JM
,
Sullivan
C
,
Fang
G
,
Cox
AJ
,
Davis
KT
, et al
Activation of the p38 MAPK/Akt/ERK1/2 signal pathways is required for the protein stabilization of CDC6 and cyclin D1 in low-dose arsenite-induced cell proliferation
.
J Cell Biochem
2010
;
111
:
1546
55
.
53.
Ouyang
W
,
Li
J
,
Ma
Q
,
Huang
C
. 
Essential roles of PI-3K/Akt/IKKbeta/NFkappaB pathway in cyclin D1 induction by arsenite in JB6 Cl41 cells
.
Carcinogenesis
2006
;
27
:
864
73
.
54.
Ouyang
W
,
Luo
W
,
Zhang
D
,
Jian
J
,
Ma
Q
,
Li
J
, et al
PI-3K/Akt pathway-dependent cyclin D1 expression is responsible for arsenite-induced human keratinocyte transformation
.
Environ Health Perspect
2008
;
116
:
1
6
.
55.
D'Amico
M
,
Hulit
J
,
Amanatullah
DF
,
Zafonte
BT
,
Albanese
C
,
Bouzahzah
B
, et al
The integrin-linked kinase regulates the cyclin D1 gene through glycogen synthase kinase 3beta and cAMP-responsive element-binding protein-dependent pathways
.
J Biol Chem
2000
;
275
:
32649
57
.
56.
Motokura
T
,
Arnold
A
. 
PRAD1/cyclin D1 proto-oncogene: genomic organization, 5′ DNA sequence, and sequence of a tumor-specific rearrangement breakpoint
.
Genes Chromosomes Cancer
1993
;
7
:
89
95
.
57.
Herber
B
,
Truss
M
,
Beato
M
,
Muller
R
. 
Inducible regulatory elements in the human cyclin D1 promoter
.
Oncogene
1994
;
9
:
2105
7
.
58.
Vartanian
R
,
Masri
J
,
Martin
J
,
Cloninger
C
,
Holmes
B
,
Artinian
N
, et al
AP-1 regulates cyclin D1 and c-MYC transcription in an AKT-dependent manner in response to mTOR inhibition: role of AIP4/Itch-mediated JUNB degradation
.
Mol Cancer Res
2011
;
9
:
115
30
.
59.
Seznec
J
,
Silkenstedt
B
,
Naumann
U
. 
Therapeutic effects of the Sp1 inhibitor mithramycin A in glioblastoma
.
J Neurooncol
2011
;
101
:
365
77
.