Medulloblastoma is a malignant pediatric brain tumor. Current treatment following patient stratification into standard and high-risk groups using clinical features has improved survival. However, a subset of patients with standard risk features have unanticipated aggressive disease, underscoring the need for a better understanding of tumor biology and the development of novel treatments. Poor differentiation, a hallmark of medulloblastomas is associated with elevated expression levels of the repressor of neuronal differentiation called repressor element 1-silencing transcription factor (REST). Here, we assessed whether elevated REST expression levels had prognostic significance and whether its pharmacologic manipulation would promote neurogenesis and block tumor cell growth. REST levels in patient tumors were measured by immunohistochemistry and stratified into negative, low/moderate- (+/++/+++), and high-REST (+++++) groups. Kaplan–Meier curves revealed that patients with high-REST tumors had worse overall and event-free survival compared with patients with REST-negative or REST-low tumors. Because histone deacetylases (HDAC) are required for REST-dependent repression of neurogenesis, we evaluated a panel of HDAC inhibitors (HDACI) for their effects on growth and differentiation of established and primary REST-positive cell lines. MS-275, trichostatin-A (TSA), valproic acid (VPA), and suberoylanilide hydroxamic acid (SAHA) upregulated expression of the REST-target neuronal differentiation gene, Syn1, suggesting a potential effect of these HDACIs on REST function. Interestingly, VPA and TSA substantially increased histone acetylation at the REST promoter and activated its transcription, whereas SAHA unexpectedly promoted its proteasomal degradation. A REST-dependent decrease in cell growth was also observed following SAHA treatment. Thus, our studies suggest that HDACIs may have therapeutic potential for patients with REST-positive tumors. This warrants further investigation. Mol Cancer Ther; 11(8); 1713–23. ©2012 AACR.

Brain tumors are the most common solid malignancy and the leading cause of cancer-related morbidity and mortality in pediatrics (1). Medulloblastoma, a malignant tumor of the cerebellum with a high propensity for leptomeningeal dissemination, represents approximately 20% of all childhood brain tumors (2). Current prognostication and treatment strategies are primarily based on patient stratification into standard and high-risk groups using clinical factors such as patient's age, tumor resection, metastases, and tumor histology (3–6). The 5-year overall survival (OS) is approximately 75% to 85% and 50% to 70% for standard-risk and high-risk patients, respectively (3, 7, 8). Unfortunately, approximately 30% of patients develop recurrent disease, and a proportion of patients with “standard” risk features exhibit unanticipated clinically aggressive disease (9, 10). A number of patients with recurrent and progressive disease who fail first-line therapies eventually succumb to their illness (9, 10). There is a great movement toward using disease-specific molecular features to help delineate the different risk groups, so that treatment strategies can be tailored for each patient to maximize survival and minimize toxicities (11–15). However, despite an improved understanding of tumor etiology, only a few of the molecules uncovered as key regulators of medulloblastoma biology have been studied as therapeutic targets or as prognostic factors in upfront protocol strategies for newly diagnosed patients (4, 16–18).

Medulloblastomas are poorly differentiated cerebellar tumors. The repressor element-1 silencing transcription factor (REST) is a transcriptional repressor of a number of genes involved in terminal neuronal differentiation (19–22). Previous studies showed abnormally elevated expression of REST in human medulloblastoma tumors (23, 24). REST knockdown in human medulloblastoma cells abrogated their tumorigenic potential in mouse orthotopic models, whereas its constitutive expression in Myc-immortalized neural progenitors promoted tumor formation in vivo (23, 24). These findings highlight the importance of REST in medulloblastoma genesis.

In the current study, we evaluated the prognostic significance of increased REST levels in human medulloblastoma samples. We show that increased REST levels are correlated with poor OS and event-free survival (EFS) in patients with the disease. Given its poor prognostic significance, we investigated whether REST activity could be pharmacologically manipulated for further development as a therapeutic target. Transcriptional repression of terminal neuronal differentiation genes such as Syn1, TUBIII, and SCG10 requires the activity of histone deacetylases-1 and -2 (HDAC1/2) that are complexed with the amino- and carboxy-terminal repression domains of REST (19, 21, 25). We therefore studied the ability of a panel of HDAC inhibitors (HDACI) to attenuate REST-mediated blockade of neuronal differentiation and promotion of cell growth. We observed that MS-275, valproic acid (VPA), trichostatin A (TSA), and suberoyl anilide hydroxamic acid (SAHA/vorinostat) induced the expression of the REST-target gene Syn1, which is required for synaptic function (26), and blocked cell growth of medulloblastoma cell lines. Unexpectedly, REST transcription was upregulated by VPA and TSA, whereas SAHA promoted its proteasomal degradation. MS-275 caused only a small change in REST transcription or protein levels, suggesting that it likely induced differentiation by inhibiting REST activity. These data suggest that MS-275 and SAHA may warrant further preclinical investigation as potential therapeutic agents for patients with high-REST–expressing medulloblastoma.

Analyses of patient samples

Institutional Review Board approval was obtained for immunohistochemical (IHC) staining of medulloblastoma samples for REST levels and for retrospective chart analyses of patient correlates. Baseline information on each patient, including, age, sex, histology, metastases, surgical resection (documented by postoperative MRI), treatments, recurrences, and date of last follow-up or death was collected. Sections of paraffin-embedded tissue were studied by hematoxylin and eosin (H&E) staining and IHC to measure REST protein levels using anti-REST antibody (Sigma-Aldrich, Inc.; 1:150 dilution) and 3,3′-diaminobenzidine (DAB) staining (Thermo Scientific). Hematoxylin (Richard-Allen Scientific) was used as a counterstain. Slides were semiquantitatively evaluated for REST levels by 2 observers (J. Fangusaro and V. Rajaram) using a 5-point grading scale as described in Table 1.

Table 1.

Description of REST staining characteristics in tumor tissue

Staining grading systemPattern of staining%
Negative 19 
Weak and focal 17 
Weak diffuse or multifocal 
Strong and focal 40 
Strong diffuse or focal 23 
Staining grading systemPattern of staining%
Negative 19 
Weak and focal 17 
Weak diffuse or multifocal 
Strong and focal 40 
Strong diffuse or focal 23 

Plasmids

Human REST (hREST) transgene was cloned into a modified pcDNA3.1-V5/His plasmid wherein the cytomegalovirus (CMV) promoter was replaced by a 1-kb region of the NeuroD2 (ND2) promoter (27). A 6× His/3× HA epitope tag was added to the amino-terminus of hREST to generate the pcDNA3.1/ND2/REST plasmid.

Cell culture

DAOY and D283 (American Type Cell Culture) were cultivated in the recommended media. Cell identity was verified using single-nucleotide polymorphism (SNP) analysis. Conditions for the cultivation of primary medulloblastoma cultures (UW426, UW228, MB01110, MB003, and MB020) are described in Supplementary Material. Immortalized mouse neural progenitor cells (NSC-M and NSC-MR) were maintained as previously described (24).

Drug treatment

Tumor cells were treated with 2.5 μmol/L MS-275 (Alexis), 33 nmol/L TSA (Millipore), 1.5 mmol/L VPA (Sigma), 5 μmol/L SAHA (Caymen Chemicals), 100 μg/mL cycloheximide (CHX; Sigma), or 20 μmol/L MG132 (Calbiochem) for various time periods and processed as outlined later. The structures of these HDACIs were obtained through the National Cancer Institute PubChem Compound Database using their unique chemical structure identifiers CID: 4216, 444732, 3121, and 5311 (ref. 28; Fig. 3A). The specificities of these HDACIs are also shown in Fig. 3A (6, 29–32).

Western blot

Equal amount of protein extracts prepared from untreated or drug-treated cells were subjected to PAGE and Western blotting using the following antibodies: anti-REST (1:1,000, Millipore), anti-AcH3 (1:1,000, Millipore), anti-Actin horseradish peroxidase (HRP; 1:50,000, Cell Signaling), and anti-GAPDH HRP (1:2,000, Abcam).

Quantitative RT-PCR and quantitative PCR

Quantitative PCR (qPCR) and quantitative reverse transcription polymerase chain reaction (qRT-PCR) analyses and normalization and statistics for assays conducted in triplicate were conducted as described previously (33, 34). The following primers were used for our analyses:

qRT-PCR: Human Syn1: Forward primer: 5′ CAACGGAGACTACCGCAGTTTGGTC 3′, Reverse primer: 5′ GGGGTAGAAGGTCTGATCAATTAGAGGG 3′; Mouse Syn1: Forward primer: 5′ CTCATTCCTCAGTATGTCCCTTGAGAAAC 3′, Reverse primer: 5′ GAAATCACCCTTTAGATGTACCAGAAGTAGAGG 3′; Human REST: Forward primer: 5′ GAAACACCTGGAGCGGAGGACAAAG 3′, Reverse primer: 5′ CTTCTGCAGTGGAAGAGCCAGATTCC 3′; Human 18s RNA: Forward primer: 5′ GTGGTGTTGAGGAAAGCAGAC 3′, Reverse primer: 5′ CATCCTTCTGTCTGTTCAAGA 3′; Mouse 18s RNA: Forward primer: 5′ GAACTCACGGAGGATGAGGTG 3′, Reverse primer: 5′ GTTGGCCAGAACCTGGCTGTA 3′.

qPCR: Human REST (−2.0 kb): Forward primer: 5′ CAAGTTCATAGCAACAGCTTCCCT C 3′, Reverse primer: 5′ GAGGCCCTTGTTCAAGGGATG 3′; (−1.5 kb): Forward primer: 5′ CCCTTCCTTCCTGTCTCTTTGGTTC 5′, Reverse primer: 5′ GGACCTCTGTTTCCCTCTATCTGG 3′; (−1.0 kb): Forward primer: 5′ CCATCTTCCTACTGGCAAACCCC 3′, Reverse primer: 5′ CGTAAGTCACACCTGTCCTCAGAAGC 3′; (−0.5 kb): Forward primer: 5′ CACGCTTTCTGAGTCCATAACCTCCTTC 3′, Reverse primer: 5′ CTCTTCAAGTCTCCACCCATAGCTGTC 3′; Human Syn1-RE1: Forward primer: 5′ CAACACTACAAACCGAGTATCTGC 3′, Reverse primer: 5′ GCCTCATCCTGGTCCTAAAA 3′.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was done as previously described using anti-AcH3, anti-AcH4, anti-REST, anti-HDAC1, anti-HDAC2 (Millipore) or nonimmune sera (rabbit or mouse IgG; ref. 35). Primers used for qPCR are listed above. The signal obtained with IgG was subtracted from that with specific antibodies and reported.

MTT

DAOY, DAOY-REST, NSC-M, and NSC-MR cells were treated with various concentrations of SAHA for different time-periods. Growth of drug-treated cells relative to untreated cells was measured by MTT assays (35). Each sample was run in quadruplicate and repeated at least 4 times.

Statistical methods

Estimated 3- and 5-year EFS and OS rates were calculated using the Kaplan–Meier method, and P values determined by log-rank tests. Recurrences were considered as events while calculating EFS, whereas death was used to calculate EFS and OS. Statistical analyses for patient analysis were conducted using SAS (v9.2) and a P value of less than 0.05 was considered significant. Statistical analysis for all other experiments was done using Statistica (v6.0., StatSoft). Significance is indicated as 0.1 > P > 0.05(*), 0.05 ≥ P > 0.01(**), or P ≤ 0.01(***).

REST is elevated in human medulloblastoma samples and cell lines

Tumors from 58 patients with a new diagnosis (2000–2010) were used for our analyses. Of these, 60% were male and the median and mean age at diagnosis was 7.23 and 7.28 years, respectively (Supplementary Table S1A). Histologically, 62.1%, 25.9%, and 12% of patients had tumors with classic, anaplastic, and desmoplastic histology, respectively (Supplementary Table S1A). Approximately, 64% of patients underwent a gross total resection (GTR). The remainder had less than a GTR (Supplementary Table S1A). A total of 70.7% of patient had no metastases at diagnosis, whereas 29.3% did have metastases, either documented by MRI or lumbar spinal fluid cytology (Supplementary Table S1A). The mean follow-up for patients was 43.2 months (0.7–121.5).

The 5-year EFS and OS for the entire cohort were 81.6% and 81.8%, respectively. Univariate analysis (Supplementary Tables S1B and S1C) revealed that patients less than 3 years of age at diagnosis had 5-year EFS and OS rates of 46.9% and 54.6%, respectively, whereas those diagnosed after the age of 3 years had a 5-year EFS and OS rates of 90.8% and 88.6%, respectively (EFS, P = 0.0003 and OS, P = 0.004). Patients with less than a GTR had 5-year EFS and OS rates of 64.3% and 68.4%, respectively, in contrast to a 5-year EFS and OS rates of 91.5% and 90.0%, respectively, in children with GTR (EFS, P = 0.01 and OS, P = 0.03). Also, patients with tumor metastases at diagnosis had a 5-year EFS and OS rate of 44.1% and 47.5%, respectively, in contrast to a 5-year EFS and OS rate of 94.9% and 94.5% (EFS, P < 0.0001 and OS, P < 0.0001), respectively, for patients without metastases.

Once we established that the prognostic variables of our dataset were similar to that described in the literature, tumor samples were stained for REST protein and graded from no expression (−) to elevated expression (+/++/+++/++++; Fig. 1A, bottom). The corresponding H&E staining is shown on the top (Fig. 1A). Infant cerebellum was used as a negative control (Fig. 1A). REST staining seemed to be solely nuclear in some cases and was both nuclear and cytoplasmic in other cases (Fig. 1A). Approximately, 81% of the samples exhibited higher levels of REST staining compared with normal cerebellum (Fig. 1A, Table 1). Of the REST-positive samples, quantitation was as follows: 17% (+), 1% (++), 40% (+++), and 23% (++++; Fig. 1A, Table 1). REST protein was also detected by Western blotting in a panel of established (DAOY and D283) and primary cultures (UW228, UW426, MB01110, MB003, and MB020) of human medulloblastoma (Fig 1B). Interestingly, a faster migrating, possibly a degradation, or alternatively spliced form of REST (∼125 kDa) was detected in UW426 cells, whereas the expected 180 kDa form of the protein was seen in other cell lines. REST levels were variable among these cells although it was elevated relative to normal cerebella where REST was absent (Fig. 1B). SK-N-AS neuroblastoma cells and actin served as positive and loading controls, respectively.

Figure 1.

REST protein is elevated in human medulloblastoma cells. A, REST protein levels in human medulloblastomas and normal fetal cerebellum were determined by IHC using anti-REST antibody. Staining was evaluated and scored by our neuropathologist as −/+/++/+++/++++. B, Western blot analysis to measure REST levels in a panel of human medulloblastoma cultures was conducted using anti-REST antibody. SK-N-AS neuroblastoma cell line and normal cerebellum were included as positive and negative controls, respectively. Actin served as a loading control. C, REST-target gene Syn1 expression in medulloblastoma cell lines was measured by qRT-PCR analysis. Retinoic acid–treated SK-N-SH neuroblastoma cells (*) served as a positive control. Experiments were carried out in triplicate and values were normalized to 18sRNA and then to SK-N-SH* (set to 1) and reported as mean ± SE.

Figure 1.

REST protein is elevated in human medulloblastoma cells. A, REST protein levels in human medulloblastomas and normal fetal cerebellum were determined by IHC using anti-REST antibody. Staining was evaluated and scored by our neuropathologist as −/+/++/+++/++++. B, Western blot analysis to measure REST levels in a panel of human medulloblastoma cultures was conducted using anti-REST antibody. SK-N-AS neuroblastoma cell line and normal cerebellum were included as positive and negative controls, respectively. Actin served as a loading control. C, REST-target gene Syn1 expression in medulloblastoma cell lines was measured by qRT-PCR analysis. Retinoic acid–treated SK-N-SH neuroblastoma cells (*) served as a positive control. Experiments were carried out in triplicate and values were normalized to 18sRNA and then to SK-N-SH* (set to 1) and reported as mean ± SE.

Close modal

Because REST is a repressor of neuronal differentiation genes, we studied the relationship between REST levels and tumor differentiation in medulloblastoma cell lines by measuring the expression of its target gene, Synapsin1 (Syn1) by qRT-PCR analyses. Syn1 expression in SK-N-SH neuroblastoma cells treated with retinoic acid served as a positive control (34). As seen in Fig. 1C, most tumor cells with the exception of MB01110 exhibited poor Syn1 gene expression compared with normal cerebella, suggesting a blockade of neuronal differentiation in most REST-positive cells.

High-REST level in tumors correlates with poor prognostic significance

To determine if high-REST levels in tumors correlated with patient survival, we grouped patients into 5 categories (−/+/++/+++/++++) on the basis of the level of REST staining in tumors. OS and EFS were determined and Kaplan–Meier curves plotted (Fig. 2A and B). Patients with tumors graded as 4+ had the worst prognosis with a 5-year OS and EFS of 58.9% and 62.3%, respectively. Patients with REST grading of 0 to 3+ had a 5-year OS and EFS of 88.2% and 84.2%, respectively (OS and EFS, P = 0.06 and P = 0.05, respectively; Fig. 2A and B).

Figure 2.

Elevated REST levels in human medulloblastoma is associated with poor outcome. Kaplan–Meier curves were plotted to compare OS (A) and EFS (B) in patients with high-REST (++++) and REST-negative (−) or low-moderate REST (+/++/+++) staining. P values were established by log-rank test.

Figure 2.

Elevated REST levels in human medulloblastoma is associated with poor outcome. Kaplan–Meier curves were plotted to compare OS (A) and EFS (B) in patients with high-REST (++++) and REST-negative (−) or low-moderate REST (+/++/+++) staining. P values were established by log-rank test.

Close modal

HDACI treatment induces neuronal differentiation

Because high REST protein levels were associated with poor survival in patient samples, we asked whether REST activity could be targeted through pharmacologic approaches. Consistent with our previous work, and as shown in Fig. 1B and C, a number of REST-positive medulloblastoma cell lines were poorly differentiated (23, 24). Work from other groups has shown the involvement of HDAC (HDACs1/2) associated with the amino and carboxy-terminal repression domains of REST for its repression of neuronal genes (19, 21, 25, 36, 37). We therefore asked whether inhibition of HDAC activity would attenuate REST-mediated blockade of neuronal differentiation. We tested a panel of HDAC inhibitors (HDACIs) including benzamides (MS-275), hydroxamic acids (TSA and SAHA/vorinostat), and aliphatics (VPA) with activity against HDACs (Fig 3A), for their ability to upregulate the expression of the REST-target gene, Syn1 in DAOY and D283 cells. IC50 doses of these agents were established in our previously published work and that from other groups (35, 38). Drug activity was first confirmed by Western blotting measurement of changes in the acetylation of histone H3 (AcH3) after treatment of DAOY and D283 cells with MS-275, TSA, VPA, and SAHA for various times (Fig. 3B). Syn1 gene expression was then assessed by qRT-PCR analyses and found to be elevated in these cells following HDACI treatment, although the extent of elevation differed between the two cell lines (5- to 80-fold and 4- to 20-fold, respectively; Fig. 3C). Levels of 18s RNA were used for normalization. SAHA caused the largest increase in Syn1 expression (20- to 80-fold and 5- to 20-fold in DAOY and D283 cells, respectively). To further examine the mechanism by which SAHA modulated Syn1 expression, we measured changes in histone acetylation at the REST-binding RE1 element within the Syn1 promoter by ChIP analysis (Fig. 3D). A significant increase in AcH3 at the RE1 element was observed for all 4 HDACIs (Fig. 3D), whereas a statistically significant increase in histone H4 acetylation in this region was seen for VPA and SAHA only. The binding of REST, HDAC1, and HDAC2 at the Syn1 RE1 element in the presence and absence of SAHA treatment was also evaluated by ChIP assays. Because SAHA was found to degrade REST (Fig. 4C), ChIP assays were done after 6 hours of SAHA treatment, a time at which REST levels were not significantly reduced. While REST binding was unaffected by SAHA treatment at 6 hours, HDAC1 and 2 showed partial to complete dissociation from the RE1 element to which REST was also bound (Fig. 3E). These observations suggest that SAHA may facilitate dissolution of the REST/HDAC/DNA complex at this time point.

Figure 3.

HDACIs upregulate Syn1 gene expression. A, structure and specificities of HDACIs used in this study (30). Western blot analysis (B) and qRT-PCR (C) were conducted to measure AcH3 and changes in Syn1 gene expression, respectively, in DAOY and D283 in response to MS-275 (2.5 μmol/L), TSA (300 nmol/L), VPA (2.5 mmol/L), or SAHA (5 μmol/L) treatment for the indicated time periods. Actin was used as a loading control for Western blots. Syn1 expression is reported relative to 18sRNA levels and compared with untreated controls (NT) set to 1. ChIP analyses were conducted to compare changes in acetylation of histones H3 and H4 (D) or REST, HDAC1, and HDAC2 binding to the Syn1 RE1 element in DAOY cells (E) following HDACI treatment. Samples were normalized to input DNA and compared with DNA pulled down by nonimmune sera (IgG). Assays were carried out in triplicate and results reported as mean ± SE. Statistical significance is shown as *, 0.1 > P > 0.05; **, 0.05 ≥ P > 0.01, or ***, P ≤ 0.01.

Figure 3.

HDACIs upregulate Syn1 gene expression. A, structure and specificities of HDACIs used in this study (30). Western blot analysis (B) and qRT-PCR (C) were conducted to measure AcH3 and changes in Syn1 gene expression, respectively, in DAOY and D283 in response to MS-275 (2.5 μmol/L), TSA (300 nmol/L), VPA (2.5 mmol/L), or SAHA (5 μmol/L) treatment for the indicated time periods. Actin was used as a loading control for Western blots. Syn1 expression is reported relative to 18sRNA levels and compared with untreated controls (NT) set to 1. ChIP analyses were conducted to compare changes in acetylation of histones H3 and H4 (D) or REST, HDAC1, and HDAC2 binding to the Syn1 RE1 element in DAOY cells (E) following HDACI treatment. Samples were normalized to input DNA and compared with DNA pulled down by nonimmune sera (IgG). Assays were carried out in triplicate and results reported as mean ± SE. Statistical significance is shown as *, 0.1 > P > 0.05; **, 0.05 ≥ P > 0.01, or ***, P ≤ 0.01.

Close modal
Figure 4.

HDACIs modulate REST gene expression and protein stability. A, qRT-PCR analysis were conducted to measure REST gene expression changes in DAOY and D283 cells in response to HDACI treatment. Normalization and statistical calculations were carried out as described in Fig. 3. B, ChIP analy-ses were done in HDACI-treated DAOY cells to assess changes in acetylation of histones H3 and H4 within a 2-kb region of the REST promoter. Normalization and statistical calculations were carried out as described in Fig. 3. Western blot analysis were done to measure REST levels in DAOY cells treated with various HDACIs (C), with SAHA (5 μmol/L) in the presence or absence of CHX (10 mg/mL) for 0–120 minutes (D) and with SAHA (5 μmol/L) in the presence or absence of MG132 (20 μmol/L) for 4 hours (E). Actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as loading control.

Figure 4.

HDACIs modulate REST gene expression and protein stability. A, qRT-PCR analysis were conducted to measure REST gene expression changes in DAOY and D283 cells in response to HDACI treatment. Normalization and statistical calculations were carried out as described in Fig. 3. B, ChIP analy-ses were done in HDACI-treated DAOY cells to assess changes in acetylation of histones H3 and H4 within a 2-kb region of the REST promoter. Normalization and statistical calculations were carried out as described in Fig. 3. Western blot analysis were done to measure REST levels in DAOY cells treated with various HDACIs (C), with SAHA (5 μmol/L) in the presence or absence of CHX (10 mg/mL) for 0–120 minutes (D) and with SAHA (5 μmol/L) in the presence or absence of MG132 (20 μmol/L) for 4 hours (E). Actin or glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as loading control.

Close modal

HDACIs modulate REST transcription and protein levels

The effects of HDACIs on REST gene expression and protein levels were also studied to ensure that the observed changes in Syn1 expression stemmed from HDAC targeting and not from changes in REST gene or protein levels. Interestingly, qRT-PCR analyses revealed that MS-275 caused a small (1.5-fold) increase in REST transcription, whereas TSA and VPA promoted a larger increase in REST gene expression (1.5- to 8-fold) in DAOY cells (Fig. 4A, left). A similar change was not seen in D283 cells at most of the time points tested (Fig. 4A, right). However, SAHA caused a small (2-fold) increase in REST transcript in D283 cells at 24 hours posttreatment (Fig. 4A, right). Further confirmation of these findings was obtained by ChIP assays using anti-histone H3/H4 antibodies and control IgG and primers specific to various regions of the REST promoter (−0.5 kb to −2.0 kb). As seen in Fig. 4B (left), a significant increase in AcH3 was observed, around −0.5 kb, −1.0 kb, and −1.5 kb of the REST promoter 24 hours after treatment with MS-275 and TSA but not VPA. However, VPA promoted a change in AcH3 in these regions at 6 and 12 hours posttreatment with HDACIs (data not shown). Acetylation of histone H3 at the −2.0 kb region was seen only in response to MS-275. ChIP assays also revealed a significant increase in the acetylation of histone H4 at the REST promoter after treatment with MS-275 and TSA but not with VPA (Fig. 4B, right). Together, these results indicate that the increase in REST transcription upon treatment with MS-275 and TSA was likely caused by chromatin remodeling at the cognate promoter.

Because MS-275 and SAHA caused the least transcriptional upregulation of REST, further studies were carried out with these agents. Western blotting showed that REST protein levels in MS-275–treated DAOY and D283 cells paralleled the small fluctuations in its transcript levels (Fig. 4C). Importantly, because Syn1 expression was upregulated even at time points when REST levels were elevated in MS-275 (24 hours)- and SAHA (6 hours)-treated cells, it suggested that inhibition of HDAC activity (presumably REST-associated) contributed to Syn1 upregulation (Fig. 4A and C). However, SAHA also caused an unexpected decrease in REST protein levels in both cell lines (after 6 hours), suggesting that the loss of REST itself may contribute to the increase in Syn1 expression at longer time points of SAHA exposure (Fig. 4C).

Because SAHA did not affect REST transcription significantly, we asked whether the SAHA-dependent decline in REST protein levels occurred through posttranscriptional mechanisms. We blocked translation of newly synthesized mRNA using cycloheximide (CHX) for 0 to 120 minutes and examined the effect of SAHA on preexisting REST protein levels by Western blotting. As expected, in the absence of CHX, SAHA did not cause a substantial change in REST protein levels within 120 minutes (Fig. 4D). However, in the presence of CHX, SAHA caused a rapid decline in REST protein levels (Fig. 4D). These results confirmed that SAHA-dependent decline in REST protein levels occurred through posttranscriptional mechanisms. REST protein levels are known to be modulated by its proteasomal degradation (39, 40). We therefore examined the contribution of the proteasomal machinery to the SAHA-dependent decrease in REST protein levels by blocking proteasomal activity using MG132. As seen in Fig. 4E, MG132 treatment for 4 hours caused an accumulation of REST, which was accentuated by coincubation with SAHA. As expected, treatment with SAHA alone caused only a very modest decrease in REST protein levels within the 4-hour window of the assay.

Ectopic REST expression causes resistance to SAHA-dependent decrease in cell growth

We and others previously showed that REST loss blocked the growth of medulloblastoma cell lines in vitro and in vivo (23, 24). The effect of SAHA-dependent decline in REST levels on cell growth was monitored by MTT assays. To determine if this decrease in cell growth was through an effect on REST, we generated stable cells (DAOY-REST) that constitutively expressed hemagglutinin (HA)-tagged REST transgene (27). Transgene expression was confirmed by qRT-PCR and Western blotting (Fig. 5A and B). DAOY and DAOY-REST cells were treated with graded doses of SAHA and cell-growth relative to untreated controls was measured. As shown in Fig. 5C (left), constitutive REST transgene expression in DAOY-REST cells caused a significant blockade to SAHA-mediated decline in cell growth seen with DAOY cells at comparable SAHA doses. This effect was seen at all doses tested (except 20 μmol/L). To further validate this observation, we compared the response of NSC-M with that of isogenic cells NSC-MR cells constitutively expressing hREST transgene. We had previously shown that constitutive REST expression facilitated tumor formation by NSC-MR in the murine cerebellum, whereas NSC-M cells were nontumorigenic (24). In this study, we observed that elevated hREST expression also caused a significant impediment to SAHA-dependent decline in NSC-MR cell growth compared with that in NSC-M cells (Fig. 5C, right). This correlated with a lack of Syn1 upregulation in NSC-MR cells after SAHA treatment. In contrast, the decline in cell growth in NSC-M cells, following SAHA exposure, was accompanied by a significant increase in Syn1 expression (Supplementary Fig. S1). Collectively, these results suggest that the decline in cell growth and the induction of differentiation in response to SAHA occurs at least in part through an effect on REST protein.

Figure 5.

Ectopic REST expression counters SAHA-dependent decline in cell growth. DAOY cells stably expressing HA-tagged human REST transgene under the control of the NeuroD2 (ND2) promoter (DAOY-REST) were generated by G418 selection. Transgene expression was confirmed by qRT-PCR analyses using transgene-specific primers specific (A) and Western blot analysis using antibodies against REST or the epitope-tag (B). Actin was used as a loading control. C, MTT assays were conducted to compare cell growth in DAOY and DAOY-REST cells (left) or NSC-M and NSC-MR cells (right) following treatment with various doses of SAHA for 48 hours. Assays were done at least 4 times and plotted relative to untreated controls. Normalization and statistical calculations were done as previously stated (35).

Figure 5.

Ectopic REST expression counters SAHA-dependent decline in cell growth. DAOY cells stably expressing HA-tagged human REST transgene under the control of the NeuroD2 (ND2) promoter (DAOY-REST) were generated by G418 selection. Transgene expression was confirmed by qRT-PCR analyses using transgene-specific primers specific (A) and Western blot analysis using antibodies against REST or the epitope-tag (B). Actin was used as a loading control. C, MTT assays were conducted to compare cell growth in DAOY and DAOY-REST cells (left) or NSC-M and NSC-MR cells (right) following treatment with various doses of SAHA for 48 hours. Assays were done at least 4 times and plotted relative to untreated controls. Normalization and statistical calculations were done as previously stated (35).

Close modal

Medulloblastomas are poorly differentiated cerebellar tumors in which expression of the repressor of neuronal differentiation, REST, is often elevated (23, 24, 41). REST elevation in tumor samples and cell lines was recapitulated in this study and correlated with a block in neuronal differentiation in tumor cell lines (23, 24, 41). However, the prognostic significance of REST levels in medulloblastomas or its pharmacologic manipulation for potential therapeutic intervention had not been investigated before this study.

The initial analysis of our data set with respect to previously known parameters such as age, resection, and metastasis were consistent with what has been previously documented in the literature (2). Clinically, histology is also an important prognostic factor, as patients with anaplastic histology have an inferior outcome compared with patients with desmoplastic and classic histology (42, 43). Interestingly, while our analyses revealed REST levels to be increased in all histologic subtypes of medulloblastoma, there was an interesting and unexpected trend wherein 3 of the 7 patients with desmoplastic tumors, which exhibited high REST protein (++++) staining, also had the worst outcome. While the reason for this finding is not clear, a potential explanation could be that the recognition and diagnosis of desmoplastic histology has evolved and improved over the last few years and may have varied during the 10-year period over which the patient data were collected. A larger data set and reevaluation of tumors based on their gene expression profiling may provide a more accurate statistical understanding of the relationship between survival and tumor type (11–15). As we have shown for the first time in this study, high-REST levels conferred poor OS as well as EFS. The basis for this inferior survival outcome, although not evident in our analysis, may be because of the tendency for metastatic disease in patients with high-REST levels in their tumors (44). Interestingly, REST expression in our tumor samples was often focal and required staining of tumor sections larger than that used in the tissue microarrays. Although REST is a transcription factor and its nuclear localization is well accepted, we found cytoplasmic REST staining in several of our tumor samples. The significance of this unexpected staining pattern remains to be determined.

The overall poor prognosis associated with elevated REST levels led us to investigate whether REST activity could be modulated in in vitro experiments for future preclinical and clinical applications in patients with REST-expressing tumors. Previous work from other groups has shown the involvement of HDACs1/2 in REST-dependent repression of neuronal differentiation genes, suggesting that HDACIs may have therapeutic applications for REST-positive tumors (19, 21, 25, 36, 37). Clinically, HDACIs are not only associated with a more tolerable side-effect profile than traditional cytotoxic chemotherapy, but they have also shown potential as effective treatment strategies in pediatric brain tumors (45). A number of clinically relevant inhibitors of HDACs such as MS-275, VPA, and SAHA are available and have been studied in the context of medulloblastoma cell lines, but not specifically for REST-positive tumors (35, 38, 46, 47).

The HDACIs we studied upregulated the expression of the REST-target gene Syn1, presumably through inhibition of REST activity. Interestingly, MB1110 had high levels of baseline Syn1 expression although REST was expressed in these cells. In this case, other components of the REST repression complex may have aberrant expression or activity, a possibility that remains to be investigated. Some of the HDACIs we tested also caused an unexpected increase in REST gene expression. This effect was particularly significant with TSA and VPA, whereas a more modest increase was seen with MS-275. The regions within the REST promoter, where histone acetylation and chromatin remodeling was detected upon HDACI treatment, also house retinoic acid receptor element (RARE) elements (−0.5 −1.0, −1.2, −1.5, and −2.0 kb from transcription start). Previous studies have implicated these elements in the regulation of REST transcription during differentiation of normal neural stem/progenitor cells (48). The induction of Syn1 expression despite REST upregulation by TSA, VPA, and MS-275 suggests attenuation of REST activity by these agents.

In contrast, SAHA predominantly influenced REST stability. The reason for these variable effects of HDACIs on REST biology may be because of their different specificities for HDACIs or alternatively effects on nonhistone proteins that are yet to be discovered (32). The abrogation of SAHA-dependent REST degradation in response to proteasomal inhibition led us to investigate the contribution of known regulators of REST protein stability to its decline in SAHA-treated cells. The E-3 ligase β-TRCP and the deubiquitylase USP7/HAUSP play opposing and balancing roles in controlling REST stability in neural progenitors and tumors (34, 39, 40, 49). Aberrations in β-TRCP biology levels, or its ability to interact with REST contributes to chemoresistance in the neural tumor, neuroblastoma (34, 40). In our studies, the levels of β-TRCP were transiently upregulated in response to SAHA treatment, whereas that of HAUSP remained unaffected in DAOY cells (data not shown). Whether these transient changes are sufficient to perturb the balance between REST ubiquitination and its degradation or its deubiquitination and stabilization remains to be evaluated. HDACIs are also known to modulate expression of the proteasomal beta subunits (50), which could also be a potential mechanistic explanation for SAHA-induced REST degradation. High-throughput genomic, epigenomic, and proteomic screens may also provide an alternative approach to uncovering molecular mechanisms underlying the differential effects of HDACIs on REST.

In summary, the current study has identified increased REST levels to be a poor prognostic indicator for patients with medulloblastoma. We have also identified MS-275 and SAHA as HDACIs with potential therapeutic relevance for medulloblastomas. This remains to be determined in more detailed studies in mouse orthotopic models. SAHA has been evaluated in phase I clinical trials for pediatric patients and is currently being used as part of the upfront strategy treating infants with medulloblastoma in a Pediatric Brain Tumor Consortium (PBTC) study-026. Similar studies with MS-275 have not been initiated in pediatric patients with cancer. Our results may provide the impetus for stratifying patients based on their REST levels in clinical trials involving SAHA or MS-275 and may help better prognosticate patient outcome based on a specific biologic abnormality.

No potential conflicts of interest were disclosed.

Conception and design: P. Taylor, J. Fangusaro, V. Gopalakrishnan

Development of methodology: P. Taylor, J. Fangusaro, V. Gopalakrishnan

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): P. Taylor, J. Fangusaro, V. Rajaram, M. Hasselblatt, L. Riedemann, A. Laureano, V. Gopalakrishnan

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): P. Taylor, J. Fangusaro, I.B. Helenowski, V. Gopalakrishnan

Writing, review, and/or revision of the manuscript: P. Taylor, J. Fangusaro, S. Goldman, T. MacDonald, M. Hasselblatt, L. Riedemann, L.J.N. Cooper, V. Gopalakrishnan

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): J. Fangusaro, V. Rajaram, L. Riedemann, A. Laureano, V. Gopalakrishnan

Study supervision: J. Fangusaro, V. Gopalakrishnan

The authors thank Dr. Joya Chandra for insightful comments, Donna Kersey for her assistance with the IHC analyses of medulloblastoma, and Drs. James Olson and James Silber for providing primary medulloblastoma cell cultures.

This work was supported by American Cancer Society Research Scholar Grant 118165-RSG-09-273-01-DDC (V. Gopalakrishnan), Matthew Larson Pediatric Brain Tumor Foundation (V. Gopalakrishnan and J. Fangusaro), NIH/National Institute of Neurological Disorders, Stroke 1R03NS077021 (V. Gopalakrishnan), and The Rolf-Dierichs-Foundation (M. Hasselblatt and L. Riedemann).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Fangusaro
J
,
Chi
S
. 
Introduction to a special issue on pediatric neuro-oncology
.
J Child Neurol
2009
;
24
:
1341
2
.
2.
Dhall
G
. 
Medulloblastoma
.
J Child Neurol
2009
;
24
:
1418
30
.
3.
Castellino
RC
,
De Bortoli
M
,
Lu
X
,
Moon
SH
,
Nguyen
TA
,
Shepard
MA
, et al
Medulloblastomas overexpress the p53-inactivating oncogene WIP1/PPM1D
.
J Neurooncol
2008
;
86
:
245
56
.
4.
Crawford
JR
,
MacDonald
TJ
,
Packer
RJ
. 
Medulloblastoma in childhood: new biological advances
.
Lancet Neurol
2007
;
6
:
1073
85
.
5.
Eberhart
CG
,
Kratz
J
,
Wang
Y
,
Summers
K
,
Stearns
D
,
Cohen
K
, et al
Histopathological and molecular prognostic markers in medulloblastoma: c-myc, N-myc, TrkC, and anaplasia
.
J Neuropathol Exp Neurol
2004
;
63
:
441
9
.
6.
Suliman
BA
,
Xu
D
,
Williams
BR
. 
HDACi: molecular mechanisms and therapeutic implications in the innate immune system
.
Immunol Cell Biol
2012
;
90
:
23
32
.
7.
Jakacki
RI
. 
Treatment strategies for high-risk medulloblastoma and supratentorial primitive neuroectodermal tumors. Review of the literature
.
J Neurosurg
2005
;
102
:
44
52
.
8.
Packer
RJ
,
Gajjar
A
,
Vezina
G
,
Rorke-Adams
L
,
Burger
PC
,
Robertson
PL
, et al
Phase III study of craniospinal radiation therapy followed by adjuvant chemotherapy for newly diagnosed average-risk medulloblastoma
.
J Clin Oncol
2006
;
24
:
4202
8
.
9.
Bakst
RL
,
Dunkel
IJ
,
Gilheeney
S
,
Khakoo
Y
,
Becher
O
,
Souweidane
MM
, et al
Reirradiation for recurrent medulloblastoma
.
Cancer
2011
;
117
:
4977
82
.
10.
Gajjar
A
,
Pizer
B
. 
Role of high-dose chemotherapy for recurrent medulloblastoma and other CNS primitive neuroectodermal tumors
.
Pediatr Blood Cancer
2010
;
54
:
649
51
.
11.
Gilbertson
RJ
. 
Finding the perfect partner for medulloblastoma prognostication
.
J Clin Oncol
2011
;
29
:
3841
2
.
12.
Kool
M
,
Koster
J
,
Bunt
J
,
Hasselt
NE
,
Lakeman
A
,
van Sluis
P
, et al
Integrated genomics identifies five medulloblastoma subtypes with distinct genetic profiles, pathway signatures and clinicopathological features
.
PLoS One
2008
;
3
:
e3088
.
13.
Northcott
PA
,
Korshunov
A
,
Witt
H
,
Hielscher
T
,
Eberhart
CG
,
Mack
S
, et al
Medulloblastoma comprises four distinct molecular variants
.
J Clin Oncol
2011
;
29
:
1408
14
.
14.
Pfister
S
,
Remke
M
,
Benner
A
,
Mendrzyk
F
,
Toedt
G
,
Felsberg
J
, et al
Outcome prediction in pediatric medulloblastoma based on DNA copy-number aberrations of chromosomes 6q and 17q and the MYC and MYCN loci
.
J Clin Oncol
2009
;
27
:
1627
36
.
15.
Schwalbe
EC
,
Lindsey
JC
,
Straughton
D
,
Hogg
TL
,
Cole
M
,
Megahed
H
, et al
Rapid diagnosis of medulloblastoma molecular subgroups
.
Clin Cancer Res
2011
;
17
:
1883
94
.
16.
Carlotti
CG
 Jr
,
Smith
C
,
Rutka
JT
. 
The molecular genetics of medulloblastoma: an assessment of new therapeutic targets
.
Neurosurg Rev
2008
;
31
:
359
68
;
discussion 368–9
.
17.
de Bont
JM
,
Packer
RJ
,
Michiels
EM
,
den Boer
ML
,
Pieters
R
. 
Biological background of pediatric medulloblastoma and ependymoma: a review from a translational research perspective
.
Neuro Oncol
2008
;
10
:
1040
60
.
18.
Guessous
F
,
Li
Y
,
Abounader
R
. 
Signaling pathways in medulloblastoma
.
J Cell Physiol
2008
;
217
:
577
83
.
19.
Chong
JA
,
Tapia-Ramirez
J
,
Kim
S
,
Toledo-Aral
JJ
,
Zheng
Y
,
Boutros
MC
, et al
REST: a mammalian silencer protein that restricts sodium channel gene expression to neurons
.
Cell
1995
;
80
:
949
57
.
20.
Lonnerberg
P
,
Schoenherr
CJ
,
Anderson
DJ
,
Ibanez
CF
. 
Cell type-specific regulation of choline acetyltransferase gene expression. Role of the neuron-restrictive silencer element and cholinergic-specific enhancer sequences
.
J Biol Chem
1996
;
271
:
33358
65
.
21.
Schoenherr
CJ
,
Anderson
DJ
. 
The neuron-restrictive silencer factor (NRSF): a coordinate repressor of multiple neuron-specific genes
.
Science
1995
;
267
:
1360
3
.
22.
Schoenherr
CJ
,
Paquette
AJ
,
Anderson
DJ
. 
Identification of potential target genes for the neuron-restrictive silencer factor
.
Proc Natl Acad Sci U S A
1996
;
93
:
9881
6
.
23.
Lawinger
P
,
Venugopal
R
,
Guo
ZS
,
Immaneni
A
,
Sengupta
D
,
Lu
W
, et al
The neuronal repressor REST/NRSF is an essential regulator in medulloblastoma cells
.
Nat Med
2000
;
6
:
826
31
.
24.
Su
X
,
Gopalakrishnan
V
,
Stearns
D
,
Aldape
K
,
Lang
FF
,
Fuller
G
, et al
Abnormal expression of REST/NRSF and Myc in neural stem/progenitor cells causes cerebellar tumors by blocking neuronal differentiation
.
Mol Cell Biol
2006
;
26
:
1666
78
.
25.
Battaglioli
E
,
Andres
ME
,
Rose
DW
,
Chenoweth
JG
,
Rosenfeld
MG
,
Anderson
ME
, et al
REST repression of neuronal genes requires components of the hSWI.SNF complex
.
J Biol Chem
2002
;
277
:
41038
45
.
26.
Ferreira
A
,
Rapoport
M
. 
The synapsins: beyond the regulation of neurotransmitter release
.
Cell Mol Life Sci
2002
;
59
:
589
95
.
27.
Hallahan
AR
,
Pritchard
JI
,
Hansen
S
,
Benson
M
,
Stoeck
J
,
Hatton
BA
, et al
The SmoA1 mouse model reveals that notch signaling is critical for the growth and survival of sonic hedgehog-induced medulloblastomas
.
Cancer Res
2004
;
64
:
7794
800
.
29.
Bradner
JE
,
West
N
,
Grachan
ML
,
Greenberg
EF
,
Haggarty
SJ
,
Warnow
T
, et al
Chemical phylogenetics of histone deacetylases
.
Nat Chem Biol
2010
;
6
:
238
43
.
30.
Marks
PA
,
Breslow
R
. 
Dimethyl sulfoxide to vorinostat: development of this histone deacetylase inhibitor as an anticancer drug
.
Nat Biotechnol
2007
;
25
:
84
90
.
31.
Rikiishi
H
. 
Autophagic and apoptotic effects of HDAC inhibitors on cancer cells
.
J Biomed Biotechnol
2011
;
2011:830260
.
32.
Xu
WS
,
Parmigiani
RB
,
Marks
PA
. 
Histone deacetylase inhibitors: molecular mechanisms of action
.
Oncogene
2007
;
26
:
5541
52
.
33.
Das
CM
,
Zage
PE
,
Taylor
P
,
Aguilera
D
,
Wolff
JE
,
Lee
D
, et al
Chromatin remodelling at the topoisomerase II-beta promoter is associated with enhanced sensitivity to etoposide in human neuroblastoma cell lines
.
Eur J Cancer
2010
;
46
:
2771
80
.
34.
Singh
A
,
Rokes
C
,
Gireud
M
,
Fletcher
S
,
Baumgartner
J
,
Fuller
G
, et al
Retinoic acid induces REST degradation and neuronal differentiation by modulating the expression of SCF(beta-TRCP) in neuroblastoma cells
.
Cancer
2011
;
117
:
5189
202
.
35.
Aguilera
DG
,
Das
CM
,
Sinnappah-Kang
ND
,
Joyce
C
,
Taylor
PH
,
Wen
S
, et al
Reactivation of death receptor 4 (DR4) expression sensitizes medulloblastoma cell lines to TRAIL
.
J Neurooncol
2009
;
93
:
303
18
.
36.
Gopalakrishnan
V
. 
REST and the RESTless: in stem cells and beyond
.
Future Neurol
2009
;
4
:
317
29
.
37.
Ooi
L
,
Wood
IC
. 
Chromatin crosstalk in development and disease: lessons from REST
.
Nat Rev Genet
2007
;
8
:
544
54
.
38.
Furchert
SE
,
Lanvers-Kaminsky
C
,
Juurgens
H
,
Jung
M
,
Loidl
A
,
Fruhwald
MC
. 
Inhibitors of histone deacetylases as potential therapeutic tools for high-risk embryonal tumors of the nervous system of childhood
.
Int J Cancer
2007
;
120
:
1787
94
.
39.
Huang
Z
,
Wu
Q
,
Guryanova
OA
,
Cheng
L
,
Shou
W
,
Rich
JN
, et al
Deubiquitylase HAUSP stabilizes REST and promotes maintenance of neural progenitor cells
.
Nat Cell Biol
2011
;
13
:
142
52
.
40.
Westbrook
TF
,
Hu
G
,
Ang
XL
,
Mulligan
P
,
Pavlova
NN
,
Liang
A
, et al
SCFbeta-TRCP controls oncogenic transformation and neural differentiation through REST degradation
.
Nature
2008
;
452
:
370
4
.
41.
Weis
DC
,
Visco
DP
 Jr
,
Faulon
JL
. 
Data mining PubChem using a support vector machine with the Signature molecular descriptor: classification of factor XIa inhibitors
.
J Mol Graph Model
2008
;
27
:
466
75
.
42.
Holthouse
DJ
,
Dallas
PB
,
Ford
J
,
Fabian
V
,
Murch
AR
,
Watson
M
, et al
Classic and desmoplastic medulloblastoma: complete case reports and characterizations of two new cell lines
.
Neuropathology
2009
;
29
:
398
409
.
43.
Leary
SE
,
Zhou
T
,
Holmes
E
,
Geyer
JR
,
Miller
DC
. 
Histology predicts a favorable outcome in young children with desmoplastic medulloblastoma: a report from the children's oncology group
.
Cancer
2011
;
117
:
3262
7
.
44.
Wu
X
,
Northcott
PA
,
Dubuc
A
,
Dupuy
AJ
,
Shih
DJ
,
Witt
H
, et al
Clonal selection drives genetic divergence of metastatic medulloblastoma
.
Nature
2012
;
482
:
529
33
.
45.
Spiller
SE
,
Ravanpay
AC
,
Hahn
AW
,
Olson
JM
. 
Suberoylanilide hydroxamic acid is effective in preclinical studies of medulloblastoma
.
J Neurooncol
2006
;
79
:
259
70
.
46.
Hacker
S
,
Dittrich
A
,
Mohr
A
,
Schweitzer
T
,
Rutkowski
S
,
Krauss
J
, et al
Histone deacetylase inhibitors cooperate with IFN-gamma to restore caspase-8 expression and overcome TRAIL resistance in cancers with silencing of caspase-8
.
Oncogene
2009
;
28
:
3097
110
.
47.
Sonnemann
J
,
Kumar
KS
,
Heesch
S
,
Muller
C
,
Hartwig
C
,
Maass
M
, et al
Histone deacetylase inhibitors induce cell death and enhance the susceptibility to ionizing radiation, etoposide, and TRAIL in medulloblastoma cells
.
Int J Oncol
2006
;
28
:
755
66
.
48.
Ballas
N
,
Grunseich
C
,
Lu
DD
,
Speh
JC
,
Mandel
G
. 
REST and its corepressors mediate plasticity of neuronal gene chromatin throughout neurogenesis
.
Cell
2005
;
121
:
645
57
.
49.
Frescas
D
,
Pagano
M
. 
Deregulated proteolysis by the F-box proteins SKP2 and beta-TrCP: tipping the scales of cancer
.
Nat Rev Cancer
2008
;
8
:
438
49
.
50.
Miller
CP
,
Singh
MM
,
Rivera-Del Valle
N
,
Manton
CA
,
Chandra
J
. 
Therapeutic strategies to enhance the anticancer efficacy of histone deacetylase inhibitors
.
J Biomed Biotechnol
2011
;
2011:514261
.