Triggering Fbw7-Mediated Proteasomal Degradation of c-Myc by Oridonin Induces Cell Growth Inhibition and Apoptosis

The protein c-Myc is a helix-loop-helix leucine zipper transcription factor that plays essential roles in cell growth, proliferation, and apoptosis. Several lines of evidence support the role of c-Myc as a central transcriptional hub, including (i) previous reports that approximately 15% of the genes in the human genome are regulated by c-Myc (1), (ii) demonstrations that 48 transcription factors are direct targets of c-Myc in a model of human B lymphoid tumor (2), and (iii) the finding that c-Myc transcriptionally regulates the expression of miRNAs (3, 4), a family of regulatory small RNAs that functions by targeting protein-coding genes (5). Given its importance, c-Myc is tightly regulated at different biologic levels, including F-box and WD repeat domain–containing 7 (Fbw7)-mediated posttranslational regulation (6, 7). However, the deregulation of c-Myc has been observed in a wide range of human cancers, particularly leukemias and lymphomas, due to gene amplification, translocation, transactivation, or increased protein stability. Deregulated c-Myc increases genomic instability, blocks differentiation, and is able to induce lymphoid and myeloid neoplasia, making it an attractive target for cancer treatment (8–10).

Various strategies aimed at targeting c-Myc for cancer treatment are under investigation, including the use of antisense oligonucleotides, siRNAs, small molecules, and natural compounds (8, 10–12). Among these approaches, natural compounds have received particular attention in recent years due to their potent anticancer activities and relative safety. For example, it was recently shown that ascofuranone and curcumin, both as natural compounds, target c-Myc and exhibit anticancer activities (11, 12). However, the mechanisms by which natural compounds target c-Myc still need to be investigated.

Oridonin is a natural diterpenoid compound (Fig. 1A) that can be isolated from the Chinese medicinal herb Rabdosia rubescens and other plants in the genus Isodon, which are traditionally used in China and Japan for the treatment of various human diseases (13, 14). Oridonin exhibits proapoptotic activity against a variety of cancer cells, including those of hematologic malignancies, and shows no obvious side effects in murine models (15, 16). Although several proteins, including caspase-3, extracellular signal—regulated kinase (ERK), p53, Bax/Bcl-xL, AML-ETO, and NF-κB, have been found to be involved in the anticancer activity of oridonin (16–19), the underlying mechanisms remain largely unknown, and further mechanistic studies are needed to provide evidence supporting the use of oridonin as a drug for cancer treatment.

To gain a deeper understanding of the molecular action of oridonin, we profiled miRNA expression in K562 cells in the absence or presence of oridonin and scored transcription factors reported to regulate the differentially expressed miRNAs, finally confirming that one of the miRNA regulators, c-Myc, was a molecular target of oridonin in vitro and in vivo. This observation is supported by a previous report that oridonin treatment decreased c-Myc expression in K562 cells (20). We then explored the mechanism by which oridonin targets c-Myc and revealed that oridonin activates the E3 ubiquitin ligase Fbw7 and the GSK-3 kinase, which accelerates the ubiquitin-proteasome–dependent degradation of c-Myc and results in the apoptosis of K562 cells and a delay of tumor growth in a K562 xenograft model. Our findings provide molecular evidence supporting the use of oridonin as an effective Fbw7 activator, and therefore, a c-Myc targeting agent, in the treatment of c-Myc–overexpressing hematologic malignancies or other cancers.

Oridonin (Kangrun Pharmaceutical), MG-132 (Calbiochem), and cycloheximide (Beyotime) were dissolved in dimethyl sulfoxide (DMSO) to make stock solutions and freshly used at concentrations of 20 μmol/L, 10 μmol/L, and 50 μg/mL, respectively, unless otherwise specified. The final concentrations of DMSO were kept below 0.1% in all cell cultures.

The K562 and HL-60 cell lines were kindly provided by Dr. Shi-Mei Zhuang (Sun Yat-sen University, Guangdong, PR China). The B16BL6 cell line was purchased from KeyGen Biotech. Other cell lines were obtained from the cell bank of Chinese Academy of Sciences (Shanghai, China). The K562 cell line was authenticated on the basis of BCR-ABL expression and sequencing within the past 12 months, whereas other cell lines were not authenticated by the authors. All transient transfections of plasmids and siRNAs were carried out with the Neon Transfection System (Life Technologies). All siRNAs were purchased from GenePharma and transfected at a final concentration of 50 nmol/L. Sequences for siRNAs are as follows:

• si-Myc: 5′-CGAUGUUGUUUCUGUGGAA-(dT)₂-3′,

• si-Fbw7: 5′-ACAGGACAGUGUUUACAAA-(dT)₂-3′,

• si-GSK-3: 5′-AUCUUUGGAGCCACUGAUU-(dT)₂-3′

• Negative control: 5′-UUCUCCGAACGUGUCACGU-(dT)₂-3′.

Cells were cultured in 96-well cell culture plates and treated the next day as indicated. Cell viability was evaluated with MTT assays (Promega).

Cell proliferation was assessed with soft agar assays. Briefly, 2,000 cells from different treatments were mixed with a 0.35% gel (Sigma) and seeded over a 0.6% bottom gel. The colonies that contained more than 50 cells were counted and photographed under a DM LB2 microscope (Leica) 7 days later.

Apoptosis was analyzed with a FACSCalibur flow cytometer (BD Biosciences) immediately after cells were fluorescein isothiocyanate (FITC)-Annexin V/propidium iodide (PI) double-stained. The data were analyzed by FlowJo software (TreeStar).

The miRNA expression array including 235 human-specific miRNA probes and 8 control probes were generated as previously described (21). A 22-nucleotide (nt) oligonucleotide with a sequence complementary to a spotted control was added to the small RNA (12–28 nt) sample as a reference for normalization. The gel-purified small RNAs were dephosphorylated, radiolabeled, and hybridized to membranes. Signals were visualized with a Typhoon 8600 imager (GE Healthcare) and quantified by ImageMaster TotalLab V2.00 (GE Healthcare).

Northern blot detection of mature miRNAs and pre-miRNAs was conducted according to the Bartel laboratory protocol (http://web.wi.mit.edu/bartel/pub/protocols.html).

For semiquantitative real-time PCR (RT-PCR), 2 μg of total RNA was used for cDNA synthesis. For quantitative RT-PCR, a SYBR RT-PCR kit (TaKaRa) was used. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as an internal control. The data were analyzed by StepOne software (Applied Biosystems). PCR primers are listed in Supplementary Table S1.

Cells were lysed as described (22). Equal amounts of proteins were loaded and separated by SDS-PAGE, transferred to polyvinylidene fluoride membranes, and detected by immunoblotting with the SuperECL Plus Detection Reagent (Applygen) or the ECL Advance Detection Kit (GE Healthcare). GAPDH was used as a loading control. See Supplementary Table S2 for information about the antibodies used.

Cells were lysed with immunoprecipitated lysis buffer (Beyotime) at 6 × 10⁶ cells/mL for control samples and 1.2 × 10⁷ cells/mL for oridonin-treated samples. Proteins were immunoprecipitated from equal volumes of cell lysates with anti-c-Myc antibody or rabbit IgG (Millipore) as a control and precipitated with Protein G Magnetic Beads (Millipore), then washed twice with lysis buffer, and subjected to Western blot analysis. All buffers contained leupeptin, phenylmethylsulfonylfluoride, and N-ethylmaleimide (Sigma).

The cDNAs of FLAG-tagged Fbw7α, Fbw7β, Fbw7γ, and wild-type c-Myc were PCR-amplified from K562 cells and cloned into the pcDNA3 vector. For construction of the c-Myc-T58A/S62A mutation plasmid, the Multipoints Mutagenesis Kit (TaKaRa) was used. Primer sequences are as follows:

• Fbw7α-F: attaagcttgccaccatggattacaaggacgacgatgacaagatgaatcaggaactgctctctg,

• Fbw7β-F: attaagcttgccaccatggattacaaggacgacgatgacaagatgtgtgtcccgagaagcg,

• Fbw7γ-F: attaagcttgccaccatggattacaaggacgacgatgacaagatgtcaaaaccgggaaaacc,

• Fbw7-R: gacgaattc tcacttcatgtccacatcaaagtc,

• c-Myc-F: gggaattcctggatttttttcgggtagtgg,

• c-Myc-R: tttctcgagttacgcacaagagttccgtagct,

• c-Myc-T58A/S62A: gctgcccgctccgcccctggcacctagccgccgctc.

All procedures for the experiments on mice were approved by the Animal Care and Use Committee of Sun Yat-sen University. Each 6-week-old nonobese severe-combined immunodeficient (NOD/SCID) mouse (Sun Yat-sen University) was subcutaneously injected with 6.75 × 10⁶ K562 cells. When the tumors reached a volume of 150 to 300 mm³, the mice were randomized into 2 groups (6 mice per group) and treated intraperitoneally with oridonin (15 mg/kg) or vehicle (2% DMSO) everyday for 12 consecutive days. The tumor volumes (length × width² × 0.5236) were measured and the body weights were monitored. All mice were euthanized 1 day after the last treatment and the tumors were cut into 8-μm sections and assessed for c-Myc expression by immunohistochemistry as previously described (23).

The data shown represent the mean of 3 independent experiments (3 replicates each). The error bars indicate the SD. Statistical differences were assessed by the Student t test. P < 0.05 was considered statistically significant.

We first investigated the in vitro effects of oridonin in K562 cells. Oridonin inhibited cell growth in a concentration- and time-dependent manner, with an IC₅₀ of 14.6 μmol/L after a 24-hour treatment (Fig. 1A). The colony-forming ability of K562 cells in soft agar was also markedly impaired (Fig. 1B), implying a potent antiproliferative activity of oridonin. Increased percentages of Annexin V–positive cells, together with the activation of caspase-3 and caspase-9 (Fig. 1C), indicated a proapoptotic activity of oridonin. To further evaluate the efficacy of oridonin, we conducted xenograft tumor studies. Treatment with oridonin dramatically delayed the tumor growth (Fig. 1D, P < 0.05), whereas the body weight changes showed no apparent difference between the treatment and control groups (data not shown). These results show that oridonin exhibits potent anticancer effects on K562 cells both in vitro and in vivo.

To explore the anticancer mechanisms of oridonin, we generated oligonucleotide DNA arrays for detection of miRNA expression because accumulating evidence suggested that miRNA expression profiling could be used as a tool to understand responses to therapy in human cancers (24, 25). We found that 14 miRNAs were upregulated and 12 miRNAs were downregulated by more than 2-fold upon oridonin treatment, primarily representing the let-7 miRNA family and the miR-17-92 paralogous clusters (including the miR-17-92 cluster, miR-106a-363 cluster, and miR-106b-25 cluster), respectively (Fig. 2A). The expression changes of several representative miRNAs were confirmed by Northern blotting (Supplementary Fig. S1A). Notably, the miRNA precursors (pre-miRNAs) of the members of the miR-17-92 paralogous clusters were also dramatically decreased by oridonin (Fig. 2B), which is suggestive of regulation upstream of pre-miRNA processing, likely at the transcriptional level. Accordingly, we began to search for transcription factors that were affected by oridonin and hence, resulted in the differential expression of the miRNAs mentioned above. As described in the Supplementary Materials and Methods, we scored transcription factors that had been reported to regulate any oridonin-induced differentially expressed miRNA and listed in Supplementary Table S3 the top 12 transcription factors that showed close correlation with oridonin in terms of miRNA regulation. Notably, c-Myc received a negative score with the highest absolute value, suggesting a strong negative regulation of c-Myc activity by oridonin. When the correlation between oridonin activity and the gene expression of these candidate transcription factors in NCI-48 cell lines was examined, c-myc still showed a high positive correlation coefficient, with an r value of 0.390 or a ρ value of 0.378 (Supplementary Table S3). c-Myc protein expression was also positively correlated with oridonin activity in these cell lines with an r value of 0.452 (P < 0.01) or a ρ value of 0.367 (P < 0.05). This significant positive correlation was also experimentally verified in 10 cell lines of leukemia and solid tumor origin (Fig. 2C). Overall, these data suggest that c-Myc is a potential molecular target of oridonin and that the activity of oridonin is highly correlated with c-Myc expression.

To determine the impact of oridonin on c-Myc, K562 cells were treated with oridonin and Western blot analyses were carried out. As shown in Fig. 3A and D, oridonin decreased c-Myc protein levels in a time- and concentration-dependent manner. In addition, K562 xenograft tumors treated with oridonin showed remarkably reduced levels of c-Myc compared with the control group (Fig. 3B). The oridonin-induced reduction of c-Myc resulted in the altered expression of certain miRNA primary transcripts (pri-miRNA; Fig. 3C and Supplementary Fig. S1B), all of which were reported to be transcriptional targets of c-Myc (3, 26). These changes in pri-miRNA levels were similar to but more significant than those caused by c-Myc siRNA (Fig. 3C). Overall, these results show that oridonin targets c-Myc in vitro and in vivo, by reducing c-Myc protein levels and thereby impairing its transcriptional activity.

We next explored the correlation between oridonin potency and the reduction of c-Myc in 4 leukemia and lymphoma cell lines including K562, KU812, HL-60, and Daudi. In all of these cell lines, the cell growth was inhibited by oridonin in a concentration-dependent manner (Fig. 3D). Interestingly, the expression change of c-Myc was almost entirely consistent with the change in cell viability (Fig. 3D), which further shows that the reduction of c-Myc is correlated with the anticancer effects of oridonin and that c-Myc is an important target of oridonin.

Given the importance of c-Myc in diverse cellular processes, we further explored the mechanisms by which c-Myc is regulated. RT-PCR showed that the c-myc mRNA level remained unchanged after oridonin treatment (Fig. 4A), which was also confirmed by qRT-PCR (data not shown) and suggested that oridonin did not affect the transcription or mRNA stability of c-myc. We also conducted dual luciferase assays to rule out the existence of oridonin-responsive elements within the 5′-untranslated region (UTR) or 3′UTR of c-myc that could affect the translation of c-myc mRNA (Supplementary Fig. S2A). Thus, on the basis of the above results, it appears unlikely that oridonin regulates c-Myc by affecting the synthesis of its mRNA or protein.

Previous studies have shown that the c-Myc protein has a very short half-life and is degraded through the ubiquitin-proteasome pathway. In the presence of oridonin, the half-life of c-Myc in K562 cells was further reduced, as observed with cycloheximide chase assays (Fig. 4B), indicating the accelerated degradation of c-Myc protein. We next evaluated the effect of oridonin on c-Myc ubiquitination. Immunoprecipitations were carried out and the results showed that ubiquitinated c-Myc accumulated upon oridonin treatment (Fig. 4C). When we used MG-132 to inhibit the 26S proteasome activity in K562 cells, the oridonin-induced downregulation of c-Myc was significantly antagonized (Fig. 4D). Similar results were observed in KU812, HL-60, and Daudi cells (Supplementary Fig. S2B). We therefore concluded that oridonin downregulated c-Myc by promoting its ubiquitin-proteasome–dependent degradation rather than by decreasing its synthesis.

The process of ubiquitination has been shown to require the consecutive action of an E1 ubiquitin–activating enzyme, an E2 ubiquitin–conjugating enzyme, and an E3 ubiquitin ligase. Of these enzymes, the E3 ligase is considered the most important component, as it confers substrate specificity (27). To determine how oridonin affects the ubiquitination of c-Myc, we examined the protein expression levels of Fbw7, an E3 ubiquitin ligase shown to be responsible for the ubiquitin-mediated degradation of c-Myc (6, 7) and other oncogenes such as cyclin E (28, 29) and mTOR (30). Oridonin treatment significantly increased the expression of Fbw7α and Fbw7γ in a time-dependent manner, which was accompanied by the remarkable downregulation of c-Myc, cyclin E, and mTOR, among which the reduction of c-Myc was the most significant (Fig. 5A and Supplementary Fig. S3A). We also detected the expression of the deubiquitinating enzyme USP28, which could interact with Fbw7α and thereby antagonize the degradation of c-Myc (31). As shown in Fig. 5A, oridonin did not affect the expression of USP28. In addition, we carried out immunoprecipitations to assess the interaction of c-Myc with Fbw7. As expected, c-Myc–associated Fbw7 increased significantly in oridonin-treated cells (Fig. 5A).

To further show the importance of Fbw7 in oridonin-induced c-Myc degradation, we used 2 T-cell acute lymphoblastic leukemia (T-ALL) cell lines, Jurkat, and CCRF-CEM, which harbor an R505C and an R465C missense mutation in Fbw7, respectively (32, 33). When exposed to oridonin, the decrease of c-Myc in these 2 cell lines was less evident than that in K562 (Fig. 5B), implying that the abundance of functional Fbw7 affects the efficiency of oridonin-induced c-Myc degradation. Taken together, our results strongly indicate that oridonin promotes the degradation of c-Myc through the activation of the Fbw7 E3 ligase.

GSK-3 is an Fbw7 priming kinase that phosphorylates most known Fbw7 substrates. It was previously shown that the GSK-3–mediated phosphorylation of c-Myc T58 was needed for the efficient binding of c-Myc by Fbw7 (34, 35). We investigated GSK-3 activity in K562 cells upon oridonin treatment. Phosphorylated/inactive GSK-3 decreased, whereas the total GSK-3 protein levels remained unchanged (Fig. 5C), indicating the activation of GSK-3. Accordingly, T58-phosphorylated c-Myc increased significantly as expected (Fig. 5C). When we transiently inhibited GSK-3 with either siRNA or LiCl (a selective GSK-3 inhibitor), the oridonin-induced degradation of c-Myc was somewhat delayed (Fig. 5D), suggesting a dependence on GSK-3 in this process.

Because oridonin was able to upregulate Fbw7, we evaluated the effects of Fbw7 overexpression in K562 cells. As shown in Fig. 6A, the overexpression of the 3 isoforms of Fbw7 (α, β, and γ) all decreased c-Myc levels, although to different extents. At the cellular level, Fbw7 remarkably inhibited the growth of K562 cells in culture medium and in soft agar (Fig. 6A), and substantially increased the fraction of apoptotic cells as determined by fluorescence-activated cell-sorting (FACS) analysis (Fig. 6B). The anticancer property of Fbw7 was comparable with that of c-Myc silencing (Fig. 6A and B) except for a slighter effect on the anchorage-independent growth in soft agar (Fig. 6A). These results reveal that the forced expression of Fbw7 inhibits growth and induces apoptosis in K562 cells, which could also be achieved by silencing c-Myc expression.

We further investigated the role of the Fbw7-c-Myc pathway in the anticancer activities of oridonin. The knockdown of Fbw7 by siRNA that targeted the common region of Fbw7 resulted in the accumulation of c-Myc and led to the reduced sensitization of cells to oridonin-induced apoptosis, as shown by the presence of fewer apoptotic cells and more viable cells (Fig. 6C). In addition, the overexpression of stable c-Myc that was mutated at both T58 and S62 (both within the Cdc4 phospho-degron) and unable to be ubiquitinated partially conferred resistance to oridonin-induced apoptosis compared with the overexpression of wild-type c-Myc (Fig. 6C). These results strongly suggest the importance of Fbw7 upregulation and c-Myc degradation in the proapoptotic ability of oridonin.

In this study, we explored the mechanism of action of the diterpenoid compound oridonin from a new point of view. We analyzed miRNA expression data in the context of oridonin treatment and determined that a transcriptional regulator of most of the differentially expressed miRNAs, c-Myc, was a molecular target of oridonin. By activating the E3 ubiquitin ligase Fbw7 and the GSK-3 kinase, oridonin induces the rapid turnover of c-Myc and the reprogramming of c-Myc–regulated miRNAs, resulting in growth inhibition and apoptosis. These mechanisms are summarized in Fig. 6D.

Research indicates that c-Myc acts as a double-edged sword in cell fate decisions because it can promote cell growth or induce apoptosis (36, 37). Our results showed that inhibition of c-Myc expression led to severe cell death (Fig. 6B), suggesting that the deregulated c-Myc in leukemia and lymphoma cells was oncogenic rather that tumor-suppressive. Because of its oncogenic properties, c-Myc has been investigated and shown to be an effective target for cancer therapy (8, 10, 38). Because proteins are the executors of cell function, promoting the degradation of the c-Myc protein by oridonin may be more efficient than other strategies aimed at disrupting c-myc expression. A question arose as to whether the oridonin-induced reduction of c-Myc was concomitant with apoptosis or a cause of apoptosis. The latter possibility was validated because the reduction in c-Myc occurred independently of the activation of caspases (Supplementary Fig. S2C), and the oridonin-induced apoptosis could be partially blocked by the forced expression of c-Myc in K562 cells. Thus, as a natural compound, oridonin targets c-Myc and exhibits antiproliferative and proapoptotic activities in c-Myc–overexpressing hematologic malignancies and other cancer cells.

The mechanism underlying the oridonin-induced c-Myc downregulation was still unclear, although the decrease of c-Myc by oridonin was also reported in prior work (20, 39). It was previously shown that treatment of SW1116 colorectal cancer cells with 25 μmol/L oridonin reduced c-myc transcription and protein levels after 24 hours or a longer period of time (39). However, our work showed that oridonin did not affect the mRNA level of c-myc in K562 cells after a 24-hour treatment but dramatically induced the degradation of c-Myc protein as early as 40 minutes. The rapid degradation of c-Myc was also observed in other malignant hematologic cell lines, including KU812, HL-60, and Daudi (Supplementary Fig. S2B). We showed, for the first time, that a ubiquitin-proteasome-dependent pathway was involved in oridonin-induced c-Myc downregulation. There are 2 rate-limiting steps in proteasomal degradation: the specific modification of substrate proteins, such as phosphorylation, and the enzymatic attachment of ubiquitin to substrate proteins (40). In this study, we showed that oridonin acts upon these 2 steps to achieve its most potent effect on c-Myc degradation in K562 cells (Fig. 6D). However, we observed that the transient inhibition of GSK-3 could not fully antagonize the oridonin-induced degradation of c-Myc. This observation may suggest that the activation of GSK-3 was less important than the activation of Fbw7 in oridonin-induced c-Myc degradation or that the residual kinase activity of GSK-3 was sufficient for the phosphorylation of c-Myc. We also examined the phosphorylation levels of AKT, an upstream kinase of GSK3. Oridonin significantly reduced pAKT levels (data not shown), which was consistent with previous reports (41) and suggested that the downregulation of pAKT may be involved in the activities of oridonin.

The ubiquitin-proteasome system (UPS) plays a crucial role in fine-tuning the abundance of key proteins in diverse cellular processes (27). The deregulation of the UPS has been observed in many types of cancer, and studies targeting the UPS for cancer therapy are being conducted (27). As a component of the UPS, Fbw7 ubiquitin ligase plays a vital role in cell fate decisions (35, 42). It was recently shown that Fbw7 controlled the fate of hematopoietic stem cells (43) and affected the proliferation and lymphomagenesis of mouse T cells (44), both through the regulation of c-Myc expression. In addition, as a tumor suppressor, Fbw7 is inactivated in numerous human malignancies. Because the overexpression of c-Myc is frequently observed in human malignancies, promotion of the degradation of oncogenic c-Myc through the activation of Fbw7 may provide a novel therapeutic approach. Our finding that oridonin upregulates Fbw7 in malignant cells of hematologic origin (Fig. 5A and Supplementary Fig. S3B) is therefore promising for the development of Fbw7-based cancer therapy. It is worth noting that among the several substrate proteins examined, the expression change in c-Myc was the most significant, implying a more important role for c-Myc in the response of cancer cells to oridonin. Besides, other prosurvival proteins, such as MCL1 and KLF5, have been shown to be targeted by Fbw7 (45–47), raising the possibility that these proteins are also involved in the anticancer activities of oridonin.

Interestingly, it has recently been reported that several stressors, including hypoxia, nickel compounds (48), or UV irradiation–induced DNA damage (49), could enhance the Fbw7-mediated degradation of c-Myc by targeting USP28, another component of the UPS. However, these types of stress are unsuitable or difficult to use as clinical therapeutic approaches. As a natural anticancer compound, oridonin is also able to influence the UPS by quickly upregulating the expression of Fbw7 and enhancing the binding of Fbw7 to its substrate rather than by affecting the expression of USP28. From this point of view, oridonin can be seen as an agonist of Fbw7, and as a result, has potential clinical implications. As to the mechanism underlying the Fbw7 activation, we found that the mRNA levels of Fbw7 were not affected by oridonin after a 2-hour treatment, whereas a 24-hour treatment did upregulate the mRNA levels of Fbw7β (data not shown), which might be mediated by p53 (50). Further mechanistic studies are being conducted.

In summary, we showed the potent anticancer activity of oridonin in vitro and in vivo and determined that the underlying mechanism involves the regulation of an E3 ligase–substrate pair (Fbw7-c-Myc). It appears that the exposure of leukemia and lymphoma cells to oridonin activates Fbw7 and GSK-3, and in this way, effectively triggers the Fbw7-mediated ubiquitination and proteasome-dependent degradation of c-Myc, leading to growth inhibition and apoptosis. Our results also provide evidence for the use of miRNA expression profiling as a tool to understand the molecular mechanisms of drug actions by retracing the expression changes in upstream transcription factors. In addition, it is possible that the altered expression of oncogenic miRNAs (e.g., the miR-17-92 cluster) and tumor suppressor miRNAs (e.g., let-7a) caused by c-Myc downregulation accounts for the anticancer activity of oridonin. It will be valuable to identify and study the roles of the target proteins of these miRNAs as well as other c-Myc downstream genes in the context of oridonin treatment to better understand the anticancer activities of this natural compound.

No potential conflicts of interest were disclosed.

Conception and design: L.-H. Qu, H.-L. Huang, H.-Y. Weng, H. Zhou

Development of methodology: H.-L. Huang, H.-Y. Weng, L.-Q. Wang, Q.-J. Huang, H. Zhou

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): L.-H. Qu, H.-L. Huang, H.-Y. Weng, L.-Q. Wang, Q.-J. Huang, P.-P. Zhao, H. Zhou

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): L.-H. Qu, H.-L. Huang, H.-Y. Weng, C.-H. Yu, Q.-J. Huang, J.-Z. Wen, H. Zhou

Writing, review, and/or revision of the manuscript: L.-H. Qu, H.-L. Huang, H.-Y. Weng, C.-H. Yu, J.-Z. Wen, H. Zhou

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L.-H. Qu, H. Zhou

Study supervision: L.-H. Qu, H. Zhou

This research was supported by the National Natural Science Foundation of China (No. 30830066, 81070589, and 30870530) and the National Basic Research Program (No. 2011CB 811300) from the Ministry of Science and Technology of China.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.