The increased migration and invasion of oral squamous cell carcinoma cells are key events in the development of metastasis to the lymph nodes and distant organs. Although the chemokine receptor CXCR4 and its ligand, stromal cell–derived factor-1α, have been found to play an important role in tumor invasion, its precise role and potential underlying mechanisms remain largely unknown. In this study, we showed that knockdown of CXCR4 significantly decreased Tca8113 cells migration and invasion, accompanied with the reduction of MMP-9 and MMP-13 expression. Inhibition of ligand binding to CXCR4 by a specific antagonist TN14003, also led to reduced cancer cell migration and invasion. Because the degradation of the extracellular matrix and the basement membrane by proteases, such as matrix metalloproteinases (MMP) is critical for migration and invasion of cancer cells, we investigated the expression of several MMPs and found that the expression of functional MMP-9 and MMP-13 was selectively decreased in CXCR4 knockdown cells. More importantly, decreased cell migration and invasion of CXCR4 knockdown cells were completely rescued by exogenous expression of MMP-9 or MMP-13, indicating that the two MMPs are downstream targets of CXCR4-mediated signaling. Furthermore, we found the level of phosphorylated extracellular signal-regulated kinase (ERK) was significantly decreased in CXCR4-silenced cells, suggesting that ERK may be a potential mediator of CXCR4-regulated MMP-9 and MMP-13 expression in Tca8113 cells. Taken together, our results strongly suggest the underlying mechanism of CXCR4 promoting Tca8113 migration and invasion by regulating MMP-9 and MMP-13 expression perhaps via activation of the ERK signaling pathway. Mol Cancer Res; 9(2); 161–72. ©2011 AACR.

Oral cancer is identified as a significant public health threat worldwide because its treatment often produces dysfunction and distortions in speech, mastication and swallowing, dental health, and even in the ability to interact socially. It is 1 of the 10 most frequent cancers in human males worldwide, with approximately two thirds of all cases occurring in developing countries (1). The most common type of oral cancer is oral squamous cell carcinoma (OSCC). Although local OSCC can be effectively controlled by surgical excision and radiotherapy, metastasis to the lymph nodes and distant organs significantly decreases the survival rate (2). As OSCC is a type of highly malignant tumor with a potent capacity to invade locally and distant metastasis, an approach decreasing the ability of invasion and metastasis may facilitate the development of effective adjuvant therapy. The invasion of tumor cells is a complex, multistage process. In this process, the degradation of the extracellular matrix (ECM) and the basement membrane surrounding the primary tumor by proteases, such as matrix metalloproteinases (MMP), is critical for migration and invasion of cancer cells. To facilitate the cell motility, invading cells need to change the cell–cell adhesion properties, rearrange the ECM environment, suppress anoikis and reorganize their cytoskeletons (3). Tumor cells secrete various ECM degrading enzymes, including MMP, to facilitate their migration and invasion (4–5). In particular, MMP2, MMP-9, and MMP-13 are highly expressed in OSCC compared with normal oral mucosa tissues, and their mRNA and protein levels are further increased on tumor progression (6–8). In addition, it is well established that MMP2, MMP-9, and MMP-13 are closely associated with tumor invasion and metastasis in a variety of human tumors (9–11).

Chemokines, a superfamily of small cytokine-like proteins, can bind to and activate a family of 7 transmembrane G-protein–coupled receptors, the chemokine receptors (12). Chemokines are expressed by many tumor types and can promote mitosis, modulate apoptosis, survival, and angiogenesis (13, 14). Interaction between the chemokine receptor CXCR4 and its ligand, stromal cell–derived factor-1α (SDF-1α or CXCL12), has been found to play an important role in tumorigenicity, proliferation, metastasis, and angiogenesis in many cancers, such as lung cancer, melanoma, esophageal cancer, ovarian cancer, glioblastoma, pancreatic cancer, cholangiocarcinoma, and basal cell carcinoma cells (15–22). Although several studies have implicated CXCR4 in tumor invasion, its precise role and potential underlying mechanisms remain largely unknown. In this study, we hypothesize that CXCR4 regulates OSCC cells migration and invasion by altering the expression and function of MMPs. First, several MMPs, including MMP2, MMP-9, and MMP-13, directly or indirectly interact with CXCR4, which could alter MMP-mediated pericellular proteolysis (23–25). Second, several studies have shown that CXCR4, and MMP2, MMP-9, and MMP-13 were highly upregulated in human OSCC, suggesting that their expression levels are likely coupled (26, 27). Herein, we present evidence that CXCR4 regulates tumor cell migration and invasion by altering the expression of MMP-9 and MMP-13.

Cell line and reagents

SCC-4, SCC-9, SCC-15, SCC-25, and Tca8113 human tongue squamous cell carcinoma cell lines were obtained from ATCC and State Key Laboratory of Oral Diseases at Sichuan University, respectively. Recombinant human SDF-1α was obtained from Research Diagnostics, Inc. MMP inhibitors, OA-Hy, and inhibitor II were obtained from Calbiochem. Antibody to human CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 were obtained from Santa Cruz Biotechnology. Rabbit anti-ERK/pERK, anti-AKT/pAKT, anti-P38/pP38, anti-JNK/pJNK, and anti-GAPDH primary antibodies were purchased from Cell Signaling Technology. The real-time PCR primers for CXCR4, MMP1, MMP2, MMP7, MMP-9, MMP-13, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were synthesized commercially (Takara). Cell proliferation and cytotoxicity assay kit were from Dojindo Laboratories. The Migration and Invasion Assay kit were from Millipore. All tissue culture media and serum were from Gibco. Peroxidase-labeled anti-rabbit antibody and enhanced chemiluminescence (ECL) system were from Millipore.

Construction of plasmid vector expressing siRNAs for CXCR4

Two siRNAs were designed based on the CXCR4 sequence (NM_001008540): siRNA 1, 5′-GGTGGTCTATGTTGGCGTCTG-3′; siRNA 2, 5′-GGCAGTCCATGTCATCTAC-3′. Oligonucleotides with a sequence predicted to induce efficient RNAi of CXCR4 (containing sense and antisense sequences) were synthesized (siRNA 1 sense: 5′-GATCCCGGGTGGTCTATGTTGGCGTCTGGAAGCTTGCAGACGCCAACATAGACCACCTTTTTT-3′, antisense: 5′-CTAGAAAAAAGGTGGTCTATGTTGGCGTCTGCAAGCTTCCAGACGCCAACATAGACCACCCGG-3′; siRNA 2 sense: 5′-GATCCCGGGCAGTCCATGTCATCTACGAAGCTTGGTAGATGACATGGACTGCCTTTTTT-3′; antisense: 5′-CTAGAAAAAAGGCAGTCCATGTCATCTACCAAGCTTCGTAGATGACATGGACTGCCCGG-3′). These oligonucleotides were annealed in STE buffer [10 mmol/L Tris (pH 8.0), 50 mmol/L NaCl, and 1 mmol/L EDTA] at 94°C for 5 minutes and cooled gradually. The double-stranded products were cloned downstream to the human U6 promoter of the pRNAT/U6 vector (Genscripts) and designated as CXCR4-shRNA1 and CXCR4-shRNA2. A control vector (Control) was constructed (5′-GAAGCAGCACGACTTCTTC-3′) with no significant homology to any mammalian gene sequence and, therefore, served as a nonsilencing control.

Cell culture and transfection

The cells were cultured at 37°C in 5% CO2 in RPMI 1640 containing 10% FBS (Gibco Life Technologies), 2 mmol/L glutamine, 1 mmol/L sodium pyruvate, 10 mmol/L HEPES, 100 U/mL penicillin G, and 100 mg/mL streptomycin (Sigma). The human tongue squamous cell carcinoma cell lines were transfected in Opti-MEM I medium with Lipofectamine LTX with plus reagent (Invitrogen) in accordance with the manufacturer's instructions. For stable transfection, selection was performed with neomycin (500 mg/mL; Invitrogen) in RPMI 1640 medium containing 20% FBS for approximately 2 weeks from the day after transfection. The cells with knockdown of CXCR4 were collected for cell proliferation and cytotoxicity assay, migration and invasion assays, real-time PCR, and Western blotting.

Quantitative real-time PCR

Quantitative reverse transcription-PCR was carried out using real-time PCR with the SYBR Green reporter. Total RNA isolated using the RNeasy Mini kit (Qiagen) was subsequently reverse transcribed to cDNA with the SuperScript First-Strand Synthesis System (Invitrogen). The quantitative real-time RT-PCR was performed using the SYBR premix Ex Taq II Kit (Takara) according to the manufacturer's instructions. The reaction mix was subjected to quantitative real-time PCR to detect levels of the corresponding GAPDH, CXCR4, and several MMPs. All primers sequence were shown in Table 1. The relative expression levels were quantified and analyzed by using Bio-Rad iCycler iQ software. The comparative threshold cycle (Ct) method was used to calculate amplification fold. GAPDH gene was used as a reference control gene to normalize the expression value of each gene. Triple replicates were performed for each gene and average expression value was computed for subsequent analysis. The relative expression level of the genes was calculated using the 2−△△Ct method (28).

Table 1.

The primers for quantitative real-time RT-PCR

GenesForward primer (5′–3′)Reverse primer (5′–3′)
CXCR4 AGACCACAGTCATCCTCATCCT GTTCTCAAACTCACACCCTTGC 
MMP1 GGGAGATCATCGGGACAACTC GGGCCTGGTTGAAAAGCAT 
MMP2 CTGACCCCCAGTCCTATCTGCC TGTTGGGAACGCCTGACTTCAG 
MMP7 GAGATGCTCACTTCGATGAGG GGATCAGAGGAATGTCCCATAC 
MMP-9 CTTTGACAGCGACAAGAAGTGG GGCACTGAGGAATGATCTAAGC 
MMP-13 TTGTTGCTGCGCATGAGTTCG GGGTGCTCATATGCAGCATCA 
GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT 
GenesForward primer (5′–3′)Reverse primer (5′–3′)
CXCR4 AGACCACAGTCATCCTCATCCT GTTCTCAAACTCACACCCTTGC 
MMP1 GGGAGATCATCGGGACAACTC GGGCCTGGTTGAAAAGCAT 
MMP2 CTGACCCCCAGTCCTATCTGCC TGTTGGGAACGCCTGACTTCAG 
MMP7 GAGATGCTCACTTCGATGAGG GGATCAGAGGAATGTCCCATAC 
MMP-9 CTTTGACAGCGACAAGAAGTGG GGCACTGAGGAATGATCTAAGC 
MMP-13 TTGTTGCTGCGCATGAGTTCG GGGTGCTCATATGCAGCATCA 
GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT 

Western blotting

The cells were lysed in lysis buffer (PBS containing 1% Triton X-100, protease inhibitor cocktail, and 1 mmol/L phenylmethylsulfonyl fluoride) at 4°C for 30 minutes. Equal quantities of protein were subjected to SDS-PAGE. After transfer to Immobilon-P transfer membrane, successive incubations with anti-CXCR4, MMP1, MMP2, MMP7, MMP-9, MMP-13, ERK/pERK, AKT/pAKT, P38/pP38, and JNK/pJNK antibody or anti-GAPDH antibody and horseradish peroxidase–conjugated secondary antibody were carried out. The immunoreactive proteins were then detected using the ECL system. Bands were scanned using a densitometer (GS-700; Bio-Rad) and quantification was performed using Quantity One 4.6.3 software (Bio-Rad).

Cell proliferation assay

Cell proliferation assay was performed using Cell Counting Kit-8 (Dojindo). Cells were plated in 96-well plates at 1×104 cells per well and incubated for 5 days. Every day, at one time, 10 μL of Cell Counting Assay Kit-8 solution were added to each well, then the cells were incubated for another 2 hours. The value of optical density (OD) was obtained by the differences in absorbance at a wavelength of 450 nm by using a microplate reader (VARI OSKAN FLASH 3001 Thermo). The amount of the formazan dye, generated by the activities of dehydrogenases in cells, is directly proportional to the number of living cells.

Cell migration assay

This cell migration assay was performed in a migration chamber with an 8-μm pore size polycarbonate membrane (Millipore), based on the Boyden chamber principle. Briefly, cells were resuspended in serum-free RPMI 1640, and 3×105 cells were added to the interior of the inserts. RPMI 1640 (500 μL) containing 10% FBS were added to the lower chamber as chemoattractant. Cells were incubated for 24 hours at 37°C in a CO2 incubator (5% CO2). Then, the upper surface of the chamber was scraped to remove nonmigratory cells. Migrated cells were fixed and stained with 0.1% crystal violet and photographed under a light microscope (×200). The stained inserts were transferred to a clean well containing 500 μL of 10% acetic acid for 15 minutes at room temperature. The OD of the stained cell was measured at 560 nm.

Cell invasion assay

The cell invasion assay was performed with QCM 24-well Invasion Assay kit (Chemicon International). This cell invasion assay was performed in an invasion chamber, based on the Boyden chamber principle. This kit contains 24 inserts and each insert contains an 8-μm pore size polycarbonate membrane coated with a thin layer of ECM. Briefly, cells were resuspended in serum-free RPMI 1640, and 3×105 cells were added to the interior of the inserts, which had been previously rehydrated at room temperature for 30 minutes. RPMI 1640 (500 μL) containing 10% FBS were added to the lower chamber as chemoattractant. Cells were incubated for 48 hours at 37°C in a CO2 incubator (5% CO2). Then, the upper surface of the chamber was scraped to remove noninvasive cells. Invaded cells were fixed and stained with 0.1% crystal violet and photographed under a light microscope (×200). The stained inserts were transferred to a clean well containing 500 μL of 10% acetic acid for 15 minutes at room temperature. The OD of the stained cell was measured at 560 nm.

Data statistics

All quantified data represent an average of at least 3 samples. Error bars represent SD. Statistical significance was determined by Student's t test, and differences at probability of less than 0.05 were considered statistically significant.

CXCR4 silencing inhibits Tca8113 cells migration and invasion by regulating MMP-9 and MMP-13 expression

We investigated whether CXCR4 is required for the invasive phenotypes of oral squamous cell carcinoma cells in vitro by expressing short hairpin RNAs (shRNA) to knock down CXCR4 expression. We expressed shRNA from 2 different CXCR4 sequences (shRNA1 or shRNA2) in the highly malignant Tca8113 cell line and SCC-9 cell line (Fig. 1A). Expression of CXCR4 protein and its mRNA levels were substantially reduced by 90%, 82% and 88%, 74% in CXCR4-shRNA1 expressing ∼ Tca8113 and SCC-9 cells, respectively (Fig. 1B–D). However, the expression of CXCR4 protein and its mRNA levels were substantially reduced by 20% and 30% in CXCR4-shRNA2 expressing Tca8113 and SCC-9 cells, respectively (data not shown). Therefore, 1 of the 2 shRNAs (CXCR4-shRNA1) was chosen for further study. Furthermore, the quantitative real-time RT-PCR and Western blotting results showed that the mRNA and protein expression of CXCR4 in both Tca8113 and SCC-9 cells were significantly inhibited in vitro. We also selected the 1 of the 2 cell lines (Tca8113) for further study. In addition, we examined the effect of CXCR4 silencing on the survival and proliferative activity of Tca8113 cells because a decrease in survival or proliferation after CXCR4 silencing may also contribute to the observed decrease in migration and invasion of Tca8113 cells. The results showed that CXCR4 silencing decreased the proliferation rate of Tca8113 cells slightly compared with Tca8113 and control cells (Supplementary Fig. S1). To investigate whether CXCR4 silencing affects Tca8113 cell migration and invasion, we conducted 3-dimensional cell migration assays using migration chambers and invasion assays with matrigel-coated invasion chambers. The results showed that knockdown of CXCR4 in Tca8113 cells decreased cell migration and invasion at approximately 75% and 85%, respectively, compared with controls (Fig. 2A–B). To further confirm whether CXCR4 regulates Tca8113 cell migration and invasion by modulating MMP expression, we analyzed the mRNA and protein levels of MMPs on CXCR4 silencing. Quantitative real-time PCR results showed that the mRNA levels of MMP-9 and MMP-13 were decreased by approximately 70% and 60%, respectively, in CXCR4-silenced cells, compared with control cells (Fig. 2C). The Western blotting results showed that the protein levels of MMP-9 and MMP-13 were decreased by approximately 75% and 65%, respectively, in CXCR4-silenced cells, compared with control cells (Fig. 2D-E). As controls, the mRNA and protein levels of the MMP1, MMP2, and MMP7 did not alter under these conditions. To further confirm that the effect of CXCR4 silencing on the decrease of migration and invasion of Tca8113 cells is specific, we restored CXCR4 function by coculturing the ligand of CXCR4 SDF-1α (100 ng/mL, 12 hours), which can significantly promote the upregulation of CXCR4 expression (Fig. 3A; ref. 29). We also observed that the upregulation of CXCR4 expression restored Tca8113 cell migration and invasion and the protein levels of MMP-9 and MMP-13 were increased by approximately 60% and 70%, respectively, in CXCR4-restored cells, compared with control cells. As controls, the protein levels of the MMP1, MMP2, and MMP7 did not alter under these conditions (Fig. 3B-D). We have further tested the effects of CXCR4 silencing on the invasion of several OSCC cell lines (SCC-4, SCC-9, SCC-15, SCC-25) and found that the invasion of these human tongue squamous cell carcinoma cells positively correlated with CXCR4 expression levels (Supplementary Fig. S2A). To further confirm whether CXCR4 regulates Tca8113 cell migration and invasion by modulating MMP expression, we analyzed the protein levels of MMPs in different cell lines on CXCR4 silencing. The Western blotting results showed that the protein levels of MMP-9 and MMP-13 were decreased significantly in CXCR4-silenced cells except SCC-25 cell line, compared with control cells (Supplementary Fig. S2B). As controls, the protein levels of the MMP1, MMP2, and MMP7 did not alter on CXCR4 silencing. These results showed that the expression levels of CXCR4 positively correlated with the migration and invasion of human tongue squamous cell carcinoma cells.

Figure 1.

CXCR4 silencing in tongue squamous cell carcinoma cells. A, Tca8113 and SCC-9 tongue squamous cell carcinoma cells were transfected with CXCR4-shRNA1, CXCR4-shRNA2, or control shRNA using Lipofectamine LTX with plus. For stable transfection, selection was performed with neomycin (500 mg/mL; Invitrogen) in RPMI 1640 medium containing 20% FBS for approximately 2 weeks from the day after 48-hour transfection, then photographed under a inverted fluorescence microscope (×100). B, Western blotting analysis of CXCR4 silencing by CXCR4-shRNA1 in both Tca8113 and SCC-9 cells. GAPDH loading control is also shown. C, densitometric analysis of protein levels of CXCR4, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. D, transcript levels of CXCR4, relative to GAPDH, determined by quantitative RT-PCR and compared with Tca8113 cells. Error bars indicate SD; n = 3 experiments; **, P < 0.01.

Figure 1.

CXCR4 silencing in tongue squamous cell carcinoma cells. A, Tca8113 and SCC-9 tongue squamous cell carcinoma cells were transfected with CXCR4-shRNA1, CXCR4-shRNA2, or control shRNA using Lipofectamine LTX with plus. For stable transfection, selection was performed with neomycin (500 mg/mL; Invitrogen) in RPMI 1640 medium containing 20% FBS for approximately 2 weeks from the day after 48-hour transfection, then photographed under a inverted fluorescence microscope (×100). B, Western blotting analysis of CXCR4 silencing by CXCR4-shRNA1 in both Tca8113 and SCC-9 cells. GAPDH loading control is also shown. C, densitometric analysis of protein levels of CXCR4, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. D, transcript levels of CXCR4, relative to GAPDH, determined by quantitative RT-PCR and compared with Tca8113 cells. Error bars indicate SD; n = 3 experiments; **, P < 0.01.

Close modal
Figure 2.

CXCR4 silencing inhibits Tca8113 cells migration and invasion. A, 3-dimensional migration and invasion assay were performed using Boyden chambers in CXCR4-shRNA1 Tca8113 cells. B, the quantitative analysis of migrated and invaded cells, which were eluted using 10% acetic acid and measured optical density value at 560 nm. Scale bars, 100 μm. C, transcript levels of CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 in CXCR4-silenced Tca8113 cells, relative to GAPDH, determined by quantitative RT-PCR. D, Western blotting analysis of CXCR4 MMP1, MMP2, MMP7, MMP-9, and MMP-13 in CXCR4-shRNA1 Tca8113 cells. GAPDH loading control is also shown. E, densitometric analysis of protein levels of CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. Representative photos of migration and invasion are presented, which were taken at a magnification of ×200 under inverted microscopy. Error bars indicate SD; n = 3 experiments; **, P < 0.01.

Figure 2.

CXCR4 silencing inhibits Tca8113 cells migration and invasion. A, 3-dimensional migration and invasion assay were performed using Boyden chambers in CXCR4-shRNA1 Tca8113 cells. B, the quantitative analysis of migrated and invaded cells, which were eluted using 10% acetic acid and measured optical density value at 560 nm. Scale bars, 100 μm. C, transcript levels of CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 in CXCR4-silenced Tca8113 cells, relative to GAPDH, determined by quantitative RT-PCR. D, Western blotting analysis of CXCR4 MMP1, MMP2, MMP7, MMP-9, and MMP-13 in CXCR4-shRNA1 Tca8113 cells. GAPDH loading control is also shown. E, densitometric analysis of protein levels of CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. Representative photos of migration and invasion are presented, which were taken at a magnification of ×200 under inverted microscopy. Error bars indicate SD; n = 3 experiments; **, P < 0.01.

Close modal
Figure 3.

CXCR4 modulates cell migration and invasion by regulating MMP-9 and MMP-13 expression. A, Western blotting analysis of the ligand of CXCR4 SDF-1α was cocultured with CXCR4-shRNA1 Tca8113 cells. The cells were serum starved for 12 hours and treated with SDF-1α (100 ng/mL) for 12 and 24 hours. CXCR4 silencing and SDF-1α overexpression were determined by Western blotting (GAPDH levels as loading control). B, the quantitative analysis of migrated and invaded cells treated with SDF-1α (100 ng/mL) for 12 hours, which were eluted using 10% acetic acid and measured optical density value at 560 nm. C, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 in the ligand of CXCR4 SDF-1α cocultured with CXCR4-shRNA1 Tca8113 cells. GAPDH loading control is also shown. D, densitometric analysis of protein levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting. E, Tca8113 cell migration and invasion were analyzed with or without 100 nmol/L TN14003 in both chambers. F, transcript levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13 in Tca8113 cells with or without 100 nmol/L TN14003, relative to GAPDH, determined by quantitative RT-PCR. G, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 protein levels of Tca8113 cells with or without 100 nmol/L TN14003. GAPDH loading control is also shown. H, densitometric analysis of MMPs protein levels for Tca8113 cells with or without 100 nmol/L TN14003, relative to GAPDH, determined by Western blotting. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Figure 3.

CXCR4 modulates cell migration and invasion by regulating MMP-9 and MMP-13 expression. A, Western blotting analysis of the ligand of CXCR4 SDF-1α was cocultured with CXCR4-shRNA1 Tca8113 cells. The cells were serum starved for 12 hours and treated with SDF-1α (100 ng/mL) for 12 and 24 hours. CXCR4 silencing and SDF-1α overexpression were determined by Western blotting (GAPDH levels as loading control). B, the quantitative analysis of migrated and invaded cells treated with SDF-1α (100 ng/mL) for 12 hours, which were eluted using 10% acetic acid and measured optical density value at 560 nm. C, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 in the ligand of CXCR4 SDF-1α cocultured with CXCR4-shRNA1 Tca8113 cells. GAPDH loading control is also shown. D, densitometric analysis of protein levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting. E, Tca8113 cell migration and invasion were analyzed with or without 100 nmol/L TN14003 in both chambers. F, transcript levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13 in Tca8113 cells with or without 100 nmol/L TN14003, relative to GAPDH, determined by quantitative RT-PCR. G, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 protein levels of Tca8113 cells with or without 100 nmol/L TN14003. GAPDH loading control is also shown. H, densitometric analysis of MMPs protein levels for Tca8113 cells with or without 100 nmol/L TN14003, relative to GAPDH, determined by Western blotting. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Close modal

CXCR4 ligand-binding function is required for efficient cancer cell migration and invasion

To determine whether the ligand-binding ability of CXCR4 affected Tca8113 cell migration and invasion, we pretreated Tca8113 cells with TN14003, an antagonist that blocks ligand binding to CXCR4 (30). Treating Tca8113 cells with 100 nmol/L TN14003 resulted in a significant decrease in migration and invasion at approximately 85% and 70%, respectively, compared with control cells, suggesting that ligand binding to CXCR4 is required for the CXCR4 function in tumor cell migration and invasion (Fig. 3E). We also investigated the mRNA and protein levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13 in Tca8113 cells with or without 100 nmol/L TN14003. Quantitative real-time PCR results showed that the mRNA levels of MMP-9 and MMP-13 were decreased by approximately 60% and approximately 75% in Tca8113 cells treated with TN14003, compared with control cells (Fig. 3F). The Western blotting results showed that protein levels of MMP-9 and MMP-13 were decreased by approximately 50% and approximately 65%, respectively, in Tca8113 cells treated with TN14003, compared with control cells (Fig. 3G–H). So the antagonist of CXCR4, TN14003, may inhibit Tca8113 cancer cells migration through downregulating expression levels of MMP-9 and MMP-13 in CXCR4-related pathway.

MMP-9 and MMP-13 are downstream targets of CXCR4

To investigate whether MMP activity is required for Tca8113 cell migration and invasion, we tested the effect of OA-Hy, a broad spectrum MMP inhibitor, and inhibitor II, a specific inhibitor of MMP-9 and MMP-13 (Fig. 4A). Both inhibitors significantly blocked Tca8113 cells migration and invasion, showing that MMP activity is necessary for efficient migration and invasion of Tca8113 cells. In our previous data, we have analyzed the mRNA and protein levels of MMPs on CXCR4 silencing. Both quantitative real-time PCR and Western blotting results showed that the mRNA and protein levels of MMP-9 and MMP-13 were decreased significantly in CXCR4-silenced cells, respectively, compared with control cells (Fig. 2C–E). Herein, we investigated the protein levels of MMPs on CXCR4 silencing and MMP inhibitors. The protein levels of MMP-9 and MMP-13 were decreased by approximately 80% and 70%, respectively, in CXCR4-silenced cells, compared with control cells. The inhibition effect of protein expression of MMP-9 and MMP-13 on CXCR4 silencing was similar with MMP inhibitors, indicating that CXCR4 is involved in the transcriptional regulation of MMP-9 and MMP-13 in Tca8113 cells (Fig. 4B–C). To confirm the finding that CXCR4 regulates MMP-9 and MMP-13 expression, we investigated the mRNA levels of MMP-9 and MMP-13 in CXCR4-deficient mouse embryonic fibroblasts (CXCR4-deficient MEF cells) and CXCR4-expressing MEF cells (MEF cells) by quantitative real-time PCR. Consistent with findings in CXCR4 knockdown cells, mRNA levels of MMP-9 and MMP-13 in CXCR4-deficient MEF cells are only approximately 25% and 40%, respectively, of MEF cells (Fig. 4D). Furthermore, the mRNA levels of MMP-9 and MMP-13 in the brain of CXCR4-deficient forebrain mice were also significantly lower than those in the brain of littermate control mice (ref. 31; Fig. 4E). In both cases, the levels of MMP1, MMP2, and MMP7 were not changed, suggesting that CXCR4 specifically regulates MMP-9 and MMP-13 expression. Additionally, to further confirm that the effect of CXCR4 silencing on the decrease of MMP-9 and MMP-13 expression levels in Tca8113 cells is specific, we restored CXCR4 function by coculturing the ligand of CXCR4 SDF-1α (100 ng/mL, 12 hours). We found that SDF-1α significantly restored mRNA levels of MMP-9 and MMP-13 in CXCR4-silenced cells (Fig. 4F). Additionally, we tested whether ectopic expression of MMP-9 or MMP-13 can restore cell migration and invasion or not in CXCR4-silenced Tca8113 cells. We found that MMP-9 or MMP-13 overexpression successfully restored both migration and invasion in these cells (Fig. 5A). We also detected the protein levels of MMP-9 and MMP-13 during this process. The restoration of protein expression of MMP-9 and MMP-13 increased the invasiveness of CXCR4-silenced cells. Furthermore, SDF-1α restored protein levels of MMP-9 and MMP-13 in CXCR4-silenced cells and significantly increased invasiveness of these cells, indicating MMP-9 and MMP-13 are downstream targets of CXCR4 (Fig. 5B–D).

Figure 4.

MMP-9 and MMP-13 are downstream targets of CXCR4. A, migration and invasion assays were performed with Tca8113 cells in the absence or presence of 10 μmol/L MMP inhibitor OA-Hy or 10 nmol/L MMP inhibitor II. B, mRNA levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13 were quantified by real-time PCR on CXCR4 silencing and MMP inhibitors compared with control cells. GAPDH mRNA levels were used as internal controls. B, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 on CXCR4 silencing and MMP inhibitors. GAPDH loading control is also shown. C, densitometric analysis of protein levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. D, CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 mRNA levels were determined by quantitative RT-PCR in MEF cells and CXCR4-deficient MEF cells. E, CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 mRNA levels were determined by quantitative RT-PCR in CXCR4-deficient forebrain mice and control mice. F, the CXCR4-shRNA1 cells were serum starved for 12 hours and treated with SDF-1α (100 ng/mL) for 12 hours. Increased mRNA levels of MMP-9 and MMP-13, determined by quantitative RT-PCR, in CXCR4-shRNA1 cells treated with SDF-1α, compared with CXCR4-shRNA1 cells. GAPDH levels were used as internal control. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Figure 4.

MMP-9 and MMP-13 are downstream targets of CXCR4. A, migration and invasion assays were performed with Tca8113 cells in the absence or presence of 10 μmol/L MMP inhibitor OA-Hy or 10 nmol/L MMP inhibitor II. B, mRNA levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13 were quantified by real-time PCR on CXCR4 silencing and MMP inhibitors compared with control cells. GAPDH mRNA levels were used as internal controls. B, Western blotting analysis of MMP1, MMP2, MMP7, MMP-9, and MMP-13 on CXCR4 silencing and MMP inhibitors. GAPDH loading control is also shown. C, densitometric analysis of protein levels of MMP1, MMP2, MMP7, MMP-9, and MMP-13, relative to GAPDH, determined by Western blotting and compared with Tca8113 cells. D, CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 mRNA levels were determined by quantitative RT-PCR in MEF cells and CXCR4-deficient MEF cells. E, CXCR4, MMP1, MMP2, MMP7, MMP-9, and MMP-13 mRNA levels were determined by quantitative RT-PCR in CXCR4-deficient forebrain mice and control mice. F, the CXCR4-shRNA1 cells were serum starved for 12 hours and treated with SDF-1α (100 ng/mL) for 12 hours. Increased mRNA levels of MMP-9 and MMP-13, determined by quantitative RT-PCR, in CXCR4-shRNA1 cells treated with SDF-1α, compared with CXCR4-shRNA1 cells. GAPDH levels were used as internal control. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Close modal
Figure 5.

Decreased migration and invasion in CXCR4 knockdown Tca8113 cells were rescued by MMP-9 and MMP-13 overexpression. A, invasion assay was performed after the ligand of CXCR4 SDF-1α was cocultured and MMP-9 or MMP-13 expression vector were cotransfected with CXCR4-shRNA1 cells. B, the invaded cells on the bottom side of the membrane were stained with 0.1% crystal violet solution, then the stained inserts were eluted using 10% acetic acid and measured optical density value at 560 nm. C, Western blotting analysis of MMP-9 and MMP-13 on CXCR4 overexpressing and ectopic expression of MMP-9 or MMP-13. GAPDH loading control is also shown. D, densitometric analysis of protein levels of MMP-9 and MMP-13, relative to GAPDH, determined by Western blotting and compared with CXCR4-silenced Tca8113 cells. Scale bars, 100 μm. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Figure 5.

Decreased migration and invasion in CXCR4 knockdown Tca8113 cells were rescued by MMP-9 and MMP-13 overexpression. A, invasion assay was performed after the ligand of CXCR4 SDF-1α was cocultured and MMP-9 or MMP-13 expression vector were cotransfected with CXCR4-shRNA1 cells. B, the invaded cells on the bottom side of the membrane were stained with 0.1% crystal violet solution, then the stained inserts were eluted using 10% acetic acid and measured optical density value at 560 nm. C, Western blotting analysis of MMP-9 and MMP-13 on CXCR4 overexpressing and ectopic expression of MMP-9 or MMP-13. GAPDH loading control is also shown. D, densitometric analysis of protein levels of MMP-9 and MMP-13, relative to GAPDH, determined by Western blotting and compared with CXCR4-silenced Tca8113 cells. Scale bars, 100 μm. Error bars indicate SD; n = 3 experiments; *, P < 0.05; **, P < 0.01.

Close modal

Extracellular signal-regulated kinase is a potential mediator of CXCR4 regulation of MMP-9 and MMP-13 expression

To understand the mechanism that CXCR4 regulates MMP-9 and MMP-13 expression, we analyzed the effects of CXCR4 silencing on the activation of several potential signaling pathways. We found that the level of phosphorylated extracellular signal-regulated kinase (ERK) was significantly decreased in CXCR4-silenced Tca8113 cells, which was restored by coculturing the ligand of CXCR4 SDF-1α (Fig. 6A–B). Phosphorylated Akt, p38, and c-jun NH kinase (JNK) were not significantly changed in CXCR4-silenced Tca8113 cells. These results show that ERK is likely a downstream target of CXCR4-mediated signaling that regulates MMP-9 and MMP-13 expression and their functions in cell migration and invasion in Tca8113 cells.

Figure 6.

CXCR4 silencing decreased phosphorylated ERK. Effects of CXCR4 silencing on several cellular signaling pathways were analyzed by Western blotting. A, control shRNA or CXCR4-shRNA1, without or with SDF-1α, were cocultured with CXCR4-shRNA1 cells. The same amounts of lysates were analyzed by Western blotting for CXCR4 expression and the levels of indicated signaling molecules. GAPDH loading control is also shown. B, densitometric analysis of protein levels of pERK, relative to GAPDH, determined by Western blotting and compared with control shRNA cells. Error bars indicate SD; n = 3 experiments; *, P < 0.05.

Figure 6.

CXCR4 silencing decreased phosphorylated ERK. Effects of CXCR4 silencing on several cellular signaling pathways were analyzed by Western blotting. A, control shRNA or CXCR4-shRNA1, without or with SDF-1α, were cocultured with CXCR4-shRNA1 cells. The same amounts of lysates were analyzed by Western blotting for CXCR4 expression and the levels of indicated signaling molecules. GAPDH loading control is also shown. B, densitometric analysis of protein levels of pERK, relative to GAPDH, determined by Western blotting and compared with control shRNA cells. Error bars indicate SD; n = 3 experiments; *, P < 0.05.

Close modal

Although local OSCC can be effectively controlled by surgical excision and radiotherapy, in tongue squamous cell carcinoma, the incidence of occult cervical lymph nodes metastases is relatively high. Of the patients with T1 and T2 squamous cell carcinoma of the oral tongue clinically staged N0, 13% to 33% and 37% to 53%, respectively, have occult metastases at the time of diagnosis (32, 33). The metastasis of tumor cells is a very complex process. Tumor cells must migrate through ECM and basement membranes to invade local tissues and metastasize to distal sites. Muller and colleagues (34) showed that injecting the antibody that neutralizes CXCR4 activity leads to inhibition of metastasis to the bone marrow and lungs in vivo. Recently, it has been proposed that chemokine receptors are critical in determining the metastatic destination of tumor cells (35–37). Uchida and colleagues (38) showed a possible role for CXCR4 in mediating the dissemination of OSCCs to the lymph nodes. In this study, we show that CXCR4 silencing leads to a significant decrease of Tca8113 cells migration and invasion and provide evidence that CXCR4 regulates the transcriptional levels of MMP-9 and MMP-13 in Tca8113 cells. We further show that CXCR4 regulation of MMP-9 and MMP-13 expression is likely mediated by ERK signal pathways.

The finding that CXCR4 silencing led to a significant decrease of Tca8113 cells migration and invasion was consistent with many previous reports, which showed that high levels of CXCR4 expression promoted OSCC cell invasion (26). Moreover, functional blocking of CXCR4 by TN14003 also led to decreased cell migration and invasion, which was also consistent with reports that TN14003 treatment decreased migration of breast cancer cells and pancreatic cancer cells in vitro and reduced pulmonary metastasis of breast cancer in SCID mice (30, 39). Additionally, we rescued cell migration and invasion in CXCR4-silenced Tca8113 cells by coculturing the ligand of CXCR4 SDF-1α, which suggested that CXCR4 expression levels were positively correlated with cancer cell migration and invasion.

We further observed that the number of invaded cells positively correlated with endogenous levels of CXCR4 in different human tongue squamous cell carcinoma cell lines, suggesting that CXCR4 regulates cancer cell migration and invasion via a similar mechanism among different tongue squamous cell carcinoma cell types. To determine how CXCR4 promotes Tca8113 cells migration and invasion, we focused on delineating the relationship between CXCR4 and MMPs, particularly MMP-9 and MMP-13. In human cancer cells, MMP1, MMP2, MMP-9, and MMP-13 have been found to correlate with malignant grade and metastasis (40, 41). MMPs have been implicated to facilitate cancer cell invasion and metastasis through degradation of surrounding ECM proteins. Expression of MMPs and other extracellular proteinases have been shown to positively correlate with the progression of cancer in patients (10, 42). It is interesting to note that several studies have shown that the expression levels of CXCR4 were also highly upregulated in human head and neck squamous cell carcinoma and OSCC, suggesting that MMPs and CXCR4 expression levels are likely coupled (26, 43, 44). However, it is unknown how these genes regulate each other during tumorigenesis. Herein, we found that CXCR4 silencing significantly decreased the mRNA and protein levels of both MMP-9 and MMP-13, but not the mRNA and protein levels of the MMP1, MMP2, and MMP7, indicating that CXCR4 specifically modulates the expression of MMP-9 and MMP-13.

Although more than 90% of CXCR4 expression was silenced by shRNA, the migration and invasion rates of Tca8113 cells and the expression levels of MMP-9 and MMP-13 were reduced by only approximately 50% to 80%. A potential explanation for this discrepancy is the paradoxical function of some MMPs. Indeed, MMP-9 has a function of host resistance in cancer, as well as protumorigenic action (45). Additionally, other modulators may regulate MMP expression and Tca8113 cell migration and invasion independent of CXCR4. Further investigation will be needed to reveal the relationship of CXCR4-dependent and CXCR4-independent mechanisms in cancer cell migration and invasion. We further showed that the expression of MMP-9 and MMP-13 in both CXCR4-deficient MEF cells and the brain of CXCR4-deficient forebrain mice were significantly lower than those in the control samples. These results suggest that CXCR4 is involved in the transcriptional regulation of MMP-9 and MMP-13 in Tca8113 cells. We also showed that the ectopic expression of MMP-9 or MMP-13 successfully restored both migration and invasion of CXCR4-silenced Tca8113 cells, indicating that MMP-9 and MMP-13 are indeed downstream targets of CXCR4.

The signal transduction pathways that modulate the activity of MMP transcription factors are highly diverse. Mitogen-activated protein kinase signal transduction pathways, including p38, ERK, and JNK, are well known mediators that stimulate or inhibit MMP expression depending on cell types (46–48). In this study, we showed that downregulation of CXCR4 expression by shRNA could significantly reduce the phosphorylation of ERK. Thus, ERK signaling pathway is likely associated with several mechanisms of cell motility mediated by CXCR4, including regulation of the transcriptional levels of MMP-9 and MMP-13.

Taken together, in this study we showed that the downregulation of CXCR4 by shRNA may well serve as a potential therapeutic strategy to treat cancer, particularly cancer metastasis. Further studies aimed at identifying the precise signal transduction pathways and transcription factors that mediated CXCR4 regulation of MMPs expression may provide a molecular understanding of the roles of CXCR4 in cancer biology.

No potential conflicts of interest were disclosed.

We thank Xiaoyu Li, Yurong Liu, and Min Zhou from State Key Laboratory of Oral Diseases, Sichuan University for their technical assistance.

This project was supported by National Natural Science Foundation of China (Grant 30973345).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Yu
T
,
Wang
XY
,
Gong
RG
,
An
Li
,
Sen
Yang
,
Yu-tang
Cao
, et al
The expression profile of microRNAs in a model of 7,12-dimethyl-benz[a]anthrance-induced oral carcinogenesis in Syrian hamster
.
J Exp Clin Canc Res
2009
;
28
:
64
.
2.
de Aguiar
FCA
,
Kowalski
LP
,
de Almeida
OP
. 
Clinicopathological and immunohistochemical evaluation of oral squamous cell carcinoma in patients with early local recurrence
.
Oral Oncol
2007
;
43
:
593
601
.
3.
Woodhouse
EC
,
Chuaqui
RF
,
Liotta
LA
. 
General mechanisms of metastasis
.
Cancer
1997
;
80
:
1529
37
.
4.
Castellano
G
,
Malaponte
G
,
Mazzarino
MC
,
Figini
M
,
Marchese
F
,
Gangemi
P
, et al
Activation of the osteopontin/matrix metalloproteinase-9 pathway correlates with prostate cancer progression
.
Clin Cancer Res
2008
;
14
:
7470
80
.
5.
Fromigué
O
,
Hamidouche
Z
,
Marie
PJ
. 
Blockade of the RhoA-JNK-c-Jun-MMP2 cascade by atorvastatin reduces osteosarcoma cell invasion
.
J Biol Chem
2008
;
283
:
30549
56
.
6.
Kawamata
H
,
Nakashiro
K
,
Uchida
D
,
Harada
K
,
Yoshida
H
,
Sato
M
Possible contribution of active MMP2 to lymphnode metastasis and secreted cathepsin L to bone invasion of newly established human oral squamous cancer cell lines
.
Int J Cancer
1997
;
70
:
120
7
.
7.
Ruokolainen
H
,
Paakko
P
,
Turpeenniemi-Hujanen
T
. 
Serum matrix metalloproteinase-9 in head and neck squamous cell carcinoma is a prognostic marker
.
Int J Cancer
2005
;
116
:
422
7
.
8.
Johansson
N
,
Airola
K
,
Grenman
R
,
Kariniemi
AL
,
Saarialho-Kere
U
,
Kähäri
VM
, et al
Expression of collagenase-3 (matrix metalloproteinase-13) in squamous cell carcinomas of the head and neck
.
Am J Pathol
1997
;
151
:
499
508
.
9.
Komatsu
K
,
Nakanishi
Y
,
Nemoto
N
,
Hori
T
,
Sawada
T
,
Kobayashi
M
, et al
Expression and quantitative analysis of matrix metalloproteinase-2 and -9 in human gliomas
.
Brain Tumor Pathol
2004
;
21
:
105
12
.
10.
Chambers
AF
,
Matrisian
LM
. 
Changing views of the role of matrix metalloproteinases in metastasis
.
J Natl Cancer Inst
1997
;
89
:
1260
70
.
11.
Culhaci
N
,
Metin
K
,
Copcu
E
,
Dikicioglu
E
. 
Elevated expression of MMP-13 and TIMP-1 in head and neck squamous cell carcinomas may reflect increased tumor invasiveness
.
BMC Cancer
2004
;
4
:
42
.
12.
Zlotnik
A
,
Yoshie
O
. 
Chemokines: a new classification system and their role in immunity
.
Immunity
2000
;
12
:
121
7
.
13.
Zhou
Y
,
Larsen
PH
,
Hao
C
,
Yong
VW
. 
CXCR4 is a major chemokine receptor on glioma cells and mediates their survival
.
J Biol Chem
2002
;
277
:
49481
7
.
14.
Burger
JA
,
Kipps
TJ
. 
CXCR4: a key receptor in the crosstalk between tumor cells and their microenvironment
.
Blood
2006
;
107
:
1761
7
.
15.
Spano
JP
,
Andre
F
,
Morat
L
,
Sabatier
L
,
Besse
B
,
Combadiere
C
, et al
Chemokine receptor CXCR4 and early-stage non-small cell lung cancer: pattern of expression and correlation with outcome
.
Ann Oncol
2004
;
15
:
613
7
.
16.
Scala
S
,
Ottaiano
A
,
Ascierto
PA
,
Cavalli
M
,
Simeone
E
,
Giuliano
P
, et al
Expression of CXCR4 predicts poor prognosis in patients with malignant melanoma
.
Clin Cancer Res
2005
;
11
:
1835
41
.
17.
Koishi
K
,
Yoshikawa
R
,
Tsujimura
T
. 
Persistent CXCR4 expression after preoperative chemoradiotherapy predicts early recurrence and poor prognosis in esophageal cancer
.
World J Gastroenterol
2006
;
12
:
7585
90
.
18.
Jiang
YP
,
Wu
XH
,
Shi
B
,
Wu
WX
,
Yin
GR
Expression of chemokine CXCL12 and its receptor CXCR4 in human epithelial ovarian cancer: an independent prognostic factor for tumor progression
.
Gynecol Oncol
2006
;
103
:
226
33
.
19.
Barbero
S
,
Bonavia
R
,
Bajetto
A
,
Porcile
C
,
Pirani
P
,
Ravetti
JL
, et al
Stromal cell-derived factor 1a stimulates human glioblastoma cell growth through the activation of both extracellular signalregulated kinases 1/2 and Akt
.
Cancer Res
2003
;
63
:
1969
74
.
20.
Saur
D
,
Seidler
B
,
Schneider
G
,
Algül
H
,
Beck
R
,
Senekowitsch-Schmidtke
R
, et al
CXCR4 expression increases liver and lung metastasis in a mouse model of pancreatic cancer
.
Gastroenterology
2005
;
129
:
1237
50
.
21.
Ohira
S
,
Sasaki
M
,
Harada
K
,
Sato
Y
,
Zen
Y
,
Isse
K
, et al
Possible regulation of migration of intrahepatic cholangiocarcinoma cells by interaction of CXCR4 expressed in carcinoma cells with tumor necrosis factor-a and stromal-derived factor-1 released in stroma
.
Am J Pathol
2006
;
168
:
1155
68
.
22.
Chen
GS
,
Yu
HS
,
Lan
CC
,
Chow
KC
,
Lin
TY
,
Kok
LF
, et al
CXC chemokine receptor CXCR4 expression enhances tumorigenesis and angiogenesis of basal cell carcinoma
.
Br J Dermatol
2006
;
154
:
910
18
.
23.
Son
BR
,
Marquez-Curtis
LA
,
Kucia
M
,
Wysoczynski
M
,
Turner
AR
,
Ratajczak
J
, et al
Migration of bone marrow and cord blood mesenchymal stem cells in vitro is regulated by stromal-derived factor-1-CXCR4 and hepatocyte growth factor-c-met axes and involves matrix metalloproteinases
.
Stem Cells
2006
;
24
:
1254
64
.
24.
Tang
CH
,
Tan
TW
,
Fu
WM
,
Yang
RS
. 
Involvement of matrix metalloproteinase-9 in stromal cell-derived factor-1/CXCR4 pathway of lung cancer metastasis
.
Carcinogenesis
2008
;
29
:
35
43
.
25.
Chu
CY
,
Cha
ST
,
Chang
CC
,
Hsiao
CH
,
Tan
CT
,
Lu
YC
, et al
Involvement of matrix metalloproteinase-13 in stromal-cell-derived factor 1 alpha-directed invasion of human basal cell carcinoma cells
.
Oncogene
2007
;
26
:
2491
501
.
26.
Ishikawa
T
,
Nakashiro
K
,
Hara
S
,
Klosek
SK
,
Li
C
,
Shintani
S
, et al
CXCR4 expression is associated with lymph-node metastasis of oral squamous cell carcinoma
.
Int J Oncol
2006
;
28
:
61
6
.
27.
de Vicente
JC
,
Fresno
MF
,
Villalain
L
,
Vega
JA
,
Hernández
Vallejo G
Expression and clinical significance of matrix metalloproteinase-2 and matrix metalloproteinase-9 in oral squamous cell carcinoma
.
Oral Oncol
2005
;
41
:
283
93
.
28.
Livak
KJ
,
Schmittgen
TD
. 
Analysis of relative gene expression data using real-time quantitative PCR and the 2-delta delta Ct method
.
Methods
2001
;
25
:
402
8
.
29.
Kukreja
P
,
Abdel-Mageed
AB
,
Mondal
D
,
Liu
K
,
Agrawal
KC
Up-regulation of CXCR4 expression in PC-3 cells by stromal-derived factor-1A (CXCL12) increases endothelial adhesion and transendothelial migration: role of MEK/ERK Signaling pathway–dependent NF-KB activation
.
Cancer Res
2005
;
65
:
9891
8
.
30.
Mori
T
,
Doi
R
,
Koizumi
M
,
Toyoda
E
,
Ito
D
,
Kami
K
, et al
CXCR4 antagonist inhibits stromal cell-derived factor 1-induced migration and invasion of human pancreatic cancer
.
Mol Cancer Ther
2004
;
3
:
29
37
.
31.
Zou
YR
,
Kottmann
AH
,
Kuroda
M
,
Taniuchi
I
,
Littman
DR
Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development
.
Nature
1998
;
393
:
595
9
.
32.
Teichgraeber
JF
,
Clairmont
AA
. 
The incidence of occult metastases for cancer of the oral tongue and floor of the mouth: treatment rationale
.
Head Neck Surg
1984
;
7
:
15
21
.
33.
Byers
RM
,
El-Naggar
AK
,
Lee
YY
,
Rao
B
,
Fornage
B
,
Terry
NH
, et al
Can we detect or predict the presence of occult nodal metastases in patients with squamous carcinoma of the oral tongue?
Head Neck
1998
;
20
:
138
44
.
34.
Muller
A
,
Homey
B
,
Soto
H
,
Ge
N
,
Catron
D
,
Buchanan
ME
, et al
Involvement of chemokine receptors in breast cancer metastasis
.
Nature
2001
;
410
:
50
6
.
35.
Taichman
RS
,
Cooper
C
,
Keller
ET
,
Pienta
KJ
,
Taichman
NS
,
McCauley
LK
Use of the stromal cell-derived factor-1/CXCR4 pathway in prostate cancer metastasis to bone
.
Cancer Res
2002
;
62
:
1832
7
.
36.
Geminder
H
,
Sagi-Assif
O
,
Goldberg
L
,
Meshel
T
,
Rechavi
G
,
Witz
IP
, et al
A possible role for CXCR4 and its ligand, the CXC chemokine stromal cell-derived factor-1, in the development of bone marrow metastases in neuroblastoma
.
J Immunol
2001
;
167
:
4747
57
.
37.
Murphy
PM
. 
Chemokines and the molecular basis of cancer metastasis
.
N Engl J Med
2001
;
345
:
833
5
.
38.
Uchida
D
,
Begum
NM
,
Almofti
A
,
Nakashiro
K
,
Kawamata
H
,
Tateishi
Y
, et al
Possible role of stromal-cell-derived factor-1/CXCR4 signaling on lymph node metastasis of oral squamous cell carcinoma
.
Exp Cell Res
2003
;
290
:
289
302
.
39.
Tamamuraa
H
,
Horib
A
,
Kanzakib
N
,
Hiramatsu
K
,
Mizumoto
M
,
Nakashima
H
, et al
T140 analogs as CXCR4 antagonists identified as anti-metastatic agents in the treatment of breast cancer
.
FEBS Lett
2003
;
550
:
79
83
.
40.
Egeblad
M
. 
New functions for the matrix metalloproteinases in cancer progression
.
Nat Rev Cancer
2002
;
2
:
161
74
.
41.
Ohbayashi
H
. 
Matrix metalloproteinases in lung diseases
.
Curr Protein Pept Sci
2002
;
3
:
409
21
.
42.
Zucker
S
,
Cao
J
. 
Imaging metalloproteinase activity in vivo
.
Nature Med
2001
;
7
:
655
6
.
43.
Lee
JI
,
Jin
BH
,
Kim
MA
,
Yoon
HJ
,
Hong
SP
,
Hong
SD
Prognostic significance of CXCR-4 expression in oral squamous cell carcinoma
.
Oral Surg Oral Med Oral Pathol Oral Radiol Endod.
2009
;
107
:
678
84
.
44.
Muller
A
,
Sonkoly
E
,
Eulert
C
,
Gerber
PA
,
Kubitza
R
,
Schirlau
K
, et al
Chemokine receptors in head and neck cancer: association with metastatic spread and regulation during chemotherapy
.
Int J Cancer
2006
;
118
:
2147
57
.
45.
Overall
CM
,
Kleifeld
O
. 
Towards third generation matrix metalloproteinase inhibitors for cancer therapy
.
Br J Cancer
2006
;
94
:
941
6
.
46.
Westermarck
J
,
Kahari
VM
. 
Regulation of matrix metalloproteinase expression in tumor invasion
.
FASEB J
1999
;
13
:
781
92
.
47.
Simon
C
,
Goepfert
H
,
Boyd
D
. 
Inhibition of the p38 mitogen-activated protein kinase by SB 203580 blocks PMA-induced Mr 92,000 type IV collagenase secretion and in vitro invasion
.
Cancer Res
1998
;
58
:
1135
9
.
48.
Johansson
N
,
Ala-aho
R
,
Uitto
V
. 
Expression of collagenase-3 (MMP-13) and collagenase-1 (MMP-1) by transformed keratinocytes is dependent on the activity of p38 mitogen-activated protein kinase
.
J Cell Sci
2000
;
113
:
227
35
.