Multiple endocrine neoplasia type 1 (MEN-1) is a heritable syndrome typified by tumors in multiple endocrine organs, including the pituitary, parathyroids, and pancreatic islets. MEN-1 is attributable to mutations in the MEN1 tumor-suppressor gene that encodes the menin protein. Recent studies have implicated menin in transcriptional regulation and in covalent histone modification; however, little is known about modifications of the menin protein. Here, we report that menin is subject to phosphorylation on serine residues, including Ser543 and Ser583. Phosphorylation-defective mutants of either or both of these residues retain the associated histone methyltransferase activity of menin, as well as binding to the trithorax complex members Ash2L, Rbbp5, and MLL2 and to RNA polymerase II. Chromatin immunoprecipitation experiments reveal that binding of menin to the Hoxc8 locus is not affected by phosphorylation on Ser543 or Ser583. (Mol Cancer Res 2006;4(10):793–801)

The MEN1 gene is mutated in the germ line of patients with multiple endocrine neoplasia type 1 (MEN-1). The clinical manifestation of MEN-1 is characterized by pituitary and parathyroid hyperplasias and adenomas, neuroendocrine tumors of the gut, and carcinoids of the lung (1); the disease occurs either sporadically or as a familial trait with an autosomal dominant mode of inheritance (2). Germ line mutations in the MEN1 gene have been described in familial and sporadic MEN-1 patients (3-6). Somatic mutations in MEN1 are seen in a variety of MEN-1–related tumors (7-9). The mutations are typically missense, frameshift, or truncation mutations within the open-reading frame, with no mutational hotspots. The second, wild-type allele is lost in tumors from these patients. The MEN1 gene is thus proposed to function as a tumor-suppressor gene, as inferred from the frequent allelic loss in MEN-1–associated tumors (10). Mouse genetic experiments, combined with human genetic data, support the conclusion that MEN1 is a tumor-suppressor gene. Heterozygous MEN1 knockout mice develop multiple endocrine tumors similar to those found in human MEN-1 patients, whereas homozygous deletion is embryonic lethal (11-13). Furthermore, disruption of the MEN1 gene in pancreatic islet β cells has been shown to result in tumor development (14, 15).

The amino acid sequence of the menin protein, which exhibits no sequence similarity with any other known proteins, is highly conserved; orthologues have been identified in vertebrates and Drosophila (16-20), but not in the genomes of yeast or Caenorhabditis elegans. The 610-amino-acid sequence of menin exhibits no identifiable functional motifs, except for two novel and independent carboxyl-terminal nuclear localization signals (21), consistent with its predominantly nuclear distribution (21, 22). Despite the limited tumor spectrum for MEN1 mutations, menin is ubiquitously expressed (23) and is likely to have a universal function. A number of studies revealed that menin interacts with a variety of proteins and may play a significant role in transcriptional regulation. Menin has been proposed to be both an activator and a repressor of transcription. The human MEN1 gene was found to directly repress telomerase expression (24). The activator protein-1 transcription factor JunD, nuclear factor-κB, nm23, Pem, Smad-3, replication protein A, and FANCD2 have all variously been reported to interact with menin (for review, see ref. 25).

We have previously proposed that one mechanism of action of menin is transcriptional activation or repression of target genes by epigenetic regulation, through the methylation of histone subunits on lysine residues. We determined that menin associates with a histone methyltransferase (HMTase) complex containing MLL2, a homologue of mixed lineage leukemia (MLL), as well as other mammalian homologues of the yeast SET1 complex. The menin-associated complex specifically methylates histone H3 on lysine 4, an epigenetic mark typically associated with transcriptionally active chromatin (26). We noted that MEN1 knockout embryos and cells show decreased expression of the homeobox genes Hoxc6 and Hoxc8, and that menin binds directly to the Hoxc8 locus. Menin has also been shown to interact with the proto-oncoprotein MLL in an HMTase complex similar to the MLL2-menin complex (27), and was found to be an essential component of this complex in the maintenance of HoxA9 gene expression by wild-type MLL. The MLL-menin interaction is essential for MLL-dependent leukemogenesis (28, 29). We subsequently extended the area of known menin-regulated genes by demonstrating that menin interacts with MLL to cooperatively regulate the expression of the cyclin-dependent kinase inhibitors p27Kip1 and p18Ink (30). Furthermore, we determined that the menin-dependent methylation of H3 Lys-4 is crucial in islet tumor suppression, as this maintains the in vivo expression of p27Kip1 and p18Ink4c to prevent pancreatic islet tumors (31).

Recently, a genome-wide analysis of menin binding suggested that this protein can target a broad range of promoters in multiple tissues, both in concert with, and independently of, the HMTase complex. The authors also postulated that menin may function as a corepressor of tissue-specific genes that promote cell growth, such as HLXB9, and that this activity may contribute to the bias in endocrine tumor formation in MEN1 (32). Overall, these findings implicate menin in the regulation of both cell differentiation and cell cycle regulation, as well as global transcriptional regulation.

In a previous report (26), we mentioned that menin migrates as a doublet on SDS-PAGE gels, indicating a possible posttranslational modification. We decided to investigate this phenomenon further, to determine the modifications that menin undergoes in vivo. Reversible protein phosphorylation, principally on serine, threonine, or tyrosine residues, is one of the most important and well-studied posttranslational modifications, and plays a critical role in the regulation of many cellular processes, including cell cycle, growth, apoptosis, and signal transduction pathways. For many proteins, multiple posttranslational modifications, such as phosphorylation, ubiquitination, and acetylation, may occur simultaneously or sequentially, and these modifications are crucial in the regulation of protein activity. The close relationship between altered posttranslational modifications in mammalian cells and developmental diseases and cancer has been well documented. In this study, we determined that menin is phosphorylated on two serine residues, Ser543 and Ser583. Mutation of these residues had no effect on either the association of menin with trithorax family complex proteins Ash2L, Rbbp5, and MLL2, or on its histone methyltransferase activity. Similarly, binding of menin to the Hoxc8 locus was unaffected. Posttranslational modifications of menin may play an as yet undetermined role in the regulation of its function as a tumor suppressor.

Menin Is Phosphorylated on Multiple Serine Residues

It was previously noted by our group that menin appeared on SDS-PAGE as a doublet (26). To examine the mobility of menin in detail, we transfected wild-type MEN1 cDNA into 293T cells. Cell lysates were subjected to immunoprecipitation and immunoblotting with anti-menin antibody directed against the COOH terminus. As can be seen in Fig. 1A, endogenous menin migrates as a doublet, with one form migrating slower than the other (top, lane 1). The difference in migration appears to be 1 to 2 kDa, a size difference consistent with phosphorylation. Investigation of transfected menin (and overexposed Western blots of endogenous menin) revealed that the protein actually migrates as two doublets (top, lane 2; bottom). The smaller form of menin in each doublet is predominant, and the larger set of doublets is more abundant than the smaller. The apparent molecular weight difference between the doublets was estimated at 5 to 10 kDa. Western blotting using anti-menin antibody generated against the NH2-terminal region (data not shown) revealed that the different isoforms could be seen with antibodies against both termini, in endogenous and transfected menin, and were therefore not due to splice variations as the transfected cDNA does not require splicing.

FIGURE 1.

Menin is phosphorylated. A. Endogenous menin (top, lane 1) and transfected menin (top, lane 2) were immunoprecipitated from 293T cells and blotted using anti-menin antibody. Two sets of doublets can be identified; the mobility shift between doublets is ∼1 to 2 kDa and between sets is ∼8 to 10 kDa. Arrows, menin isoforms. The slower-migrating set of doublets of transfected menin can be observed using a shorter exposure (bottom). B. Radiolabeled 293T cells untransfected or transfected with menin were immunoprecipitated (IP) and blotted with anti-menin antibody. Radiolabeled samples were visualized by autoradiography (top). Peptide-blocked controls (+pep) were used as negative controls in each case (lanes 1 and 4). Both transfected (lane 2) and endogenous (lane 3) menin are phosphorylated. The Western blot corresponding to each anti-menin immunoprecipitate (bottom). C. Extracts of 293T cells transfected with menin were treated with phosphatase enzyme (lane 2) and compared with untreated extract (lane 1). Samples were then immunoprecipitated and blotted using anti-menin antibody. D. Radiolabeled menin from 293T cells was digested and separated using two-dimensional gel electrophoresis. Labeled phosphoamino acids were detected by autoradiography and compared with commercial standards.

FIGURE 1.

Menin is phosphorylated. A. Endogenous menin (top, lane 1) and transfected menin (top, lane 2) were immunoprecipitated from 293T cells and blotted using anti-menin antibody. Two sets of doublets can be identified; the mobility shift between doublets is ∼1 to 2 kDa and between sets is ∼8 to 10 kDa. Arrows, menin isoforms. The slower-migrating set of doublets of transfected menin can be observed using a shorter exposure (bottom). B. Radiolabeled 293T cells untransfected or transfected with menin were immunoprecipitated (IP) and blotted with anti-menin antibody. Radiolabeled samples were visualized by autoradiography (top). Peptide-blocked controls (+pep) were used as negative controls in each case (lanes 1 and 4). Both transfected (lane 2) and endogenous (lane 3) menin are phosphorylated. The Western blot corresponding to each anti-menin immunoprecipitate (bottom). C. Extracts of 293T cells transfected with menin were treated with phosphatase enzyme (lane 2) and compared with untreated extract (lane 1). Samples were then immunoprecipitated and blotted using anti-menin antibody. D. Radiolabeled menin from 293T cells was digested and separated using two-dimensional gel electrophoresis. Labeled phosphoamino acids were detected by autoradiography and compared with commercial standards.

Close modal

To determine if menin is phosphorylated, 293T cells untransfected or transfected with menin were phosphate starved for 1 hour and radiolabeled for 3 hours with [32P]Pi. Cell lysates were subsequently immunoprecipitated with anti-menin antibody, and radiolabeled protein was detected by autoradiography; samples run in parallel were blotted with anti-menin antibody. Phosphorylation of menin is detectable in both transfected (Fig. 1B, top, lane 2) and untransfected (lane 3) samples, relative to peptide-blocked control (+pep; lanes 1 and 4). Western blotting of immunoprecipitates with anti-menin antibody detected menin in transfected (bottom, lane 2) and untransfected (lane 3) samples, but not negative controls (lanes 1 and 4).

To confirm that the mobility shift on immunoblots corresponded to menin phosphorylation, radiolabeled anti-menin immunoprecipitates and peptide-blocked control samples were treated with phosphatase enzyme. Phosphorylated menin could be detected in untreated immunoprecipitates, but not in samples treated with phosphatase (Fig. 1C). To detect specifically which residues (Ser/Thr or Tyr) are phosphorylated, cells were subjected to phosphoamino acid analysis by metabolic labeling with [32P]Pi, immunoprecipitation of menin followed by SDS-PAGE separation, and autoradiography. The appropriate band was excised from the gel, digested, and separated using two-dimensional electrophoresis. Labeled phosphoamino acids were detected by autoradiography and identified by comigration with commercial standards. Phosphoamino acid labeling of menin showed exclusive serine phosphorylation (Fig. 1D).

To determine precisely which serine residues are subject to phosphorylation, whole cell lysates of menin-transfected or untransfected 293T cells were immunoprecipitated with anti-menin antibody and samples were separated on SDS-PAGE. Bands of interest were excised and analyzed by mass spectrometry. As expected, the protein was identified as menin, represented by peptide fragments covering 87.5% of the predicted sequence. We identified S543 as the most prevalent phosphopeptide of endogenous and overexpressed menin, and thus likely to be the major phosphorylation site (under the conditions investigated in this study); an additional phosphorylation site, S583, was mapped using transfected menin (Table 1). Of the 39 serines in menin, 34 were represented by at least one peptide and 5 were not represented; 15 were represented by at least 4 peptides. Thus, we do not exclude the possibility of other serine phosphorylations and indeed we do detect residual phosphorylation of the S543A/S583A double mutant (see below).

Table 1.

Mass Spectrometric Analysis: Peptides Analyzed from Endogenous and Transfected Menin

Amino AcidEndogenous MeninTransfected MeninTotal Peptides
S15 — 
S38 — 
S66 — — — 
S84 — — — 
S104 
S113 — — — 
S114 — — — 
S122 
S128 
S130 
S132 — 
S142 — 
S145 — 
S154 — 
S155 — 
S178 — 
S219 — 
S226 — 
S246 — 
S253 — 
S308 — — — 
S381 — 
S394 — 
S399 — 
S402 — 
S427 — 
S443 — 
S459 — 
S487 — 
S512 10 
S533 
S543 2 (1) 5 (3) 7 (4) 
S555 
S572 — 
S573 — 
S583 1 (1) 3 (—) 4 (1) 
S593 — 
S596 — 
S601 — 
Amino AcidEndogenous MeninTransfected MeninTotal Peptides
S15 — 
S38 — 
S66 — — — 
S84 — — — 
S104 
S113 — — — 
S114 — — — 
S122 
S128 
S130 
S132 — 
S142 — 
S145 — 
S154 — 
S155 — 
S178 — 
S219 — 
S226 — 
S246 — 
S253 — 
S308 — — — 
S381 — 
S394 — 
S399 — 
S402 — 
S427 — 
S443 — 
S459 — 
S487 — 
S512 10 
S533 
S543 2 (1) 5 (3) 7 (4) 
S555 
S572 — 
S573 — 
S583 1 (1) 3 (—) 4 (1) 
S593 — 
S596 — 
S601 — 

NOTE: The number of identified phosphopeptides is indicated in parentheses.

To examine whether our coverage of menin phosphopeptides by mass spectrometric analysis was sufficient to identify all phosphorylation sites of the protein, stable MEN1−/− MEFs harboring vector and either wild-type menin with serine to alanine mutations (see below) at S543 and S583 were examined. Cells were phosphate-starved, radiolabeled with inorganic 33P, and immunoprecipitated with anti-menin antibody. Autoradiography of SDS-PAGE fractionated proteins revealed that menin is phosphorylated on residues in addition to those detected by mass spectrometry (data not shown).

The Phosphorylation State of Menin at Ser543 and Ser583 Does Not Affect HMT Complex Member Binding or HMTase Activity

We wished to assess the role(s) played by the phosphorylated serine residues. We used site-directed mutagenesis to convert S543 and S583 to either glutamate, which mimics the “constitutively on” phosphorylation state (33), or alanine, which acts as an unphosphorylated and unphosphorylatable residue. Transiently transfected 293T cells and stable cell lines derived from MEN1−/− MEFs harboring vector and mutated menin (one of six mutants with substitutions at either or both of the serine residues under investigation—see Materials and Methods) were established, and associated HMTase activity was assayed. We immunoprecipitated with anti-menin antibody, analyzed a fraction for menin by immunoblotting, and did HMTase assays on a second portion. As can be seen in the Fig. 2A (bottom), menin and the described mutants are expressed and can be immunoprecipitated from extracts of all the cells except the KO + pBABE cells. Reconstitution of MEN1−/− cells with wild-type menin, or any of the mutant forms examined, restored the association of HMTase activity with anti-menin immunoprecipitates (Fig. 2A, top).

FIGURE 2.

Effect of phosphorylation states of S543 or S583 on HMTase activity, subunit binding, and Hox gene expression in MEFs. A.MEN1−/− cells were infected with pBABE retroviruses containing either vector alone (KO + pBABE), WT menin (KO + pBABE menin), or one or more menin mutants: S543A, S543E, S583A, S583E, S543A S583A, or S543E S583E. Lysates from each transfected cell type were immunoprecipitated and immunoblotted for menin (bottom). Menin immunoprecipitates were incubated with [3H]S-adenosylmethionine in an HMTase assay, separated by 15% SDS-PAGE, and fluorographed (top). B. Cell lysates were immunoprecipitated with anti-menin antibody and immunoblotted with anti-menin (first panel), anti-Ash2L C19 antibody (second panel), anti-Rbbp5 antibody (third panel), or anti-RNA pol II phospho-Ser5 CTD antibody (fourth panel).

FIGURE 2.

Effect of phosphorylation states of S543 or S583 on HMTase activity, subunit binding, and Hox gene expression in MEFs. A.MEN1−/− cells were infected with pBABE retroviruses containing either vector alone (KO + pBABE), WT menin (KO + pBABE menin), or one or more menin mutants: S543A, S543E, S583A, S583E, S543A S583A, or S543E S583E. Lysates from each transfected cell type were immunoprecipitated and immunoblotted for menin (bottom). Menin immunoprecipitates were incubated with [3H]S-adenosylmethionine in an HMTase assay, separated by 15% SDS-PAGE, and fluorographed (top). B. Cell lysates were immunoprecipitated with anti-menin antibody and immunoblotted with anti-menin (first panel), anti-Ash2L C19 antibody (second panel), anti-Rbbp5 antibody (third panel), or anti-RNA pol II phospho-Ser5 CTD antibody (fourth panel).

Close modal

Next, we determined whether the phosphorylation state of either of the serine residues had an effect on the binding of menin to its associated complex members. Wild-type and mutant MEN1−/− cells (described above) were lysed, immunoprecipitated with anti-menin antibody, and blotted with anti-menin, anti-Ash2L, or anti-Rbbp5 antibodies. As can be seen in Fig. 2B, menin, Ash2L, and Rbbp5 can all be immunoprecipitated with anti-menin antibody for all of the phosphorylation site mutants of menin. Taken together, these results indicate that neither HMTase activity nor binding to HMT complex subunits Ash2L and Rbbp5 is dependent on the phosphorylation states of S543 or S583. Similarly, the association of both MLL2 and RNA polymerase II with the phosphorylation mutants of menin was examined. All mutant menin proteins were found to associate with MLL2; in addition, all interacted with RNA polymerase II phosphorylated on Ser5 (Fig. 2B, fourth panel), but not with unphosphorylated RNA polymerase II (data not shown).

Hox Binding and Gene Expression Are Not Influenced by the Phosphorylation State of Ser543 or Ser583 of Menin

The effect of each Ser→Ala or Ser→Glu mutation on the maintenance of Hox gene expression was examined in MEN1−/− MEFs. Quantitative real-time reverse transcription-PCR showed that mutation of the phosphorylation sites of menin had no significant effect on either Hoxc6 or Hoxc8 mRNA levels relative to that of β-actin (data not shown). We subsequently did chromatin immunoprecipitation assays on wild-type and mutant MEFs using anti-menin antibody. Immunoprecipitated DNA was subjected to quantitative real-time PCR using a probe to a region ∼200 bp upstream of Hoxc8 (c8P2) as previously described (26), and a Gapdh control. No significant differences were observed in the binding of the mutant menin forms to the Hoxc8 locus, compared with wild-type menin (data not shown).

Menin Isoforms Are Unaltered by Proteasomal Degradation, the DNA Damage Response, and Cellular Differentiation

Menin reportedly interacts with a wide variety of transcriptional proteins, and has been implicated in DNA replication and repair (24, 34, 35). We investigated whether menin isoforms were altered during DNA damage response. Wild-type MEFs were treated with 1,500-rad γ irradiation; lysed supernatant samples taken at various time intervals (see Materials and Methods) were separated on SDS-PAGE and blotted with anti-menin antibody. No differences in menin isoforms were observed under the conditions examined (Fig. 3A). We also treated MEF wild-type cells with the proteasome inhibitor MG132 (see Materials and Methods); there was no significant change in either the amount or the phosphorylation state of Ser543 and/or Ser583 of wild-type menin present under the conditions used in this study (data not shown), indicating that the phosphorylation of menin at these two serine residues likely serves an alternative purpose than targeting menin into the degradation pathway. To determine if menin expression or phosphorylation correlated with morphologic differentiation, HL60 cells were treated with the inducers all-trans retinoic acid or 12-O-tetradecanoylphorbol-13-acetate, which stimulate differentiation into granulocytes and macrophages, respectively. No differences in menin isoforms were observed for any of the cellular differentiation states examined (Fig. 3B).

FIGURE 3.

A. γ-Irradiation has no effect on menin isoforms. Wild-type MEFs were treated with 1,500-rad γ irradiation at time 0, 1, 2.5, and 5 hours (lanes 1-4, respectively) lysed supernatant fractions were isolated and immunoblotted with anti-menin antibody. B. Menin isoforms are unchanged by cell differentiation. HL60 cells untreated (top) or treated with all-trans retinoic acid (ATRA; 1 μmol/L, middle) or 12-O-tetradecanoylphorbol-13-acetate (TPA; 10 nmol/L, bottom) were lysed at day 1, 3, or 5, and immunoblotted with anti-menin antibody. C. Mutation of Ser543 and Ser583 has no effect on subcellular localization. Wild-type MEFs (lane 1) or MEF MEN1−/− lysates for each transfected cell type (lanes 2-9) were divided into cytoplasmic (top) and nuclear (bottom) fractions, immunoprecipitated, and immunoblotted for menin. D. Mutation of Ser543 and Ser583 has no effect on cell cycle status. MEF MEN1−/− lysates for each transfected cell type either untreated (Async), serum-starved (Starve), or treated with mimosine (Mimo), nocodozole (Noco), or hydroxyurea (HU), corresponding to asynchronous cells or cell cycle phases G0, G1, M, or S, respectively, were immunoprecipitated and blotted with anti-menin antibody (lanes 1-5, respectively). Cell cycle arrest was confirmed by fluorescence-activated cell sorting analysis of propidium iodide–stained cells (lanes 1-5, respectively).

FIGURE 3.

A. γ-Irradiation has no effect on menin isoforms. Wild-type MEFs were treated with 1,500-rad γ irradiation at time 0, 1, 2.5, and 5 hours (lanes 1-4, respectively) lysed supernatant fractions were isolated and immunoblotted with anti-menin antibody. B. Menin isoforms are unchanged by cell differentiation. HL60 cells untreated (top) or treated with all-trans retinoic acid (ATRA; 1 μmol/L, middle) or 12-O-tetradecanoylphorbol-13-acetate (TPA; 10 nmol/L, bottom) were lysed at day 1, 3, or 5, and immunoblotted with anti-menin antibody. C. Mutation of Ser543 and Ser583 has no effect on subcellular localization. Wild-type MEFs (lane 1) or MEF MEN1−/− lysates for each transfected cell type (lanes 2-9) were divided into cytoplasmic (top) and nuclear (bottom) fractions, immunoprecipitated, and immunoblotted for menin. D. Mutation of Ser543 and Ser583 has no effect on cell cycle status. MEF MEN1−/− lysates for each transfected cell type either untreated (Async), serum-starved (Starve), or treated with mimosine (Mimo), nocodozole (Noco), or hydroxyurea (HU), corresponding to asynchronous cells or cell cycle phases G0, G1, M, or S, respectively, were immunoprecipitated and blotted with anti-menin antibody (lanes 1-5, respectively). Cell cycle arrest was confirmed by fluorescence-activated cell sorting analysis of propidium iodide–stained cells (lanes 1-5, respectively).

Close modal

Menin Phosphorylation on Ser543 and Ser583 Does Not Impact Subcellular Localization or Cell Cycle Status

Phosphorylation can play a role in both the DNA damage response and subcellular localization of proteins. The two phosphorylation sites determined in this study are situated between the two nuclear localization signals located at the COOH terminus of menin, so it was hypothesized that phosphorylation at these serine residues may play a role in subcellular localization. We determined the subcellular localization of menin isoforms by cellular fractionation; wild-type and mutant menin re-expressed in MEN1−/− cells was divided into nuclear and cytoplasmic fractions following exposure to mitomycin C, and compared with untreated fractions. All isoforms were extracted with the nuclear fraction in each case (Fig. 3C), indicating that phosphorylation at Ser543 and/or Ser583 does not direct the subcellular localization of menin. We also investigated menin expression and phosphorylation on Ser543 and Ser583 in response to alterations in the cell cycle. MEF MEN1−/− cells transfected with vector alone, or wild-type or mutant menin, were treated with various drugs to arrest them in different phases of the cell cycle: mimosine to synchronize cells in G1 phase, hydroxyurea to arrest cells in S phase, nocodazole to block in G2-M phase, or serum starvation to induce proliferation arrest in G0 phase. No differences in either the levels or phosphorylation states of Ser543 and Ser583 of menin were observed for any of the cell cycle stages examined (Fig. 3D).

Posttranslational Modifications of Menin

Menin loss of function plays a significant role in human neoplasms of multiple endocrine organs (1). Despite extensive genetic and biochemical studies, the biological functions of menin remain unclear. Protein function is often under the tight regulation of posttranslational modifications such as phosphorylation. Altered protein modifications in mammalian cells are closely related to developmental diseases and cancer. As a tumor suppressor, menin may be involved in a signal transduction cascade, potentially regulating cell growth or differentiation; however, none of the upstream regulators of menin phosphorylation have been identified, and the signal transduction pathway of menin remains to be elucidated. In this study, we investigated the regulation of menin at the cellular level by posttranslational modification. We established that menin is phosphorylated; the major phosphorylation site is S543, and phosphorylation also occurs on S583. Other serine residues of menin are also subject to phosphorylation, as the double alanine substitution mutant of both sites is still phosphorylated, although the identity and significance of additional phosphorylation sites remains to be investigated.

Menin has been shown to be an essential component of both the MLL and MLL2 complexes involved in histone methyltransferase activity and epigenetic regulation. Complexes associated with several tumor-derived menin mutants lack histone methyltransferase activity, suggesting that this activity is related to the tumor-suppressor function of menin. Menin is also essential for the transcriptional activation of p27Kip1 and p18Ink4c; loss of function results in deregulated cell growth. Furthermore, menin is required for maintenance of Hox gene expression, and thus the cellular differentiation of higher eukaryotes. These findings underscore the importance of the menin-MLL histone methyltransferases in development and disease. Neither abrogation nor constitutive expression of the two serine residues examined in this study affects binding of menin to its trithorax family proteins, MLL2, Rbbp5, and Ash2L, or the associated histone methyltransferase activity. Neither does mutation of the phosphorylation sites interfere with the binding of menin to RNA polymerase II. Mutation of either or both serine residues did not alter the expression of Hoxc6 and Hoxc8 mRNA, and does not affect binding of the menin protein to the Hoxc8 locus. In addition, we did not see any effect of DNA damage or cell differentiation on wild-type menin isoforms. Mutation of Ser543 or Ser583 to either alanine or glutamate had no effect on the subcellular localization of menin; neither did mutation of these residues affect cell cycle status under the conditions examined in this study.

Although we were not able to determine the role of the Ser543 and Ser583 phosphorylations identified in this study, these modifications may play a role in the regulation of menin as a tumor-suppressor protein, and future studies should result in the elucidation of their exact function. Furthermore, we anticipate that further study may uncover additional modifications of menin. First, we know that there are additional as yet unidentified phosphorylation sites; second, there may be additional forms of posttranslational modification. The means by which posttranslational modification can modulate menin function remain to be determined by future studies. It is probable that the biological functions of menin are broad and pleiotropic; however, further investigation of the signal transduction cascades in which menin is involved, and regulated by, may lead to novel gene therapy targets in the treatment of this disease.

Plasmids and Recombinant Retroviruses

Mutations in the MEN1 gene were generated using a QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA) with primers from Invitrogen (for primer sequences, see Table 2). Fragments were digested with EcoRI and inserted into pcDNA3 expression vector (Invitrogen). Orientation of inserts was determined by PCR, and mutations were verified by automated DNA sequencing of the entire MEN1 cDNA. To generate retroviral expression vectors, the verified menin/pcDNA3 constructs were digested and inserted into appropriately digested pBABE-Hygro plasmid. Recombinant retroviruses were produced in 293T cells transiently transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA).

Table 2.

Primer Sequences for Menin Site-Directed Mutagenesis

Primer NamePrimer Sequence
S543Af ACCCGCAGCAGCACCACCGCCGGA 
S543Ar TCCGGCGGTGGTGCTGCTGCGGGT 
S583Af CAACTCACGGCACAGGCGCAAGTGCAGATGAAGAAG 
S583Ar CTTCTTCATCTGCACTTGCGCCTGTGCCGTGAGTTG 
S543Ef ACCCGCAGCAGAACCACCGCCGGA 
S543Er TCCGGCGGTGGTTCTGCTGCGGGT 
S583Ef GCAACTCACGGCACAGGAGCAAGTGCAGATGAAGAAGC 
S583Er GCTTCTTCATCTGCACTTGCTCCTGTGCCGTGAGTTGC 
Primer NamePrimer Sequence
S543Af ACCCGCAGCAGCACCACCGCCGGA 
S543Ar TCCGGCGGTGGTGCTGCTGCGGGT 
S583Af CAACTCACGGCACAGGCGCAAGTGCAGATGAAGAAG 
S583Ar CTTCTTCATCTGCACTTGCGCCTGTGCCGTGAGTTG 
S543Ef ACCCGCAGCAGAACCACCGCCGGA 
S543Er TCCGGCGGTGGTTCTGCTGCGGGT 
S583Ef GCAACTCACGGCACAGGAGCAAGTGCAGATGAAGAAGC 
S583Er GCTTCTTCATCTGCACTTGCTCCTGTGCCGTGAGTTGC 

Cell Culture, Manipulations, Infections, and Fractionation

Human embryonic kidney cells (293T cells) and HL60 cells were obtained from American Type Culture Collection (Manassas, VA), and MEN1+/+ and MEN1−/− immortalized mouse embryo fibroblasts (MEF) were established in the laboratories of X. Hua as described (34). HL60 cells were maintained in Iscove's modified Dulbecco's medium containing 20% FCS (Gemini, Woodland, CA). Other cell lines were maintained in DMEM, supplemented with 10% FCS, plus penicillin and streptomycin. To generate MEN1−/− MEFs stably expressing recombinant human menin and mutants, cells were infected with the corresponding recombinant retroviruses: pBABE-Hygro alone, pBABE-Hygro-MEN1, or pBABE-Hygro expressing one of the six MEN1 mutants (S543A; S543E; S583A, S583E, S543AS583A; and S543ES583E). Infected cell lines were selected with hygromycin at 200 μg/mL for 1 week. Nuclear and cytoplasmic fractions were isolated using a NE-PER kit (Pierce, Rockford, IL).

Antibodies

Anti-menin, anti-Ash2 (C19), and anti-Rbbp5 antibodies are rabbit polyclonal antibodies made by Bethyl Laboratories (Montgomery, TX) as previously described (26). RNA polymerase II CTD repeat YSPTSPS antibody and phosphorylated Ser5 were obtained from Abcam (Cambridge, MA). Normal rabbit IgG and normal mouse IgG and IgM were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Alexa Fluor 488–conjugated mouse anti-human CD11b/Mac-1 antibody was obtained from BD Biosciences (PharMingen, San Diego, CA).

Immunoprecipitation, Western Blotting, Phosphatase Treatment, and Mass Spectrometry

For immunoprecipitations, 293T or MEF cell lines were washed twice with PBS and lysed with detergent lysis buffer [250 mmol/L NaCl, 50 mmol/L Tris (pH 8.0), 5 mmol/L EDTA, 0.5% NP40, using Complete Protease Inhibitor (Roche, Indianapolis, IN) at 2× strength]. Specific antibodies, described above, or antibodies blocked with peptide (preincubated 1:1 on ice for 1 hour before immunoprecipitation) and Protein A Sepharose CL-4B (Amersham Biosciences, Piscataway, NJ) were used for the immunoprecipitations. Antibody dilutions used for each immunoprecipitation were as previously described (26). For in vitro phosphatase experiments, 100 μg cell extract were incubated for 15 minutes at 30°C with 100 units of λ protein phosphatase (NEB, Ipswich, MA) in buffer. Following four washes with PBS, the immunoprecipitates were separated by SDS-PAGE and transferred to nitrocellulose membrane (Schleicher & Schuell, Keene, NH). Membranes were blotted with appropriate antibody and signals were observed using the ECL Plus Western blotting detection system (Amersham Biosciences). For mass spectrometry, immunoprecipitates were fractionated on 8% gels and stained with Coomassie blue. Bands of interest were excised and digested with trypsin, chymotrypsin, or elastase. Mass spectrometry was done at the Taplin Biological Mass Spectrometry Facility as previously described (36), using a Finnigan LTQ linear ion-trap mass spectrometer (Thermo Electron, San Jose, CA).

Phosphate Labeling

293T cells, MEN1−/− MEFs, and derivative MEF cell lines were washed with PBS and phosphate starved by incubation for 1 hour in DMEM lacking sodium phosphate (Life Technologies, Gaithersburg, MD). Cells were labeled by the addition of 3 mCi of 32P[Pi] or 33P[Pi] (Perkin-Elmer Life Sciences, Boston, MA) per plate for 3 hours. Menin was subsequently immunoprecipitated from detergent-solubilized lysates as described above. Immunoprecipitates were fractionated on 15% SDS-PAGE gels and dried, and radiolabeled proteins were detected by autoradiography.

Phosphoamino Acid Labeling

Two-dimensional phosphoamino acid analysis was conducted by excising the appropriate 32P-labeled band from the polyvinylidene difluoride membrane, followed by hydrolysis of the sample in 6 N HCl for 2 hours at 100°C. Samples were dried; resuspended in buffer containing phosphotyrosine, phosphothreonine, and phosphoserine standards; and loaded onto cellulose thin-layer plates (Merck, Whitehouse Station, NJ). Two-dimensional electrophoresis was done at pH 1.9 in the first dimension and pH 3.5 in the second dimension (37, 38). The plates were then dried, sprayed with 0.25% (w/v) ninhydrin in acetone, and baked at 65°C for 20 minutes. Phosphoamino acids were visualized by autoradiography and compared with localization of unlabeled standards.

Histone Methyltransferase Assays

The histone methyltransferase assay was done as previously described (26, 39). Assay buffer and core histones were obtained from the HMT Assay Reagent kit (Upstate Biotechnology, Lake Placid, NY). Laemmli sample buffer was added to 1× concentration [2% SDS, 10% glycerol, 100 mmol/L DTT, 60 mmol/L Tris (pH 6.8), and 0.001% bromophenol blue], and samples were boiled for 5 minutes, fractionated on 15% SDS-PAGE, and stained with Coomassie blue. The gel was then amplified 30 minutes (Amplify, Amersham Biosciences), dried, and exposed to film.

Proteasome Inhibition and Stimulation of DNA Damage Response

MEN1+/+ MEFs were treated with 20 μg cyclohexamide/mL to prevent further protein synthesis, and incubated in the absence or presence of the proteasome inhibitor MG132 (final concentration, 25 μmol/L; Sigma, St. Louis, MO). Whole cell extracts were prepared from samples taken at different time points between 0 and 8 hours, and the relative quantities of menin variants were examined by Western blotting using anti-menin antibody.

To determine whether menin forms were altered during DNA damage response, wild-type MEFs were treated with 1,500-rad γ irradiation, delivered using a Gammacell 40 apparatus. At time intervals between 0 and 5 hours, lysed supernatant fractions were isolated, separated on SDS-PAGE, and blotted with anti-menin antibody. For mitomycin C treatment, cells were continuously exposed to the drug (150 ng/μL) for the indicated time as previously described (40).

Cell Synchronization and Cell Differentiation

MEF MEN1−/− derivative cell lines transfected with vector alone, or wild-type or mutant menin were washed twice with serum-free medium followed by either serum starvation (0.5% serum, 48 hours), or treatment with one of the following drugs: nocodazole, 0.04 μg/mL for 16 hours; mimosine, 400 μmol/L for 16 hours; and hydroxyurea, 0.5 mmol/L for 24 hours. At the time points indicated, cell lysates were immunoblotted with anti-menin antibody. Cell cycle arrest in the appropriate phase was confirmed by fluorescence-activated cell sorting analysis of propidium iodide–stained cells (41). For the analysis of changes in posttranslational modifications of menin during cell differentiation, the cell line HL60 was incubated in the presence of each of the differentiation-inducing agents all-trans retinoic acid (1 μmol/L final concentration) or 12-O-tetradecanoylphorbol-13-acetate (10 nmol/L final concentration). Cell lysates were examined at 12-hour intervals between 0 and 5 days by immunoblotting with anti-menin antibody. Cell differentiation into macrophages or granulocytes was assessed by morphology visualization. To confirm cell differentiation, cells were washed with PBS, incubated for 45 minutes with a CD11b/Mac-1 dye-antibody conjugate, and visualized using a Becton Dickinson (Mountain View, CA) FACScan analyzer.

Real-time Quantitative PCR Analysis of Hox Gene Expression

First-strand cDNA was synthesized from total RNA (1 μg) using an oligo(dT) primer and BD Sprint PowerScript PrePrimed SingleShot reaction tubes (BD Biosciences). Reaction products were diluted in Tris-EDTA buffer, and real-time PCR quantification of Hoxc6, Hoxc8, and human MEN1 and mouse MEN1 gene expression was done in triplicate using BD Biosciences probes. Results were analyzed using a standard curve and the relative quantitation method as described in ABI User Bulletin 2. β-Actin was used as an internal reference standard. BD Biosciences probe sequences are available on request.

Chromatin Immunoprecipitation

Chromatin immunoprecipitations were done using the Chromatin Immunoprecipitation Assay kit (Upstate Biotechnology). Real-time PCR quantification of chromatin immunoprecipitation was done in triplicate using Taqman probes and an ABI Prism 7700 instrument (Applied Biosystems). Menin chromatin immunoprecipitations were quantified relative to inputs as described (42). Hoxc8 genomic Taqman probe sequence (P2) is AACACCTTCAAACTAGAGTGCACACCTTGGA. Primer sequences are available upon request.

Grant support: Pew Scholars in the Biomedical Sciences and a gift from Dr. Raymond and Beverly Sackler (M. Meyerson).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank the Taplin Biological Institute for mass spectrometry analysis, Bethyl Laboratories for preparation of polyclonal antibodies, the National Cell Culture Center for culturing cells, and J. Skaar and A. Buchmann for helpful discussions.

1
Chandrasekharappa SC, Guru SC, Manickam P, et al. Positional cloning of the gene for multiple endocrine neoplasia-type 1.
Science
1997
;
276
:
404
–7.
2
Brandi ML, Marx SJ, Aurbach GD, et al. Familial multiple endocrine neoplasia type I: a new look at pathophysiology.
Endocr Rev
1987
;
8
:
391
–405.
3
Agarwal SK, Kester MB, Debelenko LV, et al. Germline mutations of the MEN1 gene in familial multiple endocrine neoplasia type 1 and related states.
Hum Mol Genet
1997
;
6
:
1169
–75.
4
Lemmens I, Van de Ven WJ, Kas K, et al. Identification of the multiple endocrine neoplasia type 1 (MEN1) gene. The European Consortium on MEN1.
Hum Mol Genet
1997
;
6
:
1177
–83.
5
Mayr B, Apenberg S, Rothamel T, et al. Menin mutations in patients with multiple endocrine neoplasia type 1.
Eur J Endocrinol
1997
;
137
:
684
–7.
6
Bassett JH, Forbes SA, Pannett AA, et al. Characterization of mutations in patients with multiple endocrine neoplasia type 1.
Am J Hum Genet
1998
;
62
:
232
–44.
7
Debelenko LV, Brambilla E, Agarwal SK, et al. Identification of MEN1 gene mutations in sporadic carcinoid tumors of the lung.
Hum Mol Genet
1997
;
6
:
2285
–90.
8
Zhuang Z, Ezzat SZ, Vortmeyer AO, et al. Mutations of the MEN1 tumor suppressor gene in pituitary tumors.
Cancer Res
1997
;
57
:
5446
–51.
9
Hessman O, Lindberg D, Skogseid B, et al. Mutation of the multiple endocrine neoplasia type 1 gene in nonfamilial, malignant tumors of the endocrine pancreas.
Cancer Res
1998
;
58
:
377
–9.
10
Jakobovitz-Picard O, Olchovsky D, Berezin M, et al. Mutation analysis of the MEN1 gene in Israeli patients with MEN1 and familial isolated hyperprolactinemia.
Hum Mutat
2000
;
16
:
269
.
11
Crabtree JS, Scacheri PC, Ward JM, et al. A mouse model of multiple endocrine neoplasia, type 1, develops multiple endocrine tumors.
Proc Natl Acad Sci U S A
2001
;
98
:
1118
–23.
12
Bertolino P, Tong WM, Galendo D, et al. Heterozygous Men1 mutant mice develop a range of endocrine tumors mimicking multiple endocrine neoplasia type 1.
Mol Endocrinol
2003
;
17
:
1880
–92.
13
Bertolino P, Radovanovic I, Casse H, et al. Genetic ablation of the tumor suppressor menin causes lethality at mid-gestation with defects in multiple organs.
Mech Dev
2003
;
120
:
549
–60.
14
Bertolino P, Tong WM, Herrera PL, et al. Pancreatic β-cell-specific ablation of the multiple endocrine neoplasia type 1 (MEN1) gene causes full penetrance of insulinoma development in mice.
Cancer Res
2003
;
63
:
4836
–41.
15
Crabtree JS, Scacheri PC, Ward JM, et al. Of mice and MEN1: Insulinomas in a conditional mouse knockout.
Mol Cell Biol
2003
;
23
:
6075
–85.
16
Guru SC, Prasad NB, Shin EJ, et al. Characterization of a MEN1 ortholog from Drosophila melanogaster.
Gene
2001
;
263
:
31
–8.
17
Manickam P, Vogel AM, Agarwal SK, et al. Isolation, characterization, expression and functional analysis of the zebrafish ortholog of MEN1.
Mamm Genome
2000
;
11
:
448
–54.
18
Maruyama K, Tsukada T, Honda M, et al. Complementary DNA structure and genomic organization of Drosophila menin.
Mol Cell Endocrinol
2000
;
168
:
135
–40.
19
Stewart C, Parente F, Piehl F, et al. Characterization of the mouse Men1 gene and its expression during development.
Oncogene
1998
;
17
:
2485
–93.
20
Karges W, Maier S, Wissmann A, et al. Primary structure, gene expression and chromosomal mapping of rodent homologs of the MEN1 tumor suppressor gene.
Biochim Biophys Acta
1999
;
1446
:
286
–94.
21
Guru SC, Goldsmith PK, Burns AL, et al. Menin, the product of the MEN1 gene, is a nuclear protein.
Proc Natl Acad Sci U S A
1998
;
95
:
1630
–4.
22
Wautot V, Khodaei S, Frappart L, et al. Expression analysis of endogenous menin, the product of the multiple endocrine neoplasia type 1 gene, in cell lines and human tissues.
Int J Cancer
2000
;
85
:
877
–81.
23
Guru SC, Crabtree JS, Brown KD, et al. Isolation, genomic organization, and expression analysis of Men1, the murine homolog of the MEN1 gene.
Mamm Genome
1999
;
10
:
592
–6.
24
Lin SY, Elledge SJ. Multiple tumor suppressor pathways negatively regulate telomerase.
Cell
2003
;
113
:
881
–9.
25
Agarwal SK, Kennedy PA, Scacheri PC, et al. Menin molecular interactions: insights into normal functions and tumorigenesis.
Horm Metab Res
2005
;
37
:
369
–74.
26
Hughes CM, Rozenblatt-Rosen O, Milne TA, et al. Menin associates with a trithorax family histone methyltransferase complex and with the hoxc8 locus.
Mol Cell
2004
;
13
:
587
–97.
27
Yokoyama A, Wang Z, Wysocka J, et al. Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltransferase complex with menin to regulate Hox gene expression.
Mol Cell Biol
2004
;
24
:
5639
–49.
28
Yokoyama A, Somervaille TC, Smith KS, et al. The menin tumor suppressor protein is an essential oncogenic cofactor for MLL-associated leukemogenesis.
Cell
2005
;
123
:
207
–18.
29
Chen YX, Yan J, Keeshan K, et al. The tumor suppressor menin regulates hematopoiesis and myeloid transformation by influencing Hox gene expression.
Proc Natl Acad Sci U S A
2006
;
103
:
1018
–23.
30
Milne TA, Hughes CM, Lloyd R, et al. Menin and MLL cooperatively regulate expression of cyclin-dependent kinase inhibitors.
Proc Natl Acad Sci U S A
2005
;
102
:
749
–54.
31
Karnik SK, Hughes CM, Gu X, et al. Menin regulates pancreatic islet growth by promoting histone methylation and expression of genes encoding p27Kip1 and p18INK4c.
Proc Natl Acad Sci U S A
2005
;
102
:
14659
–64.
32
Scacheri PC, Davis S, Odom DT, et al. Genome-wide analysis of menin binding provides insights into MEN1 tumorigenesis.
PLoS Genet
2006
;
2
:
e51
.
33
Thorsness PE, Koshland DE, Jr. Inactivation of isocitrate dehydrogenase by phosphorylation is mediated by the negative charge of the phosphate.
J Biol Chem
1987
;
262
:
10422
–5.
34
Jin S, Mao H, Schnepp RW, et al. Menin associates with FANCD2, a protein involved in repair of DNA damage.
Cancer Res
2003
;
63
:
4204
–10.
35
Sukhodolets KE, Hickman AB, Agarwal SK, et al. The 32-kilodalton subunit of replication protein A interacts with menin, the product of the MEN1 tumor suppressor gene.
Mol Cell Biol
2003
;
23
:
493
–509.
36
Peng J, Gygi SP. Proteomics: the move to mixtures.
J Mass Spectrom
2001
;
36
:
1083
–91.
37
Boyle WJ, van der Geer P, Hunter T. Phosphopeptide mapping and phosphoamino acid analysis by two-dimensional separation on thin-layer cellulose plates.
Methods Enzymol
1991
;
201
:
110
–49.
38
Kamps MP. Determination of phosphoamino acid composition by acid hydrolysis of protein blotted to Immobilon.
Methods Enzymol
1991
;
201
:
21
–7.
39
Strahl BD, Ohba R, Cook RG, et al. Methylation of histone H3 at lysine 4 is highly conserved and correlates with transcriptionally active nuclei in Tetrahymena.
Proc Natl Acad Sci U S A
1999
;
96
:
14967
–72.
40
Garcia-Higuera I, Taniguchi T, Ganesan S, et al. Interaction of the Fanconi anemia proteins and BRCA1 in a common pathway.
Mol Cell
2001
;
7
:
249
–62.
41
Vindelov LL, Christensen IJ, Nissen NI. A detergent-trypsin method for the preparation of nuclei for flow cytometric DNA analysis.
Cytometry
1983
;
3
:
323
–7.
42
Frank SR, Schroeder M, Fernandez P, et al. Binding of c-Myc to chromatin mediates mitogen-induced acetylation of histone H4 and gene activation.
Genes Dev
2001
;
15
:
2069
–82.