Intraperitoneal Oil Application Causes Local Inflammation with Depletion of Resident Peritoneal Macrophages

This article is featured in Highlights of This Issue, p. 165

Oil is frequently used as solvent in animal research. For instance, inducible gene recombination using the Cre-ERT2-loxP system requires administration of tamoxifen, which is usually dissolved in olive, peanut, corn, or mineral oil. The oil solution is administered orally or by intraperitoneal injection. Both applications induce gene recombination to a similar extent (1, 2). Also, in a liver fibrosis model, carbon tetrachloride (CCl₄) is delivered by intraperitoneal injection in oil, inhalation, or oral gavage (3). Interestingly, intraperitoneal injection generates stronger liver fibrosis when compared with the other two administration methods (4), raising the question whether CCl₄ or its solvent act locally within the peritoneum. Indeed, intraperitoneal injection of mineral oil causes chronic inflammation (5–9). Also, subcutaneous injection of olive oil can cause lipogranuloma, a granulomatous inflammatory soft-tissue reaction (10).

Therefore, it can be assumed that any experimental immune cell analysis within the peritoneal cavity would be strongly affected by oil. It is surprising how little is known about the peritoneal immune cell reaction toward oil, and to our knowledge, comparative studies of different oils are missing.

Peritoneal inflammation can be divided into the initiation and resolution phase. Pathogens trigger infiltration of neutrophils, which phagocytose pathogens, clear apoptotic cells, and recruit monocytes from the blood stream into the peritoneal fluid. Recruited monocytes eliminate dying neutrophils and differentiate into monocyte-derived macrophages (11). This is important, as the number of resident peritoneal macrophages, which are derived from embryonic progenitors and have self-renewal capacity (12), gets strongly decreased as a result of the so called “macrophage disappearance reaction” (13). As such, resident peritoneal CD11b⁺ macrophages, expressing high F4/80 levels (F4/80^hi) get replaced by monocyte-derived CD11b⁺ macrophages, expressing low F4/80 levels (F4/80^low) on the membrane (12, 14, 15). Subsequently, monocyte-derived macrophages increase surface expression of F4/80 from a low to an intermediate level (F4/80^int) to initiate the resolution phase (16).

The switch from inflammatory to resolving macrophages is triggered by phagocytosis of apoptotic cells. Deficiency in this phagocytic process leads to chronic inflammation (17). For instance, in atherosclerotic plaques, macrophages take up excessive amounts of lipids and become foam cells, which cannot initiate the resolution phase, perpetuating further neutrophil and monocytes infiltration (18).

The aim of this study was to analyze how the most commonly used oils in animal research affect the myeloid cells within the peritoneum and whether this would diminish their capability to resolve the peritoneal inflammation.

All animal procedures were approved by the local Institutional Animal Care and Use Committee (RP Karlsruhe, Germany and DKFZ) and performed according to the guidelines of the local institution and the local government. Female C57BL/6 mice were group‐housed under specific pathogen‐free barrier conditions.

Administration of sterile peanut oil (P2144, Sigma-Aldrich), corn oil (C8267, Sigma-Aldrich), olive oil (8873.1, Carl Roth), mineral oil (HP50.2, Carl Roth), or 0.9% NaCl (Braun) in 8- to 12-week-old randomized mice was performed by daily intraperitoneal injection of 100 μL for 5 consecutive days or by oral gavage of peanut oil once with 100 μL. After 3 weeks, mice were euthanized. For peritoneal lavage, 5 mL of cold PBS (Gibco/Thermo Fisher Scientific) was intraperitoneally injected. After a careful massage to mobilize cells, peritoneal fluid was collected. Cells were isolated by centrifugation (5 minutes, 200 × g) and suspended in 1 mL of PBS.

8- to 12-week-old randomized mice were euthanized and subsequently injected intraperitoneally with peanut, olive, corn, and mineral oil. After 5 minutes, the peritoneal lavage was collected.

Three weeks after oil treatment, mice were intraperitoneally injected with thioglycolate (2 mg in 1 mL H₂O; B2551, Sigma-Aldrich). After 24 or 72 hours, mice were sacrificed and peritoneal lavage was collected. All groups were randomized.

Histologic analysis was performed on formalin‐fixed, paraffin‐embedded sections (3 μm). Sections were deparaffinized and rehydrated. For hematoxylin and eosin (H&E) and Sirius Red (Dianova) staining, sections were processed according to standard protocols. For myeloid cell staining, antigen retrieval at pH 6 with citrate buffer followed by the primary antibody, rabbit anti-mouse CD11b (1:200, ab133357, Abcam) incubated at 4°C overnight was performed. After washing, sections were incubated with secondary antibodies coupled with horseradish peroxidase (HRP; 1:200, DAKO, Agilent Technologies) for 1 hour at room temperature. For immunofluorescence staining, antigen retrieval at pH 9 was performed using citrate buffer and sections were incubated with the primary antibody rabbit anti‐mouse CD31 (1:50, ab28364, Abcam) at 4°C overnight. After washing, sections were incubated with secondary antibody (1:200) goat anti‐rabbit Alexa Fluor-647 (A21245, Life Technologies/Thermo Fisher Scientific) for 1 hour at room temperature. H&E images were obtained with Slide Scanner (Zeiss Axio Sacn.Z1, Carl Zeiss). CD11b images were obtained with Wide-field Microscope (Zeiss Axioplan, Carl Zeiss). All images were processed with ZENblue Software (Carl Zeiss). Immunofluorescence was imaged using the confocal (LSM 700, Carl Zeiss) microscope with ZENblack Software (Carl Zeiss). Sections of seven Z-stacks per omentum and mesentery and three random fluorescence images per slide were taken. Numbers of CD31-positive vessels per view field and lipid droplet size from H&E images were counted with ImageJ Software (NIH, Bethesda, MD).

Mouse macrophages were derived from the bone marrow of wild-type C57BL/6 mice and cultured for 7 days in DMEM supplemented with 10% FCS (Biochrom) and 10 ng/mL recombinant mouse M-CSF (R&D Systems).

Cell line was Mycoplasma free, which was regularly tested by PCR-based detection methods (last test September 2020). J774A.1 cells were kindly provided by Dr. R. Offringa (DKFZ Heidelberg, Heidelberg, Germany; authentication was not performed). Cells were cultured in DMEM with 10% FCS (Biochrom). All experiments were performed between second and fifth passage upon thawing.

Peritoneal lavage was plated into one well of a 6-well plate on top of coverslips and incubated for 30 minutes with DMEM (Thermo Fisher Scientific). Afterwards, nonadherent cells were removed by carefully washing three times with PBS. Bone marrow–derived macrophages (BMDM) and J774A.1 cells were seeded (5 × 10⁵ cells/well) into 12-well plates on coverslips and treated with 100 μL oil in 1 mL medium for 4 hours. Cells on coverslips were stained with Oil Red O (O0625, Sigma-Aldrich) following the protocol published elsewhere (19) and counterstained with hematoxylin. Images were obtained with Wide-field Microscope (Zeiss Axioplan Carl Zeiss). Numbers of stained lipids per view field were counted with ImageJ Software (NIH, Bethesda, MD).

Peritoneal lavage was plated into one well of a 24-well plate on top of coverslips and incubated for 30 minutes with DMEM (Thermo Fisher Scientific). Afterwards, nonadherent cells were removed by carefully washing three times with PBS. BMDMs and J774A.1 cells were cultured in DMEM with 10% FCS (Biochrom) and 2 × 10⁵ cells per well were seeded into 24-well plates on top of coverslips. All cell types were treated with 100 μL oil in 1 mL medium for 4 hours. Cells were washed with PBS and fixed with 4% PFA for 10 minutes. Then, the coverslips were washed three times for 5 minutes with PBS, permeabilized with PBS + 0.1% Triton X-100 for 10 minutes, and blocked for 1 hour in PBS in 5% FCS with 0.1% Tween-20 and 100 mmol/L glycine. The coverslips were incubated with antibody against CD36 (1:500, Abcam, ab124515) overnight at 4°C. The coverslips were rinsed three times in PBST and incubated with a secondary antibody coupled to Alexa Fluor‐488 for 1 hour. The coverslips were washed again and incubated with a DAPI solution before they were washed again. Coverslips were mounted and imaged with a Confocal Microscope (LSM 710, Carl Zeiss). All images were processed with ZENblack Software (Carl Zeiss). Average mean intensities per image were counted with ImageJ Software (NIH, Bethesda, MD).

Cells obtained from peritoneal lavage were washed and erythrocytes were lysed with ACK Lysis Buffer (Thermo Fisher Scientific). Cells were suspended at approximately 10⁶ cells per mL in PBS with 2% FCS. Cell suspensions were incubated with the different fluorophore-coupled primary antibodies for 20 minutes on ice. The following antibodies were used: CD45 (552848), CD11b (552850), CD19 (560375), Ly6G (560600), Ly6C (560594), and F4/80-like (564227) all from BD Biosciences, CD3 (100203) and F4/80 (123128) from BioLegend, and Tim4 (12-5866-82, Life Technologies/Thermo Fisher Scientific). Concentration of the different antibodies was determined by titration. Flow cytometry results in percentage were extrapolated to the total amount of cells obtained from the previous cell counting.

Cell lysates were separated by SDS-PAGE and proteins were blotted on nitrocellulose membranes. Membranes were blocked with 5% skim milk in TBS with 1% Tween-20. The following primary antibodies were used: CD36 (ab124515), VCP (ab11433) from Abcam, ABCG1 (NB400-132SS, Novus Biologicals), Cleaved-Caspase 3 (Asp175; 9664S), Arginase-1 (D4E3M; 93668S) from Cell Signaling Technology, and Caspase 1 (14F468; sc-56036, Santa Cruz Biotechnology). Primary antibodies were incubated overnight at 4°C and appropriate HRP-conjugated secondary antibodies (DAKO, Agilent Technologies) were incubated for 1 hour at room temperature. Chemiluminescence was detected by Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) and ChemiDoc Imaging System (Bio-Rad) and quantified with Image Lab 3.0 Software (Bio-Rad).

RNA was isolated using the innuPREP RNA Mini Kit (Analytik Jena). cDNA was synthesized with the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems). The cDNA was applied to qPCR using the POWER SYBR Green Master Mix (Applied Biosystems). Fold changes were assessed by 2^−ΔΔC_t method and normalized with the CPH gene. The following primers were used for qPCR: CD36 forward: GCAAAACGACTGCAGGTCAA and reverse: GGCCATCTCTACCATGCCAA; ABCG1 forward: CTTTCCTACTCTGTACCCGAGG and reverse: CGGGGCATTCCATTGATAAGG; IL10 forward: GCATGGCCCAGAAATCAAGG and reverse: GAGAAATCGATGACAGCGCC; and CPH forward: ATGGTCAACCCCACCGTG and reverse: TTCTTGCTGTCTTTGGAACTTTGTC.

BMDMs and J774A.1 cells were plated at 5 × 10⁵ cells per well into a 12-well plate with 100 μL of the different oils in 1 mL medium and incubated for 4 hours. Afterwards, supernatant and attached cells were collected and stained with Annexin V-FITC (640905, BioLegend) and PI (Cayman Chemical) and incubated for 15 minutes on ice. After washing, cells were immediately analyzed by flow cytometry.

An Apoptosis/Necrosis Immunofluorescence Assay Kit (ab176749, Abcam) was used for the detection of necrosis or apoptosis cell death. BMDMs and J774A.1 cells were plated at 5 × 10⁵ cells per well into a 24-well plate on top of a coverslip. To each well, 100 μL of oil was added in a final volume of 1 mL medium and incubated for 2 hours. Afterwards, the staining was performed following the manufacturer's protocol. Three fluorescence images of each channel at fixed positions of each triplicate were collected with the wide-field Cell Observer Microscope (Carl Zeiss) with ZENblue Software (Carl Zeiss). FIJI software was employed for the quantification of positive cells of each channel per field.

For determination of lactate dehydrogenase (LDH) activity in the cell supernatant, BMDMs and J774A.1 cells were plated at 5 × 10⁴ cells per well into a 96-well plate with 100 μL of medium containing 10 μL oil in triplicates and incubated for 1 and 2 hours, respectively. Oleic Acid (O1008, Sigma-Aldrich), diluted in absolute EtOH, was added to the medium or mixed with 5 μL peanut oil when indicated. Then, levels of LDH were detected using the LDH-Cytotoxicity Assay Kit (Ab65393, Abcam) following the manufacturer's protocol.

GraphPad Prism 8 (GraphPad Software) was used to generate graphs and for statistical analysis. Statistical significance was calculated using one-way or two-way ANOVA as indicated in the figure legends. Datasets are presented as mean ± SD. P < 0.05 was considered as significant.

Peanut, olive, corn, and mineral oil were injected into the peritoneum (intraperitoneally) of adult mice for 5 consecutive days. This mimics a typical protocol for delivering tamoxifen to induce gene recombination in transgenic mice expressing Cre^ERT2 recombinase (2). Analysis was done 3 weeks later. Untreated mice and mice treated with peanut oil by oral gavage were used as controls (Fig. 1A). Mice showed no signs of discomfort or adversities after treatment with the different oils. In addition, there was no difference in terms of body weight throughout the course of the experiment (Supplementary Fig. S1A).

In contrast to untreated mice or those receiving oil by oral gavage, the intraperitoneally injected mice showed macroscopically visible alterations in the peritoneal cavity. Peanut oil was still visible as oil droplets (Fig. 1B), whereas this was not the case for the other oils. White nodules, in the size of <3 mm, were visible on the surface of liver, diaphragm, or colon in mice receiving peanut (4/5 mice), olive (4/5 mice), and mineral (5/5 mice) oil intraperitoneally, but not corn oil. The nodules formed because of olive oil treatment were only loosely attached to the organ surfaces, whereas the nodules in mice that were intraperitoneally injected with peanut or mineral oil were firmly attached to the liver surface (Fig. 1B).

Histologic analysis revealed no pathologic changes in liver (Fig. 1C) and spleen (Supplementary Fig. S1B) of mice that received intraperitoneal injection of oil. The nodules that were firmly attached to the liver surface in mice treated with peanut or mineral oil could be classified as xanthogranulomas with foamy macrophages and mixed inflammatory background (Fig. 1C).

Next, we examined the greater omentum. The greater omentum is an organ that filters excessive fluid from the abdominal cavity, senses microorganisms or damaged cells, initiates immune responses, and supports repair of damaged organs (20). Omenta of mice treated with oral gavage were indistinguishable from those of untreated mice. However, omenta of mice that received intraperitoneal oil injections showed a remarkable change in morphology. The omenta were swollen, darker, and had enlarged blood vessels, particularly in mice treated with peanut and mineral oil (Fig. 2A). Histologic analysis revealed that lipid droplet size in adipocytes was reduced in mice treated intraperitoneally with any of the different oils. Again, the changes were most pronounced in mice injected with peanut and mineral oil (Fig. 2B and F).

IHC analysis of CD31-positive endothelial cells revealed an increase in vessel density in the omenta after oil injection. It was strongly increased in the case of peanut and mineral oil, but mild in olive oil- and corn oil–treated mice (Fig. 2C and G). In addition, higher numbers of CD11b⁺ myeloid cells were present in all four oil-treated mice, but again, peanut oil- and mineral oil–treated mice had highest infiltration rates (Fig. 2D).

So far, the described changes are indicative of peritoneal inflammation upon local oil injection. Prolonged inflammation may impede tissue healing resulting in organ fibrosis. Indeed, Sirius Red staining revealed an increase in collagen deposition, a typical sign of fibrosis, in the greater omentum of mice injected with oil intraperitoneally. Such fibrotic changes were in particular observed in mice treated with peanut and mineral oil (Fig. 2E).

Histopathologic scoring of the inflammation grade in the greater omentum by H&E staining was based on the granularity of the tissue, the presence of foamy macrophages or other inflammatory cells, multinucleated giant cells, fibrosis, or necrosis with a score from 0 (no inflammation) to 3 (severe chronic inflammation). This showed that intraperitoneal injection of all four oils causes xanthogranulomatous inflammation of the omentum with highest scores for mineral and peanut oil. (Fig. 2H).

Similar data were obtained during the analysis of mesentery. The almost transparent membrane became opaque in mice treated intraperitoneally with oil. The strongest changes were observed in mice treated with peanut and mineral oil (Fig. 3A). Lipid droplets in adipocytes of mesentery from mineral oil–treated mice were much smaller compared with controls. Such changes were also observed, but to a lesser extent, in mice injected intraperitoneally with peanut oil, whereas the effects of olive and corn oil were mild (Fig. 3B and F). The number of blood vessels was increased in peanut oil- and mineral oil–treated mice (Fig. 3C and G). We detected increased numbers of CD11b⁺ myeloid cells in the mesentery of olive oil-, corn oil-, and peanut oil–treated mice, and to the maximum extent in mineral oil–treated mice (Fig. 3D). There was mild fibrosis in the mesentery of mice treated with peanut oil and severe fibrosis in mice that had received mineral oil (Fig. 3E). Histopathologic scoring of the inflammation grade revealed that peanut and mineral oil, but not olive and corn oil, generated xanthogranulomatous inflammation (Fig. 3H).

In summary, the histopathologic analysis revealed that mineral oil and peanut oil induce a strong xanthogranulomatous inflammatory response in the peritoneum. Olive and corn oils also induce inflammation, but to a much lesser degree.

To further analyze the immune response, peritoneal lavage was obtained 3 weeks after the intraperitoneal injection. Flow cytometry revealed that the total cell number in the peritoneal lavage was significantly increased in mice treated with either peanut or mineral oil compared with untreated animals (Fig. 4A). The vast majority of the cell population was myeloid cells (CD45⁺CD19⁻CD11b⁺). Peanut and mineral oil increased the total number of myeloid cells, whereas olive and corn oil had no significant effect (Fig. 4B; Supplementary Fig. S2A).

We also observed that oil injection led to a decrease in the number of B (CD45⁺CD19⁺CD3⁻) and T lymphocytes (CD45⁺CD19⁻CD3⁺; Supplementary Fig. S2B). This was expected, as during peritoneal inflammation lymphocytes migrate from the peritoneal fluid into the greater omentum (21, 22).

A more detailed evaluation of the myeloid population revealed that peanut and mineral oil injections strongly increased the presence of neutrophils (CD45⁺CD11b⁺Ly6G⁺Ly6C^int) and recruited monocytes (CD45⁺CD11b⁺Ly6G⁻Ly6C⁺) in the peritoneal fluid. Neutrophils and infiltrated monocytes were almost absent in peritoneal lavage derived from untreated mice or mice treated with olive oil, corn oil, or oral gavage (Fig. 4C–E).

Importantly, the injection itself did not cause such alterations. Injection of 0.9% NaCl did not lead to macroscopic or histologic changes, nor to significant changes in total number of cells in peritoneal fluid or changes within the myeloid cell compartment (Supplementary Fig. S3A–S3G).

During inflammation, neutrophils are the first cells to be recruited to clear apoptotic cells or eliminate pathogens. Afterwards, monocytes reach the inflamed zone to eliminate dying neutrophils and to differentiate into macrophages. The latter is in particular essential when resident macrophages are eradicated. Therefore, we next examined the macrophage population within the peritoneum. The total macrophage (CD45⁺CD11b⁺F4/80⁺) cell number was not significantly changed in peritoneal lavage of mice treated intraperitoneally with oil compared with the untreated mice or to those who received oil by oral gavage (Fig. 4F).

We further characterized the F4/80 population by analyzing the amount of Tim4 on the cell surface, as Tim4 can be employed as a marker to differentiate long-term (F4/80⁺Tim4⁺) from newly recruited (F4/80⁺Tim4⁻) resident macrophages (23). This revealed that all four oils led to a dramatic decrease in long-term resident (F4/80⁺Tim4⁺) macrophages and a replacement by recently recruited (F4/80⁺Tim4⁻) macrophages (Fig. 4G).

The level of F4/80 on the macrophage cell membrane varies depending on the differentiation stage (15). In this regard, resident macrophages express high levels of F4/80 (F4/80^hi), while newly recruited monocyte-derived macrophages express low to intermediate levels (F4/80^int). Peanut oil injection led to a strong decrease in resident F4/80^hi macrophage numbers (Fig. 4H). Mineral oil showed a similar, but not significant trend, whereas olive oil and corn oil did not alter the proportion of F4/80^hi macrophages.

The full resolution of inflammation is carried out by F4/80^int macrophages (16). Analysis of this cell population revealed that only the intraperitoneal injection of olive oil led to a significant increase in F4/80^int macrophages at this timepoint (Fig. 4I).

Collectively, the data imply that injection of any oil into the peritoneum triggers an inflammatory response in which resident macrophages get replaced by monocyte-derived ones. However, the resolution of inflammation depends on the type of oil, with olive oil and corn oil (to a lesser extent) showing signs of resolution.

Monocytes and macrophages can take up excessive amounts of lipids (24). Therefore, we examined lipid uptake in macrophages upon oil injection. Peritoneal lavage was performed 3 weeks after intraperitoneal oil injection. Adherent peritoneal macrophages were stained with Oil Red O, which marks lipids and neutral triglycerides. Macrophages derived from the control mice were not stained by Oil Red O, while peritoneal macrophages derived from mice injected intraperitoneally with peanut oil contained multiple large lipid droplets. Fewer amounts were detected in the macrophages derived from the olive oil and corn oil group, whereas the macrophages of the mineral oil group contained almost no detectable lipid droplets (Fig. 5A and C).

To further evaluate this, we tested lipid uptake in BMDMs and the J774A.1 macrophage cell line. Macrophages took up lipids when in contact with olive, corn, and peanut oil, but not mineral oil, suggesting that the effect of this oil is independent of the cellular lipid uptake (Fig. 5B and D; Supplementary Fig. S4A and S4B).

In atherosclerotic plaques, monocyte-derived macrophages endocytose lipids, such as oxidized LDL, and become foam cells. During this transition, an upregulation of the fatty acid translocase (CD36) expression and downregulation of the cholesterol transporter, ABCG1, are evident (25). Macrophages showed the same changes in gene expression when cultured for 4 hours in the presence of vegetal oils (Fig. 5E and F; Supplementary Fig. S4C–S4F). Furthermore, immunofluorescence staining of freshly isolated peritoneal macrophages and also BMDMs confirmed that CD36 protein was not only upregulated, but also differently localized upon incubation with the vegetable oils (Fig. 5G–J). This change in CD36 localization has been shown to mediate fatty acid uptake through vesicle internalization (26).

In summary, these results indicate that peanut, olive, and corn oil, but not mineral oil, intraperitoneal injection leads to foam cell formation.

Lipoprotein uptake can cause macrophage cell death (27). Therefore, we evaluated whether peritoneal macrophage cell death is induced by the four different oils. Mice were injected once intraperitoneally with 100 μL oil and 5 minutes later, peritoneal cells were harvested and subjected to flow cytometry (Fig. 6A). This revealed that compared with untreated mice there was approximately a 50% decrease in CD11b⁺F4/80⁺ macrophages in the peritoneum of mice that received any of the oils (Fig. 6B). There was a 5%–10% decrease in the fraction of live cells (Annexin V⁻ and PI⁻) and an equivalent increase of necrotic (PI⁺), apoptotic (Annexin V⁺), and Annexin V⁺PI⁺ cells in the peritoneal lavage of mice that received peanut or olive oil (Fig. 6C). The Annexin V⁺PI⁺ double-positive population can be the result of both, apoptosis and necrosis (28). The increase in cell death was milder in the presence of corn oil, whereas in mineral oil–injected mice, cell death was not different as compared with untreated mice, suggesting that the mechanism for mineral oil–induced injury is different (Fig. 6C).

To further analyze cell death in macrophages, BMDMs and J774A.1 cells were treated with different oils. All three vegetal oils increased cell death. In this case, the increase in Annexin V⁺PI⁺ double-positive cells was present for olive, corn, and peanut oil (Fig. 6D; Supplementary Fig. S5A).

To further clarify whether macrophages die by apoptosis or necrosis, we incubated BMDMs and J774A.1 cells with different oils to determine apoptotic and necrotic cell death. There was an increase in apoptotic cells in the case of incubation with olive oil and a mild increase in the presence of corn oil. 7-AAD incorporation (necrosis) was increased upon treatment with peanut oil and, to a lesser extent, upon treatment with corn and mineral oil (Fig. 6E–G; Supplementary Fig. S5B–S5D). This increase in necrosis upon incubation with mineral oil is in-line with a previous publication that demonstrates that mineral oil treatment reduces P2X7 receptor expression, which increases necrosis (29).

Another way to detect necrotic cell death is by measuring LDH activity in the cell culture supernatant. Membrane disruption of necrotic cells allows release of cytosolic LDH. Peanut oil caused pronounced release of LDH. LDH was also released from macrophages treated with olive and corn oil, however to a lesser degree (Fig. 6H; Supplementary Fig. S5E). Interestingly, the LDH release upon treatment with peanut oil could be strongly decreased by supplementing peanut oil with the polyunsaturated oleic acid (Supplementary Fig. S5E).

We corroborated the different mechanisms of cell death further and observed that only treatment with olive oil induces cleavage of caspase-3 in macrophages, a major effector of apoptosis (Fig. 6I; Supplementary Fig. S5F). On the other hand, peanut oil–treated macrophages showed an increase in active p20 caspase-1, which is a marker for pyroptosis (Fig. 6I and J), which has similar features as necrosis, but is driven by caspase-1 activation (30). In contrast, olive oil–treated macrophages showed increased levels of IL10 and arginase-1 indicating an anti-inflammatory switch toward resolution of inflammation (Fig. 6K; Supplementary Fig. S5G).

These results suggest that macrophages in contact with olive oil die by apoptosis, which facilitates the subsequent resolution of the inflammation, whereas peanut oil induces macrophage pyroptosis, which impairs the resolution of inflammation.

The results presented indicate that intraperitoneal oil injection leads to a dramatic change in the peritoneal immune cell composition. Chronic inflammation is induced by peanut oil and this would potentially alter the outcome of experiments executed subsequently. One such example could be a peritonitis experiment in transgenic mice that had been injected intraperitoneally before with tamoxifen in peanut oil to induce gene recombination. We decided to test this in experimental peritonitis model, in which mice received peanut oil by intraperitoneal injection or by oral gavage as control. Three weeks later, thioglycolate was applied to mimic bacterial peritonitis (Fig. 7A).

It is known that thioglycolate initially induces a massive neutrophil and monocyte infiltration, followed by differentiation into macrophages that resolve inflammation by clearance of apoptotic cells (16). Consistently, mice that had received peanut oil by oral gavage had approximately 50% increase in myeloid cell numbers 24 and 72 hours after thioglycolate injection. However, mice pretreated intraperitoneally with oil, already had high numbers of CD45⁺CD11b⁺ myeloid cells in peritoneal fluid at baseline and this was not further increased upon thioglycolate administration (Fig. 7C). In mice treated by oral gavage, the number of monocytes and neutrophils in peritoneal fluid increased strongly upon thioglycolate injection and subsequently returned below baseline. This suggests that the first inflammatory response by these cells had already been cleared. However, in mice that had been intraperitoneally injected with peanut oil, there was a higher proportion of monocytes and neutrophils already under basal conditions, which was maintained after thioglycolate administration (Fig. 7B, D, and E).

Mice treated orally showed the expected increase in CD45⁺CD11b⁺F4/80⁺ macrophages 72 hours after thioglycolate injection. However, mice that had been injected intraperitoneally with peanut oil had only few macrophages present in the peritoneum (∼12% of all myeloid cells) and these increased only marginally (Fig. 7F). Orally treated mice showed disappearance of F4/80^hi macrophages 24 hours after thioglycolate administration and subsequent recovery, which was accompanied by an increase of F4/80^int macrophages (Fig. 7G and H). This suggests that resident macrophages disappear after thioglycolate administration and get replaced by monocyte-derived macrophages as the inflammation resolves. Yet, in mice that received peanut oil intraperitoneally there were only few F4/80^hi macrophages at baseline and there was only a minor increase in F4/80^int macrophages (Fig. 7G and H). The lower presence of F4/80^int macrophages, together with the continuous influx of monocytes and neutrophils, suggests that resolution of inflammation cannot take place. As such, intraperitoneal peanut oil injection leads to a dramatic change in the myeloid cell composition of the peritoneum that affects the outcome of subsequent experiments.

Animal experimentation requires careful planning and analysis to allow reproducibility and the possibility to translate basic research into successful clinical trials. Oil injection is frequently performed in animal research, in particular to deliver tamoxifen for inducible gene recombination (1, 2, 4). Oil is considered to be safe and nontoxic. However, few studies reported peritoneal inflammation after subcutaneous or intraperitoneal oil injection (6, 10, 31). To our knowledge, little is still known about changes in the immune cell composition and related reactions within the peritoneum upon intraperitoneal oil delivery. This work demonstrates that intraperitoneal injection of four different oils causes inflammation, foam cell formation, and depletion of resident macrophages. However, the severity of inflammation strongly depends on the type of oil.

Within the peritoneum, the omentum plays a major role in recognition and encapsulation of pathogens (32). During this process, it expands, a feature which we observed after injection of the different oils. Interestingly, the applied oils were not completely resorbed even 3 weeks after injection into the peritoneal cavity. In particular, larger amounts of peanut oil were still visible in the peritoneal fluid. The failed clearance can be assumed to prolong the phase of acute inflammation (17). Consistently, chronic xanthogranulomatous inflammation and fibrosis were observed, particularly upon peanut and mineral oil treatment. Myeloid cell infiltration and fibrosis were more severe in the omentum compared with the mesentery. This is consistent with the fact that the omentum is an immunologic niche and the first organ to react against pathogens, but only when this inflammation becomes chronic it starts to affect the mesentery (20).

Mechanistically, the type of oil–induced macrophage cell death appears to determine whether inflammation gets resolved. For successful resolution of the inflammation, there is the need of efferocytosis, where macrophages engulf apoptotic cells (33). Nonresolving inflammation contributes substantially to the progression of atherosclerotic plaques and other chronic inflammatory diseases (18, 34, 35). Our data indicate that macrophages in contact with olive oil die by apoptosis, which facilitates efferocytosis-mediated resolution of inflammation. Conversely, peanut oil induces pyroptosis of macrophages. Excessive pyroptosis impairs the resolution of inflammation (36, 37). As such, peanut oil injection results in chronic peritoneal inflammation, whereas olive oil induces macrophage apoptosis, followed by efferocytosis and initiation of the resolution phase.

At the cellular level, all three vegetal oils were taken up by macrophages and caused foam cell formation. This change in the expression pattern has been observed in peritoneal macrophages isolated from obese mice, and blood monocytes from patients suffering from severe atherosclerosis (38–40). In principle, one could even use intraperitoneal peanut oil injection as a fast model to obtain viable foam cells for in vitro experiments. Future research will determine the potential of this model.

In conclusion, our study shows that intraperitoneal injection of different oils causes peritoneal inflammation and depletion of resident peritoneal macrophages. Whereas olive oil triggers macrophage apoptosis and resolution of inflammation, peanut oil induces pyroptosis and chronic nonresolved inflammation. This has important consequences for animal experiments. In a proof-of-principle approach, we demonstrated this in a thioglycolate-induced peritonitis model after peanut oil injection. To overcome such limitations, it is advisable to deliver lipophilic substances, like tamoxifen, by oral gavage instead of intraperitoneal injection.

No disclosures were reported.

E. Alsina-Sanchis: Conceptualization, data curation, formal analysis, validation, investigation, visualization, methodology, writing–original draft. R. Mülfarth: Data curation, formal analysis, validation, investigation, visualization. I. Moll: Methodology. C. Mogler: Data curation, validation, investigation, visualization, methodology. J. Rodriguez-Vita: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, validation, investigation, methodology, writing–review and editing. A. Fischer: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, validation, investigation, methodology, writing–review and editing.

This work was funded by the Deutsche Forschungsgemeinschaft (DFG) project no., 394046768 - SFB1366 projects C4 and Z2 (to A. Fischer and C. Mogler), DFG project no., 419966437 (to J. Rodriguez-Vita), the Cooperation Program in Cancer Research of the German Research Cancer Center (DKFZ) and the Israeli Ministry of Science and Technology (MOST), and the Helmholtz Association (to A. Fischer).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.