Granulocyte colony stimulating factor (G-CSF), an essential cytokine regulating granulopoiesis, is expressed in a substantial proportion of breast cancers, and it has been implicated in cancer progression. Here, we examined effects of G-CSF on the development of bone metastases of breast cancer using immunocompetent mouse models. The expression of CXC chemokine ligand 12 (CXCL12) in bone marrow stromal cells, which plays a critical role in the maintenance of hematopoietic stem cells and also in cancer cell homing to bone, was markedly decreased in mice treated with G-CSF. Flow cytometric analysis revealed that pretreatment of mice with G-CSF reduced the number of bone-homing cancer cells. G-CSF also increased the population of myeloid-derived suppressor cells (MDSCs) in bone marrow. Depletion of MDSCs using anti–Gr-1 antibody treatment significantly decreased the metastatic tumor burden in bone. The overall effects of G-CSF on bone metastases were finally examined using two different treatment protocols. When mice were treated with G-CSF prior to the tumor cell inoculation, G-CSF did not change bone metastatic-tumor burden. In contrast, when G-CSF treatment was started after the tumor cells had homed to bone, G-CSF significantly accelerated bone metastases formation. These results suggest that G-CSF suppressed cancer cell homing to bone by downregulating CXCL12 expression in bone marrow stromal cells, whereas G-CSF stimulated the progression of bone metastases at least in part by MDSC-mediated mechanisms.

Implications:

G-CSF had opposing effects on the initiation and progression of bone metastases of breast cancer and the balance may regulate the metastatic tumor burden.

Breast cancer is the most common malignancy diagnosed in women worldwide (1). Bone is the most frequent site of distant metastases in patients with breast cancer, and more than 50% of patients with metastatic breast cancer develop bone metastases (2, 3). Bone metastases worsen the quality of life of the patients by causing skeletal-related events, including bone pain, pathologic fractures, spinal compression, and hypercalcemia, which are also associated with a higher mortality rate (4). Despite recent progress, the mechanisms of bone metastases are not yet fully understood.

Cancer cells produce a number of humoral factors, which not only influence the microenvironment in primary sites but also affect other systemic organs, including bone marrow (5). Granulocyte colony-stimulating factor (G-CSF), an essential cytokine-regulating granulopoiesis, is one of these factors and causes leukocytosis, a symptom of paraneoplastic syndrome, and splenomegaly in patients with cancer (6, 7). Clinical studies showed that plasma or serum levels of G-CSF were elevated in patients with advanced breast cancer compared with those with early breast cancer and healthy controls (8). An IHC study using human breast cancer samples showed that 60.3% of estrogen receptor–positive and/or HER2-positive tumors and 92.9% of triple-negative tumors expressed G-CSF (9). Furthermore, high G-CSF expression was correlated with shorter overall survival in patients with triple-negative breast cancer (9). Preclinical studies showed that G-CSF plays a role in tumor growth, migration, angiogenesis, and metastasis, leading to cancer progression (10). These findings suggest that G-CSF has stimulatory effects on the progression of breast cancer.

Bone marrow stromal cells expressing CXC chemokine ligand 12 (CXCL12), also known as stromal cell–derived factor-1 (SDF-1), is the major cellular component of the hematopoietic stem cell (HSC) niche (11). CXCL12 is also one of the most well-described factors that promotes cancer cell homing to bone (12). It has been demonstrated that G-CSF decreases CXCL12 expression in bone marrow, thereby inducing HSC mobilization (13). Shiozawa and colleagues showed that G-CSF mobilized bone metastatic-cancer cells as well as HSCs from bone marrow to peripheral blood, suggesting that bone metastatic cancer cells directly compete with HSCs for occupancy of the HSC niche (14).

Myeloid-derived suppressor cells (MDSCs) are immature myeloid cells, and they exhibit potent immunosuppressive activity by multiple mechanisms (15). In cancer tissues, MDSCs suppress antitumor immune responses and stimulate tumor cell proliferation, epithelial–mesenchymal transition, premetastatic niche formation, and angiogenesis, all of which contribute to cancer progression. Colony-stimulating factors, including G-CSF, that regulate normal myelopoiesis have been shown to mediate the expansion of MDSCs (15, 16).

These findings imply that G-CSF likely affects bone metastases through several different mechanisms; however, available information about G-CSF effects on bone metastases is extremely limited to date (17). Thus, in the current study, we investigated the effects of G-CSF on the initiation and progression of bone metastases of breast cancer using immunocompetent mouse models to enable to examine the contribution of immune cells. We showed that G-CSF suppressed cancer cell homing to bone by downregulating CXCL12 expression in bone marrow stromal cells. On the other hand, G-CSF stimulated the progression of bone metastases likely by the MDSC-mediated mechanisms.

Antibodies and reagents

The primary antibodies used were anti-CD3e (clone 145–2C11, catalog no. 100311, RRID:AB_312676), anti-CD11b (clone M1/70, catalog no. 101207, RRID:AB_312790, and catalog no. 101211, RRID:AB_312794), anti-CD27 (clone LG.3A10, catalog no. 124215, RRID:AB_10645330), anti-CD31 (clone 390, catalog no. 102409, RRID:AB_312904), anti-CD45 (clone 30-F11, catalog no. 103111, RRID:AB_312976), anti-CD45R (clone RA3–6B2, catalog no. 103211, RRID:AB_312996), anti-CD48 (clone HM48–1, catalog no. 103403, RRID:AB_313018), anti-CD51 (clone RMV-7, catalog no. 104105, RRID:AB_313074), anti-CD150 (clone TC15–12F12.2, catalog no. 115935, RRID:AB_2565960), anti-CD201 (clone RCR-16, catalog no. 141503, RRID:AB_10899579), anti-c-Kit (clone 2B8, catalog no. 105833, RRID:AB_2564054), anti-Gr-1 (clone RB6–8C5, catalog no. 108405, RRID:AB_313370, and catalog no. 108411, RRID:AB_313376), anti-Sca-1 (clone D7, catalog no. 108105, RRID:AB_313342), anti–TER-119 (clone TER-119, catalog no. 116211, RRID:AB_313712), and isotype-matched IgG controls conjugated with allophycocyanin (APC), FITC, PE, PE/Cyanine7 (Cy7), or PE/Dazzle, all of which were purchased from BioLegend. All other reagents used in this study were purchased from Sigma-Aldrich or FUJIFILM Wako Pure Chemical Corporation, unless otherwise specified.

Cell cultures

The mouse breast cancer cell line 4T1 was a generous gift from Dr. Fred R. Miller (Michigan Cancer Foundation, Detroit, MI; RRID:CVCL_0125; ref. 18). E0771/Bone, a highly bone-metastatic clone of the mouse breast cancer cell line E0771, was established from the parental E0771 cells (CH3 Biosystems, RRID:CVCL_GR23) by serial in vivo selection as described previously (19). Cells were cultured in DMEM (Sigma-Aldrich) supplemented with 10% FBS (Mediatech) and 100 μg/mL kanamycin sulfate (Meiji Seika Pharma), and were maintained in a humidified atmosphere of 5% CO2 in air at 37°C. Cells stably expressing the fluorescent protein ZsGreen were generated by infection with a lentiviral vector pLVSIN-IRES-ZsGreen1 (Takara Bio catalog no. 6191) using Lentiviral High Titer Packaging Mix (Takara Bio, catalog no. 6194) in accordance with the manufacturer's protocol. Cells were tested for Mycoplasma using MycoAlert Mycoplasma Detection Kit (Lonza) and used within 1 month of initiating cell culture from the cryopreserved stocks. Only mouse cell lines were used in this study and cell authentication by short tandem repeat profiling was not performed.

Cell proliferation in monolayer cultures

Cell proliferation in monolayer cultures was determined using a WST-8 assay as described previously (19, 20). The cells were cultured in DMEM supplemented with 1% FBS and G-CSF (10 or 100 ng/mL, filgrastim, Mochida Pharmaceutical) for 72 hours. Data are expressed as fold changes relative to the control. Each assay was conducted in quadruplicate.

Cell-migration assay

The cells suspended in serum-free DMEM (1 × 105 cells/100 μL medium) were seeded in Transwell top chambers with 8-μmol/L pores (Corning). The chambers were placed in 24-well bottom chambers filled with DMEM with 1% FBS (600 μL) and 100 ng/mL CXCL12a (BioLegend, catalog no. 578702). Six or 24 hours later, the upper surfaces of the transwell chambers were wiped with cotton swabs. Migrated cells were then fixed with 10% neutral-buffered formalin and stained with hematoxylin. The numbers of migrated cells were counted in 5 randomly selected microscope fields (×100). Data are expressed as the number of migrated cells/field. Each assay was conducted in quadruplicate.

RT-PCR

RT-PCR was performed as described previously (19, 20). Primer sequences were as follows: mouse CXC chemokine receptor type 4 (CXCR4; product size 220 bp), TCAGTGGCTGACCTCCTCTT/TTTCAGCCAGCAGTTTCCTT; mouse CXCR7 (product size 230 bp), CCAGGAGAAGCACAGTAGCC/TGCGGTTGATGAAGCTGTAG; mouse G-CSF receptor (G-CSFR; product size 228 bp), GAGCTGTGGACACATCGAGA/AGGAAGGCCTGGGTGTAGTT; mouse GAPDH (product size 338 bp), TTGAAGGGTGGAGCCAAACG/ACACATTGGGGGTAGGAACACG. The absence of contamination of DNA was verified by PCR on non–reverse-transcribed RNAs. The sizes of the fragments were confirmed by reference to a 100-bp DNA ladder.

Real-time RT-PCR

Real-time RT-PCR was performed as described previously (19, 20). Primer sequences were as follows: mouse CXCL12, CTGTGCCCTTCAGATTGTTG/TAATTTCGGGTCAATGCACA; ZsGreen, ATCTGCAACGCCGACATC/CTTGGACTCGTGGTACATGC; mouse β-actin, CTAAGGCCAACCGTGAAAAG/ACCAGAGGCATACAGGGACA. Melting curve analysis was performed to determine the melting temperatures of the amplified products and exclude undesired primer dimers. Quantification was normalized using mouse β-actin as a reference gene. Expression levels of the specific genes were indicated as fold changes compared with the controls.

FACS and flow cytometric analysis

Bone marrow cells were flushed out from femurs and tibias. For the isolation of bone marrow stromal cells, the bone marrow cells were digested with 0.1% collagenase IV (Thermo Fisher Scientific), 0.2% Dispase (Thermo Fisher Scientific), and 20 U/mL DNase I (Worthington Biochemical) in Hank balanced salt solution for 30 minutes at 37°C (21). After hemolysis and the treatment with an anti-mouse CD16/32 antibody (TruStain FcX; BioLegend, catalog no. 101320, RRID:AB_1574975) for blocking nonspecific binding of immunoglobulin to the Fc receptors, the cells were stained with fluorescently labeled mAbs at 1:100 dilutions. Dead cells were eliminated using 7-amino-actinomycin D (7-AAD; BioLegend, catalog no. 420404). Cell sorting was conducted by using a fluorescent-activated cell sorter (FACSAria IIu cell sorter; Becton, Dickinson and Company). Flow cytometric analysis was performed also using a flow cytometer (Cytomics FC500; Beckman Coulter). Data were analyzed using FlowJo software (Tree Star, RRID:SCR_008520).

Frequency of HSCs in bone marrow

It has been well described that HSCs are included in the lineage-negative (Lin) Sca-1+c-Kit+ fraction of bone marrow cells in mice (22); however, Sca-1 is not robustly expressed in strains expressing the Ly-6.1 haplotype, including BALB/c strain (23). Thus, in this study, CD27 and CD201 were employed as markers alternative to Sca-1 and c-Kit (Supplementary Fig. S1; ref. 23), and LinCD27+CD201+CD150+CD48 cells were defined as HSCs. TER119, CD3e, CD11b, CD45R, and Gr-1 were used as lineage markers.

Animal experiments

BALB/c (female, 5-week-old) and C57BL/6 (female, 8-week-old) mice were purchased from Japan SLC. Nestin-GFP mice, transgenic mice in which GFP expression is regulated under the nestin promoter, were a generous gift from Dr. Grigori Enikolopov (Cold Spring Harbor Laboratory; ref. 24). 4T1 cells were inoculated into BALB/c mice and E0771/Bone cells were inoculated to C57BL/6 or nestin-GFP mice. All animal experiments were approved by the Animal Management Committee of Matsumoto Dental University. The number of mice used in each experiment is described in the figure legends.

Effects of G-CSF on CXCL12 expression and MDSCs in bone marrow

Mice received subcutaneous injections of G-CSF (250 μg/kg/day) for 4 consecutive days and were sacrificed on the next day after the final injection (25).

Effects of mammary tumor burden on CXCL12 expression, MDSCs, and HSCs in bone marrow

Mice received the intramammary injection of tumor cells (1 million cells/0.1 mL PBS/mouse) and were sacrificed after 3 weeks.

Effects of G-CSF on cancer cell homing to bone

On the next day of the final injection of G-CSF (250 μg/kg/day, s.c., daily for 4 days), ZsGreen-expressing 4T1 and E0771/Bone cells (1 million cells/0.1 mL PBS/mouse) were inoculated into mice through the caudal artery as described previously (26). Twenty-four hours later, mice were sacrificed and bone-disseminated cancer cells were counted using a flow cytometer. Because the number of bone marrow cells was affected by G-CSF treatment, the total number of CD45-positive bone marrow cells was estimated by using Flow-Count Fluorospheres (Beckman Coulter) and the data were expressed as the ratio to the control.

Effects of G-CSF on bone metastases

In the early treatment protocol, mice were treated with G-CSF (250 μg/kg/day, s.c., daily for 4 days) and then were inoculated with tumor cells (0.1 million 4T1 or 0.2 million E0771/Bone cells/0.1 mL PBS/mouse) through the caudal artery. In the late treatment protocol, G-CSF treatment was started at 2 days after tumor cell inoculation and continued for 7 days. In both protocols, mice were sacrificed 14 days after tumor cell inoculation.

Effects of anti–Gr-1 antibody on bone metastases

After tumor-cell inoculation (0.1 million 4T1 or 0.2 million E0771/Bone cells/0.1 mL PBS/mouse) into the caudal artery, mice received twice-weekly intraperitoneal injections of anti-Gr-1 antibody (clone RB6–8C5, 200 μg/mouse, Bio X Cell, catalog no. BE0075, RRID:AB_10312146; ref. 27) and were sacrificed 14 days after tumor-cell inoculation. Isotype control rat IgG2b (clone LTF-2, Bio X Cell, catalog no. BE0090, RRID:AB_1107780) was similarly given to the control mice.

ELISA

Bone-marrow aspirates were collected from femurs and tibiae with 1 mL PBS. Concentrations of G-CSF and CXCL12b in plasma, conditioned medium, or bone marrow aspirates were determined using ELISA kits, purchased from PeproTech (catalog no. 900-M103) and BioLegend (catalog no. 444207), respectively, in accordance with the manufacturers' instructions.

Histomorphometric analysis

Paraffin sections were prepared by conventional methods and were stained with hematoxylin and eosin (H&E). Histomorphometric analysis was conducted on the tumor burden in bones as previously described (20). Data are expressed as the tumor area (mm2).

Statistical analysis

Data are expressed as the mean ± SEM. Significance was analyzed using Student t test or Welch's t test (Mini StatMate; ATMS). One-way ANOVA followed by the Tukey test was used when more than 2 groups were compared. P values of < 0.05 were considered to be significant.

Tumor-bearing mice exhibited splenomegaly and increased plasma levels of G-CSF

We firstly noticed enlarged spleens in mice inoculated with 4T1 and E0771/Bone mouse breast cancer cells in the mammary fat pads (Fig. 1A and B). Consistent with a previous study showing that high levels of serum G-CSF is one of the factors responsible for splenomegaly in tumor-bearing mice (7), the plasma levels of G-CSF were markedly elevated in these mice (Fig. 1C). ELISA analysis of the conditioned medium showed that both 4T1 and E0771/Bone cells constitutively produce G-CSF (Fig. 1D). We also confirmed that G-CSF treatment increased the spleen weight in non–tumor-bearing BALB/c and C57BL/6 mice (Fig. 1E).

Figure 1.

Splenomegaly and elevated plasma levels of G-CSF in mice inoculated with 4T1 and E0771/Bone cells into the mammary fat pads. A, Representative macroscopic view of spleens in tumor-bearing mice (scale bars = 1 cm). B, Spleen weight of tumor-bearing mice. C, Plasma concentrations of G-CSF in tumor-bearing mice as determined using ELISA. D, Concentrations of G-CSF in the conditioned medium of tumor cells as determined using ELISA. E, Spleen weight of non–tumor-bearing BALB/c and C57BL/6 mice treated with G-CSF (250 μg/kg/day for 4 days, s.c.). Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 1.

Splenomegaly and elevated plasma levels of G-CSF in mice inoculated with 4T1 and E0771/Bone cells into the mammary fat pads. A, Representative macroscopic view of spleens in tumor-bearing mice (scale bars = 1 cm). B, Spleen weight of tumor-bearing mice. C, Plasma concentrations of G-CSF in tumor-bearing mice as determined using ELISA. D, Concentrations of G-CSF in the conditioned medium of tumor cells as determined using ELISA. E, Spleen weight of non–tumor-bearing BALB/c and C57BL/6 mice treated with G-CSF (250 μg/kg/day for 4 days, s.c.). Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

CXCL12 expression in bone marrow was decreased in G-CSF–treated and tumor-bearing mice

CXCL12 was shown to be essential for the maintenance of HSCs (11). Real-time PCR analysis showed that, in bone marrow, CXCL12 was predominantly expressed by CD51-positive cells (Supplementary Fig. S2B). CD51 is a marker for bone marrow stromal cells (28) and marks similar populations positive for nestin-GFP, a well-described marker for bone marrow stromal cells serving as an HSC niche (Supplementary Fig. S2A; ref. 29). CXCL12 mRNA expression was markedly decreased by G-CSF treatment in a dose-dependent manner (Fig. 2A). G-CSF also reduced the protein concentration of CXCL12b in bone marrow determined by ELISA (Fig. 2B). Reduction in mRNA and protein expression of CXCL12 was similarly found in mice inoculated with 4T1 and E0771/Bone in the mammary fat pad (Fig. 2C and D). Accordingly, the population of HSCs, defined as LinCD27+CD201+CD150+CD48 cells, was significantly decreased in bone marrow in mammary tumor-bearing mice (Fig. 2E).

Figure 2.

Reduced CXCL12 expression and HSC populations in bone marrow in mice treated with G-CSF and in mice inoculated with 4T1 and E0771/Bone cells into the mammary fat pads. A, Relative mRNA expression of CXCL12 in bone marrow cells in G-CSF-treated mice (n = 3). Data are expressed as fold changes compared with the control. B, The concentration of CXCL12b in bone-marrow fluid in mice treated with G-CSF (250 μg/kg/day for 4 days, s.c.) as determined using ELISA (n = 3). C, Relative mRNA expression of CXCL12 in bone marrow cells in tumor-bearing mice (n = 4). Data are expressed as fold changes compared with the control. D, The concentration of CXCL12b in bone-marrow fluid in tumor-bearing mice (n = 4). E, HSCs in bone marrow in mice inoculated with 4T1 (top) or E0771/Bone (bottom) in the mammary fat pads. Representative flow cytometry plots of CD150 and CD48 expression among LinCD27+CD201+ bone marrow cells are shown on the left. LinCD27+CD201+CD150+CD48 cells were defined as HSCs. Quantitative data are expressed as the percentage of HSCs in whole bone-marrow cells (n = 7 for BALB/c mice and n = 6 for C57BL/6 mice). *, P < 0.05; **, P < 0.01; ***, P < 0.001 (vs. Control); +, P < 0.001 vs. G-CSF (100 μg/kg).

Figure 2.

Reduced CXCL12 expression and HSC populations in bone marrow in mice treated with G-CSF and in mice inoculated with 4T1 and E0771/Bone cells into the mammary fat pads. A, Relative mRNA expression of CXCL12 in bone marrow cells in G-CSF-treated mice (n = 3). Data are expressed as fold changes compared with the control. B, The concentration of CXCL12b in bone-marrow fluid in mice treated with G-CSF (250 μg/kg/day for 4 days, s.c.) as determined using ELISA (n = 3). C, Relative mRNA expression of CXCL12 in bone marrow cells in tumor-bearing mice (n = 4). Data are expressed as fold changes compared with the control. D, The concentration of CXCL12b in bone-marrow fluid in tumor-bearing mice (n = 4). E, HSCs in bone marrow in mice inoculated with 4T1 (top) or E0771/Bone (bottom) in the mammary fat pads. Representative flow cytometry plots of CD150 and CD48 expression among LinCD27+CD201+ bone marrow cells are shown on the left. LinCD27+CD201+CD150+CD48 cells were defined as HSCs. Quantitative data are expressed as the percentage of HSCs in whole bone-marrow cells (n = 7 for BALB/c mice and n = 6 for C57BL/6 mice). *, P < 0.05; **, P < 0.01; ***, P < 0.001 (vs. Control); +, P < 0.001 vs. G-CSF (100 μg/kg).

Close modal

G-CSF suppressed the cancer cell homing to bone

CXCL12 is also well described as a homing factor for metastatic cancer cells (14). Because CXCL12 expression and production were decreased by G-CSF (Fig. 2A and B), we then determined if G-CSF affects the cancer cell homing to bone. RT-PCR analysis demonstrated that 4T1 and E0771/Bone cells express CXCR4 and CXCR7, the receptors for CXCL12 (Fig. 3A). Transwell assays demonstrated that CXCL12 enhanced cell migration of these tumor cells (Fig. 3B). Then, we examined the effects of G-CSF on cancer cell homing to bone using mouse models of bone metastasis. Flow cytometric analysis revealed that the number of cancer cells in bone at 24 hours after inoculation was significantly reduced by pretreatment with G-CSF (Fig. 3C). The results were further confirmed by real-time PCR analysis (Fig. 3D).

Figure 3.

Effects of G-CSF on cancer cell homing to bone. A, mRNA expression of CXCR4 and CXCR7 in 4T1 and E0771/Bone cells determined by conventional RT-PCR (30 cycles for CXCR4, 25 cycles for CXCR7, and 22 cycles for GAPDH; Lad, 100-bp DNA ladder). B, CXCL12-induced cell migration of 4T1 (left) and E0771/Bone (right) cells cultured for 6 and 24 hours, respectively, determined using a Transwell assay. Representative micrographs of Transwell membranes are shown on the left (scale bars = 200 μm). C, The number of cancer cells in bone in mice 24 hours after cell inoculation through the caudal artery determined by flow cytometry. Representative flow cytometry plots are shown on the left. Data are expressed as the ratio of the number of bone-homed tumor cells adjusted by the total number of bone marrow cells. D, Relative mRNA expression of ZsGreen in bone marrow as determined by quantitative real-time RT-PCR. Data are expressed as fold-changes compared with the control. Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 3.

Effects of G-CSF on cancer cell homing to bone. A, mRNA expression of CXCR4 and CXCR7 in 4T1 and E0771/Bone cells determined by conventional RT-PCR (30 cycles for CXCR4, 25 cycles for CXCR7, and 22 cycles for GAPDH; Lad, 100-bp DNA ladder). B, CXCL12-induced cell migration of 4T1 (left) and E0771/Bone (right) cells cultured for 6 and 24 hours, respectively, determined using a Transwell assay. Representative micrographs of Transwell membranes are shown on the left (scale bars = 200 μm). C, The number of cancer cells in bone in mice 24 hours after cell inoculation through the caudal artery determined by flow cytometry. Representative flow cytometry plots are shown on the left. Data are expressed as the ratio of the number of bone-homed tumor cells adjusted by the total number of bone marrow cells. D, Relative mRNA expression of ZsGreen in bone marrow as determined by quantitative real-time RT-PCR. Data are expressed as fold-changes compared with the control. Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

Depletion of MDSCs decreased bone metastases

The effects of G-CSF on bone metastases were then examined by focusing on its effect on MDSCs. The MDSC populations, which were defined as Gr-1+CD11b+ cells, in bone marrow was increased by G-CSF both in BALB/c and C57BL/6 mice (Fig. 4A; Supplementary Fig. S3A). Mice bearing 4T1 and E0771/Bone tumors in the mammary fat pads also showed the increase in MDSCs in bone marrow (Fig. 4B; Supplementary Fig. S3B).

Figure 4.

Effects of MDSC depletion on the development of bone metastases. A and B, MDSC populations in bone marrow in G-CSF–treated (A) and mammary tumor-bearing (B) mice determined using flow-cytometric analysis. Data are expressed as the percentage of MDSCs in CD45+ bone marrow cells. C, Effects of anti–Gr-1 antibody on bone marrow MDSCs in mice with bone metastases. Representative flow-cytometry plots are shown on the left (IgG, isotype control IgG; Ab, anti–Gr-1 antibody; blue rectangles, total MDSCs; red rectangles, Gr-1high MDSCs). Quantitative data are expressed as the percentage of total MDSCs or Gr-1high MDSCs in CD45+ bone marrow cells. D, Effects of anti–Gr-1 antibody on bone metastases of 4T1 and E0771/Bone. Representative histologic views of bone metastases in mice treated with isotype control IgG or anti–Gr-1 antibody are shown on the left (H&E staining; T, tumor; BM, bone marrow; scale bars = 1 mm). Quantitative data (combination of 2 separate experiments) are expressed as tumor area (mm2). Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Figure 4.

Effects of MDSC depletion on the development of bone metastases. A and B, MDSC populations in bone marrow in G-CSF–treated (A) and mammary tumor-bearing (B) mice determined using flow-cytometric analysis. Data are expressed as the percentage of MDSCs in CD45+ bone marrow cells. C, Effects of anti–Gr-1 antibody on bone marrow MDSCs in mice with bone metastases. Representative flow-cytometry plots are shown on the left (IgG, isotype control IgG; Ab, anti–Gr-1 antibody; blue rectangles, total MDSCs; red rectangles, Gr-1high MDSCs). Quantitative data are expressed as the percentage of total MDSCs or Gr-1high MDSCs in CD45+ bone marrow cells. D, Effects of anti–Gr-1 antibody on bone metastases of 4T1 and E0771/Bone. Representative histologic views of bone metastases in mice treated with isotype control IgG or anti–Gr-1 antibody are shown on the left (H&E staining; T, tumor; BM, bone marrow; scale bars = 1 mm). Quantitative data (combination of 2 separate experiments) are expressed as tumor area (mm2). Numbers in parentheses indicate the number of animals studied. *, P < 0.05; **, P < 0.01; ***, P < 0.001.

Close modal

To examine the roles of MDSCs in bone metastases, we employed an anti–Gr-1 neutralizing antibody to deplete MDSCs. The depletion efficiency of the antibody was preconfirmed in G-CSF–treated mice. The anti–Gr-1 antibody reduced MDSCs, especially those of Gr-1high populations (Supplementary Fig. S4). As well as in mice bearing mammary tumors (Fig. 4B), MDSCs in bone marrow were increased in mice with bone metastases of 4T1 and E0771/Bone cells compared with those in non–tumor-bearing mice (Fig. 4C). Flow cytometric analysis revealed that anti–Gr-1 antibody treatment decreased MDSCs almost to the control level (Fig. 4C). The reduction was particularly evident in Gr-1high MDSC populations also in these mice (Fig. 4C). Histomorphometric analysis demonstrated that the anti–Gr-1 antibody significantly decreased the metastatic tumor burden in bone (Fig. 4D).

Effects of G-CSF on bone metastases varied depending on the treatment protocols

The results so far obtained suggest that G-CSF has both inhibitory (Fig. 3) and stimulatory (Fig. 4) effects on bone metastases. Thus, we finally examined the overall effects of G-CSF on bone metastases by two different protocols. In the early treatment protocol, in which G-CSF injection was conducted prior to the tumor cell inoculation, G-CSF did not change bone metastatic tumor burden of 4T1 and E0771/Bone (Fig. 5A). In contrast, in the late treatment protocol, in which G-CSF treatment was started at 2 days after the tumor cell inoculation, G-CSF significantly accelerated bone metastases formation (Fig. 5B).

Figure 5.

Effects of G-CSF on bone metastases of 4T1 and E0771/Bone. Mice were treated with the early (A) or late (B) treatment protocols. Representative histologic views of bone metastases in mice treated without or with G-CSF are shown on the left (H&E staining; T, tumor; BM, bone marrow; scale bars = 1 mm). Quantitative data (combination of 2 separate experiments) are expressed as tumor area (mm2). Numbers in parentheses indicate the number of animals studied. NS, not significant; *, P < 0.05.

Figure 5.

Effects of G-CSF on bone metastases of 4T1 and E0771/Bone. Mice were treated with the early (A) or late (B) treatment protocols. Representative histologic views of bone metastases in mice treated without or with G-CSF are shown on the left (H&E staining; T, tumor; BM, bone marrow; scale bars = 1 mm). Quantitative data (combination of 2 separate experiments) are expressed as tumor area (mm2). Numbers in parentheses indicate the number of animals studied. NS, not significant; *, P < 0.05.

Close modal

G-CSF has been shown to have several promoting effects on cancer progression and metastasis (10). Preclinical studies using mouse models showed that G-CSF promotes lung metastases of breast cancer, including 4T1 (30, 31). Regarding bone metastases, Hirbe and colleagues demonstrated that G-CSF increased bone resorption and tumor burden in mice using B16-F10 mouse melanoma cell line and 4T1 (17). They also showed that these effects of G-CSF were suppressed in osteoclast-defective osteoprotegerin transgenic mice and mice treated with zoledronic acid, a potent inhibitor of osteoclastic bone resorption. These results suggest that G-CSF has osteoclast-mediated tumor-promoting effects on bone metastases; however, other mechanisms of action of G-CSF on bone metastases remained to be elucidated.

In the current study, we firstly examined the effects of G-CSF on cancer cell homing to bone, the initial interaction with the bone microenvironment. G-CSF induced the mobilization of HSCs by downregulating CXCL12 production in bone marrow (13). Considering that CXCL12 also acts as an important bone-homing factor for cancer cells, it is anticipated that G-CSF inhibits cancer cell homing to bone. Consistent with previous reports (32), our data showed that CXCL12 was predominantly expressed by bone marrow stromal cell populations, which was markedly decreased by G-CSF. Moreover, the pretreatment of mice with G-CSF decreased the number of cancer cells colonized in bone at 24 hours after cancer cell inoculation through the caudal artery. Rossnagl and colleagues obtained a similar result by using MDA-MB-231 human breast cancer cells in nude mice (33). Together with the findings that 4T1 and E0771/Bone cells expressed CXCR4 and their migration was enhanced by CXCL12, these results suggest that G-CSF has inhibitory effects on the initial colonization of cancer cells in bone by suppressing CXCR4/CXCL12 interactions between cancer cells and bone marrow stromal cells.

We then examined the other effects of G-CSF on bone metastases by focusing on MDSCs. The percentage of MDSCs in bone marrow was significantly increased by G-CSF as described previously (15, 16). Similar changes were also induced by 4T1 and E0771/Bone tumor burden in the mammary fat pads and bone. Treatment with an anti–Gr-1 antibody reduced the frequencies of MDSCs, especially Gr-1high MDSCs, and resulted in a decrease in bone metastases. Thus, it is likely that G-CSF–induced MDSCs have stimulatory effects on the progression of bone metastases. In support of this notion, the coinoculation of 4T1 cells with MDSCs obtained from G-CSF–treated mice or those from 4T1 tumor-bearing mice enhanced tumor growth in the mammary fat pads compared with the inoculation of 4T1 cells alone (27, 34). MDSCs have also been shown to play critical roles in G-CSF–promoted breast cancer metastases to the lung (30, 31). Although MDSCs are recognized to promote cancer progression primarily by suppressing immune cell functions (15), Welte and colleagues suggested that tumor-initiating cells produce higher levels of G-CSF and induced MDSCs reciprocally to increase the frequency of tumor-initiating cells (35). Further studies are required to determine the precise mechanisms by which MDSCs promote bone metastases. Besides MDSCs, G-CSF has been reported to affect a variety of immune cells of the innate and adaptive immune systems (36); however, to date, their specific contributions to bone metastases have yet to be determined.

As described thus far, G-CSF acts on bone metastases in both an inhibitory and stimulatory fashion. Therefore, we finally examined the overall effects of G-CSF on bone metastases. In the early treatment protocol, in which tumor cells were inoculated into mice after G-CSF treatment, G-CSF did not change bone-metastatic tumor burden at the time of sacrifice. In this protocol, cancer cell homing to bone was expected to be suppressed as shown in Fig. 3C. However, considering the result shown in Fig. 4A, MDSCs in bone marrow were already increased at the time of the cell inoculation and presumably stimulated tumor growth in bone. Thus, it is likely that the inhibitory and stimulatory effects of G-CSF were balanced in this situation. On the other hand, in the late treatment protocol, in which G-CSF treatment was started after the tumor cells had homed to bone, bone metastases were increased in G-CSF–treated mice. In this case, the bone homing was not affected and MDSC-mediated tumor-promoting effects were likely pronounced even if G-CSF may have an effect to mobilize metastatic cancer cells from bone marrow to peripheral blood (14). These results collectively suggest that G-CSF suppresses cancer cell homing to bone; however, once cancer cells colonize the bone, G-CSF accelerates the tumor progression in bone at least in part through mechanisms mediated by MDSCs. Therefore, the balance between these opposing effects may determine the metastatic tumor burden in bone.

Several studies suggested that G-CSF promotes tumor growth and metastases also through MDSC-independent mechanisms (10). One of those mechanisms is the direct effect of G-CSF on cancer cells expressing G-CSFRs. The studies using human breast cancer cell lines and clinical specimens of breast cancer showed that substantial proportions of breast cancer cells express G-CSFR (37, 38). Furthermore, the activation of G-CSF signals through G-CSFR have been shown to stimulate the proliferation and migration of several types of cancer cells (10). Our preliminary study showed that both 4T1 and E0771/Bone cells express different levels of G-CSFR mRNA determined by conventional RT-PCR analysis; however, G-CSF did not affect the cell proliferation in monolayer cultures (Supplementary Fig. S5), which is consistent with the data shown by Cavalloni and colleagues (37). The influence on bone metastases through direct action of G-CSF on cancer cells requires future studies.

Breast cancer cells employed in this study constitutively produce G-CSF, but not all of breast cancer cells do so (9). Even in cases where cancer cells themselves do not produce G-CSF, exogenous G-CSF administration induces a similar condition as shown in this study. G-CSF is frequently used for the treatment of leukopenia caused by chemotherapy in patients with cancer. In addition, G-CSF is routinely employed to collect hematopoietic progenitor cells before high-dose chemotherapy with autologous stem cell transplantation. Extensive clinical studies have yet to be conducted; however, one study of patients with stage III and IV unresectable oro- and hypopharyngeal carcinoma treated with chemoradiotherapy reported that the use of G-CSF worsened local control and prognosis (39), implicating that negative impacts of G-CSF should be taken into consideration when used in clinical practice (10). Another important point is that tumor burden may increase the G-CSF production by host cells (30, 40), even though the regulatory mechanisms are currently unknown. In these cases, even when cancer cells do not produce G-CSF, host-derived G-CSF elevates the serum levels of G-CSF, which also influence tumor microenvironment.

In conclusion, this study suggests that G-CSF suppresses cancer cell homing to bone by downregulating CXCL12 expression in bone marrow stromal cells, whereas G-CSF stimulates the progression of bone metastases at least in part by MDSC-mediated mechanisms. As also mentioned by Swierczak and colleagues (41), the roles of the G-CSF system in breast cancer metastasis are fairly complicated and require further investigation as a therapeutic target for bone metastasis.

T. Hiraga reports grants from Japan Society for the Promotion of Science (JSPS) during the conduct of the study. No disclosures were reported by the other authors.

T. Hiraga: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, validation, investigation, methodology, writing–original draft, project administration, writing–review and editing. S. Ito: Data curation, formal analysis, investigation, methodology. T. Mizoguchi: Resources, methodology, writing–review and editing.

The authors are grateful to Dr. Grigori Enikolopov for providing nestin-GFP mice. This work was supported by grants from JSPS KAKENHI (grant numbers 18K19656 and 21K09863, to T. Hiraga).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Torre
LA
,
Siegel
RL
,
Ward
EM
,
Jemal
A
.
Global cancer incidence and mortality rates and trends - an update
.
Cancer Epidemiol Biomarkers Prev
2016
;
25
:
16
27
.
2.
Tahara
RK
,
Brewer
TM
,
Theriault
RL
,
Ueno
NT
.
Bone metastasis of breast cancer
.
In
:
Ahmad
A
,
editor
.
Breast cancer metastasis and drug resistance. Advances in experimental medicine and biology
.
Cham
:
Springer
;
2019
.
p.
105
29
.
3.
Huang
JF
,
Shen
J
,
Li
X
,
Rengan
R
,
Silvestris
N
,
Wang
M
, et al
.
Incidence of patients with bone metastases at diagnosis of solid tumors in adults: a large population-based study
.
Ann Transl Med
2020
;
8
:
482
.
4.
Sathiakumar
N
,
Delzell
E
,
Morrisey
MA
,
Falkson
C
,
Yong
M
,
Chia
V
, et al
.
Mortality following bone metastasis and skeletal-related events among women with breast cancer: A population-based analysis of U.S. Medicare beneficiaries, 1999–2006
.
Breast Cancer Res Treat
2012
;
131
:
231
8
.
5.
McAllister
SS
,
Weinberg
RA
.
The tumour-induced systemic environment as a critical regulator of cancer progression and metastasis
.
Nat Cell Biol
2014
;
16
:
717
27
.
6.
Abukhiran
IA
,
Jasser
J
,
Syrbu
S
.
Paraneoplastic leukemoid reactions induced by cytokine-secreting tumours
.
J Clin Pathol
2020
;
73
:
310
3
.
7.
duPre'
SA
,
Hunter
KW
.
Murine mammary carcinoma 4T1 induces a leukemoid reaction with splenomegaly: association with tumor-derived growth factors
.
Exp Mol Pathol
2007
;
82
:
12
24
.
8.
Mouchemore
KA
,
Anderson
RL
,
Hamilton
JA
.
Neutrophils, G-CSF and their contribution to breast cancer metastasis
.
FEBS J
2018
;
285
:
665
79
.
9.
Hollmén
M
,
Karaman
S
,
Schwager
S
,
Lisibach
A
,
Christiansen
AJ
,
Maksimow
M
, et al
.
G-CSF regulates macrophage phenotype and associates with poor overall survival in human triple-negative breast cancer
.
Oncoimmunology
2016
;
5
:
e1115177
.
10.
Yeo
B
,
Redfern
AD
,
Mouchemore
KA
,
Hamilton
JA
,
Anderson
RL
.
The dark side of granulocyte-colony stimulating factor: a supportive therapy with potential to promote tumour progression
.
Clin Exp Metastasis
2018
;
35
:
255
67
.
11.
Sugiyama
T
,
Omatsu
Y
,
Nagasawa
T
.
Niches for hematopoietic stem cells and immune cell progenitors
.
Int Immunol
2019
;
31
:
5
11
.
12.
Sowder
ME
,
Johnson
RW
.
Bone as a preferential site for metastasis
.
JBMR Plus
2019
;
3
:
e10126
.
13.
Petit
I
,
Ponomaryov
T
,
Zipori
D
,
Tsvee
L
.
G-CSF induces stem cell mobilization by decreasing bone marrow SDF-1 and up-regulating CXCR4
.
Nat Immunol
2002
;
3
:
687
94
.
14.
Shiozawa
Y
,
Pedersen
EA
,
Havens
AM
,
Jung
Y
,
Mishra
A
,
Joseph
J
, et al
.
Human prostate cancer metastases target the hematopoietic stem cell niche to establish footholds in mouse bone marrow
.
J Clin Invest
2011
;
121
:
1298
312
.
15.
Groth
C
,
Hu
X
,
Weber
R
,
Fleming
V
,
Altevogt
P
,
Utikal
J
, et al
.
Immunosuppression mediated by myeloid-derived suppressor cells (MDSCs) during tumour progression
.
Br J Cancer
2019
;
120
:
16
25
.
16.
Pilatova
K
,
Bencsikova
B
,
Demlova
R
,
Valik
D
,
Zdrazilova-Dubska
L
.
Myeloid-derived suppressor cells (MDSCs) in patients with solid tumors: considerations for granulocyte colony-stimulating factor treatment
.
Cancer Immunol Immunother
2018
;
67
:
1919
29
.
17.
Hirbe
AC
,
Uluçkan
Ö
,
Morgan
EA
,
Eagleton
MC
,
Prior
JL
,
Piwnica-Worms
D
, et al
.
Granulocyte colony-stimulating factor enhances bone tumor growth in mice in an osteoclast-dependent manner
.
Blood
2007
;
109
:
3424
31
.
18.
Aslakson
CJ
,
Miller
FR
.
Selective events in the metastatic process defined by analysis of the sequential dissemination of subpopulations of a mouse mammary tumor
.
Cancer Res
1992
;
52
:
1399
405
.
19.
Hiraga
T
,
Ninomiya
T
.
Establishment and characterization of a C57BL/6 mouse model of bone metastasis of breast cancer
.
J Bone Miner Metab
2019
;
37
:
235
42
.
20.
Hiraga
T
,
Ito
S
,
Nakamura
H
.
Cancer stem-like cell marker CD44 promotes bone metastases by enhancing tumorigenicity, cell motility, and hyaluronan production
.
Cancer Res
2013
;
73
:
4112
22
.
21.
Yang
M
,
Arai
A
,
Udagawa
N
,
Zhao
L
,
Nishida
D
,
Murakami
K
, et al
.
Parathyroid hormone shifts cell fate of a leptin receptor-marked stromal population from adipogenic to osteoblastic lineage
.
J Bone Miner Res
2019
;
34
:
1952
63
.
22.
Oguro
H
,
Ding
L
,
Morrison
SJ
.
SLAM family markers resolve functionally distinct subpopulations of hematopoietic stem cells and multipotent progenitors
.
Cell Stem Cell
2013
;
13
:
102
16
.
23.
Vazquez
SE
,
Inlay
MA
,
Serwold
T
.
CD201 and CD27 identify hematopoietic stem and progenitor cells across multiple murine strains independently of Kit and Sca-1
.
Exp Hematol
2015
;
43
:
578
85
.
24.
Mignone
JL
,
Kukekov
V
,
Chiang
A-S
,
Steindler
D
,
Enikolopov
G
.
Neural stem and progenitor cells in nestin-GFP transgenic mice
.
J Comp Neurol
2004
;
469
:
311
24
.
25.
Katayama
Y
,
Battista
M
,
Kao
WM
,
Hidalgo
A
,
Peired
AJ
,
Thomas
SA
, et al
.
Signals from the sympathetic nervous system regulate hematopoietic stem cell egress from bone marrow
.
Cell
2006
;
124
:
407
21
.
26.
Kuchimaru
T
,
Kataoka
N
,
Nakagawa
K
,
Isozaki
T
,
Miyabara
H
,
Minegishi
M
, et al
.
A reliable murine model of bone metastasis by injecting cancer cells through caudal arteries
.
Nat Commun
2018
;
9
:
2981
.
27.
Waight
JD
,
Hu
Q
,
Miller
A
,
Liu
S
,
Abrams
SI
.
Tumor-derived G-CSF facilitates neoplastic growth through a granulocytic myeloid-derived suppressor cell-dependent mechanism
.
PLoS One
2011
;
6
:
e27690
.
28.
Pinho
S
,
Lacombe
J
,
Hanoun
M
,
Mizoguchi
T
,
Bruns
I
,
Kunisaki
Y
, et al
.
PDGFRα and CD51 mark human nestin+ sphere-forming mesenchymal stem cells capable of hematopoietic progenitor cell expansion
.
J Exp Med
2013
;
210
:
1351
67
.
29.
Méndez-Ferrer
S
,
Michurina
TV
,
Ferraro
F
,
Mazloom
AR
,
Macarthur
BD
,
Lira
SA
, et al
.
Mesenchymal and haematopoietic stem cells form a unique bone marrow niche
.
Nature
2010
;
466
:
829
34
.
30.
Kowanetz
M
,
Wu
X
,
Lee
J
,
Tan
M
,
Hagenbeek
T
,
Qu
X
, et al
.
Granulocyte-colony stimulating factor promotes lung metastasis through mobilization of Ly6G+Ly6C+ granulocytes
.
Proc Natl Acad Sci U S A
2010
;
107
:
21248
55
.
31.
Cao
Y
,
Slaney
CY
,
Bidwell
BN
,
Parker
BS
,
Johnstone
CN
,
Rautela
J
, et al
.
BMP4 inhibits breast cancer metastasis by blocking myeloid-derived suppressor cell activity
.
Cancer Res
2014
;
74
:
5091
102
.
32.
Sugiyama
T
,
Kohara
H
,
Noda
M
,
Nagasawa
T
.
Maintenance of the hematopoietic stem cell pool by CXCL12-CXCR4 chemokine signaling in bone marrow stromal cell niches
.
Immunity
2006
;
25
:
977
88
.
33.
Rossnag
S
,
Ghura
H
,
Groth
C
,
Altrock
E
,
Jakob
F
,
Schott
S
, et al
.
A subpopulation of stromal cells controls cancer cell homing to the bone marrow
.
Cancer Res
2018
;
78
:
129
42
.
34.
Stewart
TJ
,
Liewehr
DJ
,
Steinberg
SM
,
Greeneltch
KM
,
Abrams
SI
.
Modulating the expression of IFN regulatory factor 8 alters the protumorigenic behavior of CD11b+Gr-1+ myeloid cells
.
J Immunol
2009
;
183
:
117
28
.
35.
Welte
T
,
Kim
IS
,
Tian
L
,
Gao
X
,
Wang
H
,
Li
J
, et al
.
Oncogenic mTOR signalling recruits myeloid-derived suppressor cells to promote tumour initiation
.
Nat Cell Biol
2016
;
18
:
632
44
.
36.
Theron
AJ
,
Steel
HC
,
Rapoport
BL
,
Anderson
R
.
Contrasting immunopathogenic and therapeutic roles of granulocyte colony-stimulating factor in cancer
.
Pharmaceuticals
2020
;
13
:
1
21
.
37.
Cavalloni
G
,
Sarotto
I
,
Pignochino
Y
,
Gammaitoni
L
,
Migliardi
G
,
Sgro
L
, et al
.
Granulocyte-colony stimulating factor upregulates ErbB2 expression on breast cancer cell lines and converts primary resistance to trastuzumab
.
Anticancer Drugs
2008
;
19
:
689
96
.
38.
Wojtukiewicz
MZ
,
Sierko
E
,
Skalij
P
,
Kamińska
M
,
Zimnoch
L
,
Brekken
RA
, et al
.
Granulocyte-colony stimulating factor receptor, tissue factor, and VEGF-R bound VEGF in human breast cancer in loco
.
Adv Clin Exp Med
2016
;
25
:
505
11
.
39.
Staar
S
,
Rudat
V
,
Stuetzer
H
,
Dietz
A
,
Volling
P
,
Schroeder
M
, et al
.
Intensified hyperfractionated accelerated radiotherapy limits the additional benefit of simultaneous chemotherapy - Results of a multicentric randomized German trial in advanced head-and-neck cancer
.
Int J Radiat Oncol Biol Phys
2001
;
50
:
1161
71
.
40.
Arroyo-Crespo
JJ
,
Armiñán
A
,
Charbonnier
D
,
Deladriere
C
,
Palomino-Schätzlein
M
,
Lamas-Domingo
R
, et al
.
Characterization of triple-negative breast cancer preclinical models provides functional evidence of metastatic progression
.
Int J Cancer
2019
;
145
:
2267
81
.
41.
Swierczak
A
,
Cook
AD
,
Lenzo
JC
,
Restall
CM
,
Doherty
JP
,
Anderson
RL
, et al
.
The promotion of breast cancer metastasis caused by inhibition of CSF-1R/CSF-1 signaling is blocked by targeting the G-CSF receptor
.
Cancer Immunol Res
2014
;
2
:
765
76
.

Supplementary data