High-constitutive activity of the DNA damage response protein checkpoint kinase 1 (CHK1) has been shown in glioblastoma (GBM) cell lines and in tissue sections. However, whether constitutive activation and overexpression of CHK1 in GBM plays a functional role in tumorigenesis or has prognostic significance is not known. We interrogated multiple glioma patient cohorts for expression levels of CHK1 and the oncogene cancerous inhibitor of protein phosphatase 2A (CIP2A), a known target of high-CHK1 activity, and examined the relationship between these two proteins in GBM. Expression levels of CHK1 and CIP2A were independent predictors for reduced overall survival across multiple glioma patient cohorts. Using siRNA and pharmacologic inhibitors we evaluated the impact of their depletion using both in vitro and in vivo models and sought a mechanistic explanation for high CIP2A in the presence of high-CHK1 levels in GBM and show that; (i) CHK1 and pSTAT3 positively regulate CIP2A gene expression; (ii) pSTAT3 and CIP2A form a recursively wired transcriptional circuit; and (iii) perturbing CIP2A expression induces GBM cell senescence and retards tumor growth in vitro and in vivo. Taken together, we have identified an oncogenic transcriptional circuit in GBM that can be destabilized by targeting CIP2A.

Implications:

High expression of CIP2A in gliomas is maintained by a CHK1-dependent pSTAT3–CIP2A recursive loop; interrupting CIP2A induces cell senescence and slows GBM growth adding impetus to the development of CIP2A as an anticancer drug target.

Glioblastoma (GBM), the most lethal primary brain tumor, has a median survival of 15 months (1). Indeed, in terms of years of life lost, the population burden from GBM is the highest of all malignant cancers (2). GBM accounts for more than 80% of all malignant brain tumors. Currently, surgical resection followed by radiotherapy with concomitant and adjuvant temozolomide chemotherapy constitutes the mainstay for treatment of GBMs (3, 4). However, tumor recurrence and associated patient mortality is almost inevitable. This is mainly due to the highly invasive nature of GBMs and their resistance to currently available treatment modalities.

DNA damage is a universal characteristic of cancer cells (5). Interestingly, in contrast to many other DNA damage response (DDR) proteins that are inactivated in cancer (5), checkpoint kinase1 (CHK1) has emerged as a human oncoprotein (6, 7), and a target for cancer therapy (6, 7). Importantly, the presence of higher DNA damage and activation of DDR proteins such as CHK1 has been demonstrated in GBM tissue sections and cell lines compared with their normal counterparts (8). However, whether this robust constitutive activation and overexpression of CHK1 in GBM plays a functional role in tumorigenesis or has prognostic significance is not known.

We have previously shown that cancerous inhibitor of protein phosphatase 2A (CIP2A), an endogenous inhibitor of protein phosphatase 2A (PP2A), is a downstream target of high-CHK1 activity in human gastric cancers (7). In contrast to normal cells, high-CIP2A expression is observed in most solid and hematologic malignancies (6, 9). Furthermore, a prognostic role for high-CIP2A expression has been demonstrated in various tumor types, including gastric, colon, melanoma, non–small cell lung cancer, breast, chronic myeloid leukemia, and ovarian cancer (6). Oncogenic transcription factors (e.g., MYC, ETS1, E2F1, and ATF2) and their constituent signaling pathways have been shown to promote CIP2A expression in human cancers (6).

STAT3 is a transcription factor that is phosphorylated by receptor-associated kinases in response to cytokines and growth factors (10). Constitutive activation of STAT3 has been shown to play a vital role in various aspects of carcinogenesis, including promoting growth of cancer stem–like cell populations, drug resistance, and immune evasion (10, 11). Notably, STAT3 is constitutively activated in GBM stem cells (12) and phosphorylation of STAT3 at Serine 727 residue (pSTAT3) has been implicated in GBM maintenance, cellular transformation, and poor survival of patients with GBM (13–15).

Here, we show that constitutive CHK1 expression in GBM activates a recursive pSTAT3-CIP2A oncogenic circuit that drives tumor growth. Inhibition of this circuit retards GBM growth in heterotopic and orthotopic transplants and prolongs survival.

Cell lines and culture

Glioma cell lines (U251MG, RRID: CVCL_0021 and U87MG, and RRID: CVCL_0022) were sourced from Professor Brent Reynolds (Queensland Brain Institute, St Lucia, Australia) and short tandem repeat-PCR profiled prior to use. U251MG-Luc cells were generated by transducing U251MG cells with lentiviral particles carrying the luciferase gene. Cell lines were maintained in RPMI1640 supplemented with 10% FBS at 37°C with 5% CO2. Patient-derived GBM cell lines (BAH1, FPW1, HW1, JK2, MMK1, MN1, PB1, RKI1, RN1, SB2b, SJH1, and WK1 and RRID: CVCL_VS43, CVCL_VS44, CVCL_VS45, CVCL_VS46, CVCL_VS47, CVCL_VS48, CVCL_VS49, CVCL_VS50, CVCL_VS51, CVCL_VS52, CVCL_VS53, and CVCL_VS54; ref. 16) were cultured as glioma neural stem cells as described previously (17). Patient-derived cell lines from recurrent GBM (299MG, 160MG, and G13MG) and normal human astrocyte (NHA) cultures were maintained as described previously (17, 18). Cell stocks were thawed for each series of experiments and kept in culture for up to 3 months. Cell cultures were checked monthly for Mycoplasma infection using a MycoAlert Mycoplasma Detection Kit (Lonza catalog no. LT07-318) according to the manufacturer's instructions.

Ethics and animal use statement

All mouse experiments were performed according to the National Health and Medical Research Council (2013) Australian code for the care and use of animals for scientific purposes, under experimental protocols approved by either the UNSW Sydney Animal Ethics Committee or the QIMR Berghofer Animal Ethics Committee. No patient samples were collected in the course of this study.

Protein extraction and immunoblotting

Proteins extracted in hot Laemmli sample buffer were subjected to Western blot analysis. Thirty micrograms total protein extracts were separated by 12% SDS-PAGE and transferred to nitrocellulose membranes, blocked with 5% non-fat milk in TBS-0.1%-NP40, and incubated with anti-β-Actin (Santa Cruz Biotechnology catalog no. sc4778, RRID: AB_2714189), anti-CIP2A (Santa Cruz Biotechnology catalog no. sc80659, RRID: AB_1121640), anti-phospho-Chk1-Serine345 (Cell Signaling Technology catalog no. 23485, RRID: AB_331212), anti-Chk1 (Novus catalog no. EP691Y, RRID: AB_838019), anti-phospho-STAT3-Serine727 (Cell Signaling Technology catalog no. 91345, RRID: AB_331589), and anti-STAT3 (Santa Cruz Biotechnology catalog no. sc482, RRID: AB_632440).

Immunofluorescence

U251MG and NHA cells were seeded on sterilized cover slips and allowed to attach overnight. Cover slips were washed with PBS then fixed using 4% paraformaldehyde for 10 minutes at 37°C, permeabilized with 0.5% NP-40 for 5 minutes at room temperature, and blocked with 0.5% BSA for 30 minutes. Cells were then exposed to DAPI (Dako) and anti-phospho-Chk1-Serine345 (Cell Signaling Technology catalog no. 23485, RRID: AB_331212). The cells were visualized and photographed with camera (Imaging, Inc.) attached to the Olympus IX71 (Olympus) microscope.

IHC

Tumor tissue blocks were freshly cut into 4-μm thick sections. Sections were fixed on slides and dried for 12 to 24 hours at 37°C, then deparaffinized in xylene, and rehydrated through gradually decreasing concentrations of ethanol to distilled water. For antigen retrieval, slides were treated in a Pretreatment Module (Lab Vision Corp) in Tris – HCl buffer (pH 8.5) for 20 minutes at 98°C. Sections were stained in an Autostainer 480 (Lab Vision Corp.) using the Dako REAL EnVision Detection System, Peroxidase/DAB+, Rabbit/Mouse (Dako). In brief, slides were treated for 5 minutes with 0.3% Dako REAL Peroxidase-Blocking Solution to block endogenous peroxidases. Subsequently, slides were incubated for 1 hour with anti-CIP2A antibody (Novus catalog no. NB110-59722, RRID:AB_2130796) diluted 1:2,000 in Dako REAL Antibody Diluent (Dako) or with anti-Ki67 antibody (Abcam catalog no. ab16667, RRID: AB_302459) diluted 1:500, or with anti-pSTAT3-serine727 antibody (Cell Signaling Technology catalog no. 91345, RRID: AB_331589) followed by a 30 minute incubation with horseradish peroxidase–conjugated Dako REAL EnVision rabbit anti-mouse antibody, and finally visualized by Dako REAL DAB+ Chromogen for 10 minutes. Between each step in the staining procedure, slides were washed with PBS [8.10 mmol/L disodium phosphate (Na2HPO4), 0.5 mmol/L monopotassium phosphate (KH2PO4), 2.7 mmol/L potassium chloride (KCl), and 137 mmol/L sodium chloride (NaCl) dissolved in distilled water] containing 0.04% Tween-20 (Dako). Slides were counterstained with Mayer hematoxylin, washed in tap water for 10 minutes, and mounted in aqueous mounting medium (Aquamount, BDH) and photographed with camera (Imaging, Inc.) attached to the Olympus IX71 (Olympus) microscope.

Coimmunoprecipitation

For coimmunoprecipitation studies, 1–10 × 106 cells were harvested and lysed using ice-cold RIPA buffer (20 mmol/L Tris pH 7.5, 150 mmol/L NaCl, 1% NP-40, 0.5% sodium deoxycholate, 1 mmol/L EDTA, and 0.1% SDS). Lysates were sonicated at high power for 10 cycles (30 seconds on/off) in a Bioruptor Sonicator (Diagenode) and centrifuged at 13,000 rpm for 10 minutes. Protein extract (500–1,000 μg) was precleared with Protein G Dynabeads (Thermo Fisher Scientific) for 2 hours at 4°C prior to overnight incubation at 4°C with 5–10 μg anti-STAT3 (Santa Cruz Biotechnology catalog no. sc482, RRID: AB_632440). The immune complexes were collected with Protein G Dynabeads (Invitrogen), washed three times with wash buffer (Invitrogen), and then boiled with 2 × sample buffer for 10 minutes. Inputs were prepared using 5–30 μg of protein (5%–10% of immunoprecipitation). Samples were then subjected to Western blot analysis.

Tumorsphere and monolayer clonogenic assays

Glioma cells were plated at 1 × 104 per dish in Corning Costar ultra-low attachment 6-well plates (Sigma Aldrich) in 2 mL appropriate culture medium (changed every 2–3 days). For siRNA experiments, tumorsphere assays were set up 48 hours following transfection. After 8 or 12 days, cells were stained with Giemsa 1:20 in water (Sigma-Aldrich), the wells were scanned using the Surveyor Software (Objective Imaging Ltd) with camera (Imaging Inc) attached to the Olympus IX71 (Olympus) microscope, and colonies were counted by analysis with ImageJ 1.42q Software (Rasband WS, US National Institutes of Health https://imagej.nih.gov/ij/). Cell groupings that were greater than 1,200 pixels in diameter with 3.2 × enlargements were counted as colonies.

For monolayer colony formation assays, 2,000–10,000 cells in each well of a 6-well plate were seeded and transfected with respective siRNAs and grown for 8 to 12 days. Cells were then fixed with 3.7% formaldehyde and stained with 0.1% crystal violet solution (Sigma Aldrich) in 10% ethanol. Area of colonies was measured using ImageJ 1.42q software.

Cell viability assay

One day before treatment with chemical inhibitors or transfection of siRNAs U251MG, U87MG, or WK1, glioma cells were seeded in RPMI1640 medium supplemented with 10% FBS at a density of 1–2 × 103 cells per well in 96-well plates. The cells were treated or transfected with the following conditions: medium only, Lipofectamine RNAiMAX (for U251MG and U87MG cells)/Lipofectamine LTX reagent (WK1 cells) only or 33 nmol/L of indicated siRNAs (with respective Lipofectamine reagent) in 200 μL of RPMI1640 supplemented with 10% FBS. Subsequently, relative numbers of viable cells were measured by fluorescence at the 544 and 590 nm wavelengths in a FLUOstar OPTIMA Microplate Reader (BMG Labtech), using the resazurin-based CellTiter-Blue Assay (Promega) according to the manufacturer's instructions.

xCELLigence (proliferation) assay

Cell proliferation was measured in real-time using the xCELLigence System (Roche) using the manufacturer's protocol with proprietary 16-well plates. A total of 10,000 cells in 100 μL of media were seeded in each well and placed in the instrument for measurement. A baseline measurement was made the next day (∼18–20 hours), then cells were treated with control or treatment (chemical inhibitor/siRNA). Cells were monitored for the indicated period and proliferation measured as a normalized cell index and plotted against time. Each treatment condition was measured as quadruplets and the normalized cell index is represented. Results were confirmed in at least two independent experiments.

Inducible knockdown assays

Lentiviral particles corresponding to the diagrams shown in Fig. 4A were purchased from Amsbio. Cells were transduced by incubating with viral particles overnight, and transduced cells were selected with blasticidin (Bsd). Short hairpin RNA (shRNA) expression and subsequent knockdown were induced by the addition of 1 μg/mL doxycycline (Sigma-Aldrich). The shRNA sequences encoded by the lentiviral particles were as follows:

  • shRNA#1 - 5′-GGC TGA TAG ACT GAT TGC TCA-3′

  • shRNA#2 - 5′-GAG TGA TAT TGA GCA TCT CTT-3′

  • shRNA control - 5′-GTC TCC ACG CGC AGT ACA TTT-3′

Chemical inhibitors

The following small-molecule chemical inhibitors were purchased (i) CHK1 Inhibitors: PF477736 (Sigma-Aldrich) and SB218078 (Merck) and (ii) STAT3 inhibitors: Stattic (Sigma-Aldrich) and S3I-201 (Sigma-Aldrich). Cells were treated at indicated concentrations for indicated duration.

siRNA transfections

HP Validated siRNAs for human CHK1, CIP2A, and STAT3 were initially purchased from Qiagen Technologies. Cells were transfected with 100 pmoles of siRNA per well in a 6-well plate using Lipofectamine RNAiMAX (Thermo Fisher Scientific) in antibiotic-free growth medium, as per the manufacturer's instructions. For Western blots, cells were harvested and lysates prepared 72 hours posttransfection. Stem cell media (SCM, 2 mL) was added after 6 hours in each well. After 6 more hours, wells were washed with PBS twice and 2 mL of fresh SCM was added. Cells were harvested at 72 hours after transfection to determine the effect on protein expression. The siRNA sequences used were as follows;

  • Scr. (Control)- 5′-UAA CAA UGA GAG CAC GGC TT-3′

  • CHK1.1- 5′-AAC UGA AGA AGC AGU CGC AGU TT-3′

  • CHK1.2- 5′-AAG AAA GAG AUC UGU AUC AAU TT-3′

  • CIP2A.1- 5′-CUG UGG UUG UGU UUG CAC UTT-3′

  • CIP2A.2- 5′-ACC AUU GAU AUC CUU AGA ATT-3′

  • STAT3.1- 5′-CAG CCT CTC TGC AGA ATT CAA-3′

  • STAT3.2- 5′-CAG GCT GGT AAT TTA TAT AAT-3′

  • STAT3.3- 5′-AAC GTT ATA TAG GAA CCG TAA-3′

Transient transfections of plasmids (promoter constructs) and luciferase assays

Previously generated CIP2A promoter construct was transfected into the U251MG cells along with a control plasmid encoding Renilla luciferase (Promega). Luciferase activity was measured using the Dual-Glo Luciferase Assay System (Promega) and a GloMAX Luminometer (Promega). CIP2A promoter–driven luciferase signal was normalized to Renilla luciferase to account for variation in transfection efficiencies.

RNA expression measurements

RNA was extracted and reverse transcribed using standard commercial reagents. For inhibitor studies, RNA was collected 24 hours posttreatment. qPCR was performed either using PowerUP SYBR Green Master Mix (Life Technologies) and a ViiA 7 Real-Time PCR System (Thermo Fisher Scientific) or SYBR Green PCR Master Mix (Applied Biosystems) and a Rotor-Gene 3000 Machine (Corbett Research). Primers used were as follows:

  • CIP2A F: CTGGTGAGATAATCAGCAATTT

  • CIP2A R: CGAAACATTCATCAGACTTTTCA

  • REEP5 F: TGGTGTTCGGTTATGGAGCCTCTC

  • REEP5 R: GGTCAGCCACTGGGTATCATCTTC

  • ACTB F: CACACTGTGCCCATCTACGA

  • ACTB R: GTGGTGGTGAAGCTGTAGCC

REEP5 (19) was used as the reference gene in drug inhibitor studies and ACTB was used as the reference gene for orthotopic tumor samples. Expression changes were calculated using the ΔΔCt method, and error bars show upper and lower limits (drug inhibitor studies) or SEM (orthotopic tumor samples).

Senescence assays

To detect senescent cells, U251MG and WK1 cells were fixed and stained for SA-β-gal at pH 6.0 (Sigma-Aldrich) according to the manufacturer's protocol. Senescent cells in in vitro assays were quantified under the microscope (seven random fields) by counting morphologically flattened and SA-β-gal–positive cells.

Glioma mouse models

Both orthotopic and heterotopic mouse models were established and the tumor size was measured and imaged using the U251MG cell line as described previously (18).

Heterotopic model

For heterotopic xenograft studies, 7- to 9-week-old female BALB/c nude mice were sourced from the UNSW Biological Resource Centre. Mice were held in groups of five at a 12-hour day and night cycle and were given animal chow and water ad libitum. U251MG cells transfected 3 days previously with either scrambled control (Scr.) or CIP2A siRNAs were resuspended at 3 × 106 cells in 0.1 mL of PBS and injected subcutaneously in the proximal midline. Tumor volume and animal weight was measured every 3 to 5 days. Tumor volume was calculated using the relationship length × height × width × 0.523. Tumors were harvested for further analysis at either day 22 or 32.

Orthotopic model

For orthotopic xenograft studies, 5-week-old female NOD/SCID (NOD.CB17-Prkdc scid/Arc) animals were sourced from the Animal Resources Centre (Canning Vale Western, Australia). U251MG-Luc cells transfected 3 days previously with either Scr. or CIP2A siRNAs were counted and 1.5 × 105 cells engrafted intracranially into the right striatum (0.8 mm lateral of the midline, 1.6 mm caudal to the bregma, at a depth of 3 mm) using a small animal stereotactic device. Mice were given analgesia [Meloxicam (Ilium) 5 mg/kg, delivered subcutaneously] 30 minutes prior to surgery and again the following day. Mice were monitored daily for signs of illness or tumor burden, as per our ethical guidelines, animal monitoring criteria, and scoring. Tumor growth was monitored by measuring luminescence of the implanted cells. At endpoint, animals were euthanized by cervical dislocation and tumors harvested for further analysis.

Chromatin immunoprecipitation

Chromatin immunoprecipitation (ChIP) was performed using 2 × 107 cells per immunoprecipitation condition with antibodies against STAT3 (Santa Cruz Biotechnology catalog no. sc-482x, RRID: AB_632440) or non-specific IgG (Sigma catalog no. I5006, RRID: AB_1163659). Cells were cross-linked with 1% formaldehyde in PBS for 10 minutes at room temperature then incubated with 0.125 mol/L glycine to quench the reaction. Cells were washed with PBS and lysed on ice in cell lysis buffer [10 mmol/L Tris (pH 8.0), 10 mmol/L NaCl, 0.2% NP-40] for 10 minutes to recover nuclei. Nuclei were lysed in nuclei lysis buffer [50 mmol/L Tris, 10 mmol/L EDTA, 1% SDS (pH 8.0)] on ice for 10 minutes. The resulting chromatin was diluted in immunoprecipitation dilution buffer [20 mmol/L Tris (pH 8.0), 2 mmol/L 10 EDTA, 150 mmol/L NaCl, 1% Triton-X100, 0.01% SDS] and sonicated using a BioRuptor Pico Sonicator (Diagenode) to yield an average fragment size of approximately 200 bp. The fragmented chromatin was precleared with rabbit IgG, then rotated overnight at 4°C with 10 μg of either anti-STAT3 antibody or IgG as a negative control. Immune complexes were recovered with protein G Agarose (Roche), and following reversal of cross-linking, DNA was purified using phenol:chloroform:isoamyl alcohol, precipitated, and resuspended in water. For quantitation of STAT3 enrichment, qPCR was performed using PowerUP SYBR Green Master Mix (Life Technologies) and a MX3000P PCR Machine (Stratagene). Primers used were:

  • CIP2A_P_r1 F: GCCAGGGGTCGAGGTGATTTG

  • CIP2A_P_r1 R: TCTCAGACGAGGGTGGGTTAGC

  • CIP2A_P_r2 F: CGCTAACCCACCCTCGTCTG

  • CIP2A_P_r2 R: CCTTCTCCTAACCGATTCCTCTCC

  • CIP2A_P_r3 F: TTCCTCGTCCTTCATGTTGGATG

  • CIP2A_P_r3 R: GGGCAAGCGACCATTTCTCAG

Statistical and bioinformatics analysis

Expression (mRNA) and survival data were mined from the REpository for Molecular BRAin Neoplasia DaTa (REMBRANDT) database. Raw gene expression array data were downloaded from the REMBRANDT database (https://wiki.nci.nih.gov/display/ICR/Rembrandt+Data+Portal) and summarized into gene expression values using the robust multichip average (RMA) algorithm. Differential expression between high and low grade was tested with a t test under means are equal null hypothesis. Bonferroni corrected P values less than 0.05 were considered significant. Kaplan–Meier analysis was used to determine the survival effect based on gene expression data. The statistical significance of Kaplan–Meier curves was evaluated with the log-rank test. Further, R2 Genomics Analysis and Visualization Platform (http://r2.amc.nl) was accessed to mine the microarray expression in the normal brain and other glioma studies. One-way ANOVA followed by Dunnett post hoc test was used to establish significant difference in expression profiles between normal brain and various glioma samples from the indicated studies. Correlation between CHK1 and CIP2A expression was established using Pearson Correlation Coefficient. Additional statistical tests were performed using GraphPad Prism software. For all figures, *, P < 0.05; **, P < 0.01.

High CHK1 and CIP2A expression in human gliomas is associated with worse overall survival

To explore potential links between CHK1 and CIP2A expression in gliomas, we first screened the NCI's REMBRANDT dataset (n = 523) for genes with a high positive correlation with CHK1 mRNA in gliomas and negligible or negative correlation in normal brain. CIP2A satisfied these criteria with a Pearson correlation coefficient of r = 0.77 in gliomas and r = −0.3 in normal brain (Fig. 1A). High CHK1 and CIP2A mRNA expression levels were also associated with worse overall survival in both gliomas and astrocytomas with greater significance seen in malignant gliomas (Fig. 1B and C). High-CIP2A copy number (n > 2) was also strikingly associated with a lower probability of survival (Fig. 1D).

Figure 1.

CHK1 and CIP2A expression levels are positively correlated in human gliomas and high expression is associated with worse overall survival. A, Pearson correlation of CHK1 and CIP2A mRNA expression in human gliomas (n = 425) and normal brain (n = 21) from the REMBRANDT study. B, Tumor samples were profiled for CHK1 mRNA, which was split into high versus low by median percentile as preset threshold for Kaplan–Meier analysis and percent survival in patients with glioma (n = 329; left) and astrocytoma (n = 102; right) determined. The log-rank value was calculated using Mantel–Haenszel procedure. C, Tumor samples were profiled for CIP2A mRNA, which was split into high versus low by median percentile as preset threshold for Kaplan–Meier analysis and percent survival in patients with glioma (n = 329; left) and astrocytoma (n = 102; right) determined. The log-rank value was calculated using Mantel–Haenszel procedure. D, Survival distributions of patients with more than 2 or ≤ 2 CIP2A copies in gliomas (left) and astrocytomas (right). E, mRNA expression levels of CHK1 (left) and CIP2A (right) in normal brain and human gliomas. P values were calculated using one-way ANOVA (normal brain, n = 172; Gravendeel, n = 284; Paugh, n = 53; Sun, n = 153; and Murat, n = 84). F, CHK1 and CIP2A mRNA expression in PTEN-mutant gliomas with functional p53 (left) and mutant p53 (right) compared with normal brains in wild-type (WT, n = 3; PTEN mutant, n = 12; and PTEN/p53 dual mutant, n = 8). GEM, genetically engineered mouse.

Figure 1.

CHK1 and CIP2A expression levels are positively correlated in human gliomas and high expression is associated with worse overall survival. A, Pearson correlation of CHK1 and CIP2A mRNA expression in human gliomas (n = 425) and normal brain (n = 21) from the REMBRANDT study. B, Tumor samples were profiled for CHK1 mRNA, which was split into high versus low by median percentile as preset threshold for Kaplan–Meier analysis and percent survival in patients with glioma (n = 329; left) and astrocytoma (n = 102; right) determined. The log-rank value was calculated using Mantel–Haenszel procedure. C, Tumor samples were profiled for CIP2A mRNA, which was split into high versus low by median percentile as preset threshold for Kaplan–Meier analysis and percent survival in patients with glioma (n = 329; left) and astrocytoma (n = 102; right) determined. The log-rank value was calculated using Mantel–Haenszel procedure. D, Survival distributions of patients with more than 2 or ≤ 2 CIP2A copies in gliomas (left) and astrocytomas (right). E, mRNA expression levels of CHK1 (left) and CIP2A (right) in normal brain and human gliomas. P values were calculated using one-way ANOVA (normal brain, n = 172; Gravendeel, n = 284; Paugh, n = 53; Sun, n = 153; and Murat, n = 84). F, CHK1 and CIP2A mRNA expression in PTEN-mutant gliomas with functional p53 (left) and mutant p53 (right) compared with normal brains in wild-type (WT, n = 3; PTEN mutant, n = 12; and PTEN/p53 dual mutant, n = 8). GEM, genetically engineered mouse.

Close modal

To validate these findings, we interrogated CHK1 and CIP2A gene expression data in 183 normal human brain (20, 21) and 776 human glioma samples (refs. 21–25; Fig. 1E; Supplementary Fig. S1A and S1B). Both CHK1 and CIP2A had significantly higher mRNA expression levels in tumors (gliomas) compared with normal brain. As previously observed with the REMBRANDT cohort, statistically significant correlations were also observed between CHK1 and CIP2A mRNA expression in gliomas in these other cohorts (Supplementary Fig. S1C–S1G) and in a series of patient-derived GBM lines (Supplementary Fig. S1H). Kaplan–Meier analysis for both CHK1 and CIP2A showed significantly lower overall survival (Supplementary Fig. S2A–S2D) for patients with glioma with high expression of either of these genes.

CIP2A is an established endogenous inhibitor of the PP2A tumor suppressor complex (6, 26–28). Interestingly, a recent study has demonstrated direct interaction with the regulatory PP2A subunits B56α/PPP2R5A and B56γ/PPP2R5C (29). Therefore, we estimated the expression levels of these two and other PP2A subunits previously observed to be associated with human cancers (30). Notably, a decrease in expression for all the PP2A subunits we assessed was noted in the glioma samples compared with their normal counterpart, thereby further strengthening the evidence for the oncogenic role of CIP2A in gliomas (Supplementary Fig. S2E–S2J). In addition, expression data from human gliomas indicates that gliomagenesis is driven by a population of stem-like cells (17, 31). Therefore, we interrogated and correlated the expression levels of both CHK1 and CIP2A in cells derived from normal brain cortex and from human glioma cancer stem cells (CSC; ref. 17). In accordance with these results, both genes were highly expressed in malignant cells compared with the normal cell populations (Supplementary Fig. S3A and S3B).

Further evidence for CHK1 and CIP2A gene activation in gliomas was sought in gene expression data (GSE29458) generated in a PDGF-cre–driven genetically engineered mouse model (32). CHK1 and CIP2A mRNA levels were approximately 10- and 14- fold higher in gliomas that developed in PDGF-cre; PTEN f/f, and in PDGF-cre; PTEN f/f + TP53 f/f–mutant mice, respectively, compared with wild-type controls (Fig. 1F). There was a decrease or no significant change in expression values of the various PP2A subunits in these mouse models (data not shown).

Taken together, these data show that CHK1 and CIP2A expression levels in gliomas are positively correlated with each other and that high expression was associated with worse clinical outcomes.

CHK1 positively regulates CIP2A expression levels in GBM cells

CHK1 regulates DNA damage–induced gene transcription (33). To evaluate whether perturbing CHK1 activity impacts on CIP2A transcription, we first tested the activity of a CIP2A luciferase reporter construct in U251MG cells in the presence or absence of PF477736, a small-molecule CHK1 inhibitor (Fig. 2A). Inhibiting CHK1 activity by PF477736 reduced CIP2A promoter luciferase activity. Treating U251MG GBM cells with PF477736 also inhibited endogenous CIP2A mRNA (Fig. 2B) and protein levels (Fig. 2C). These findings were validated using a second CHK1 inhibitor (SB219078) in U251MG and U87MG cells, the latter being a different GBM cell line (Fig. 2D). To complement these experiments, we next used a siRNA-based approach. Two different siRNAs against CHK1 were transfected into U251MG (Fig. 2E) and WK1 patient-derived GBM cells (Fig. 2F), along with the Scr. to assess the impact on CIP2A protein expression. There was significant reduction of CIP2A expression in both U251MG and WK1 cells, independently supporting the role of CHK1 as a positive regulator of CIP2A expression in GBM.

Figure 2.

CHK1 positively regulates CIP2A expression in GBM cells. A, Activity of the CIP2A promoter (schematic; left) in luciferase reporter assays in U251MG GBM cells in the presence or absence of a small-molecule CHK1 inhibitor, PF477736 (n = 3). B,CIP2A RNA expression in U251MG cells treated with 5 μmol/L PF477736 relative to REEP5 and normalized to DMSO control (n = 2). C, Western blots for CIP2A protein levels in U251MG cells with increasing concentrations of PF477736. D, Western blots (left) and corresponding protein densitometry (right) for CIP2A protein levels in U251MG and U87MG GBM cells with a second CHK1 inhibitor SB219078. E, Western blots (left) and protein densitometry (right) for CHK1 and CIP2A protein in U251MG GBM cells at 72 hours following treatment with control (Scr), CIP2A siRNA, and two separate CHK1 siRNAs. F, Western blots (left) and protein densitometry (right) for CHK1 and CIP2A protein in primary glioma CSCs (WK1) at 72 hours following treatment with control (Scr) and two separate CHK1 siRNAs. C–F, Blots representative of at least two experiments and their corresponding densitometric quantitation.

Figure 2.

CHK1 positively regulates CIP2A expression in GBM cells. A, Activity of the CIP2A promoter (schematic; left) in luciferase reporter assays in U251MG GBM cells in the presence or absence of a small-molecule CHK1 inhibitor, PF477736 (n = 3). B,CIP2A RNA expression in U251MG cells treated with 5 μmol/L PF477736 relative to REEP5 and normalized to DMSO control (n = 2). C, Western blots for CIP2A protein levels in U251MG cells with increasing concentrations of PF477736. D, Western blots (left) and corresponding protein densitometry (right) for CIP2A protein levels in U251MG and U87MG GBM cells with a second CHK1 inhibitor SB219078. E, Western blots (left) and protein densitometry (right) for CHK1 and CIP2A protein in U251MG GBM cells at 72 hours following treatment with control (Scr), CIP2A siRNA, and two separate CHK1 siRNAs. F, Western blots (left) and protein densitometry (right) for CHK1 and CIP2A protein in primary glioma CSCs (WK1) at 72 hours following treatment with control (Scr) and two separate CHK1 siRNAs. C–F, Blots representative of at least two experiments and their corresponding densitometric quantitation.

Close modal

CHK1 and CIP2A promote growth of GBM cells

To assess the impact of CHK1 inhibition on GBM cells, we first treated U251MG, U87MG, and WK1 cells with PF477736 at various concentrations and assessed cell viability. All three cell types showed reduced viability at increasing concentrations of the CHK1 inhibitor (Fig. 3A). U251MG and U87MG cells also showed reduced viability in the presence of an additional CHK1 inhibitor, SB18078 (Supplementary Fig. S4A). U251MG cells were particularly sensitive to CHK1 inhibition. Colony-forming capacity (Fig. 3B) and cell proliferation (Fig. 3C) also diminished when U251MG cells were treated with increasing concentrations of PF477736. Tumorsphere assays were used to assess self-renewal capacity of cancer cells. It is a preferred platform for screening potential anticancer stem cell drugs and reflects in vivo antitumorigenic activity (34, 35). Tumorsphere forming capacity was progressively reduced with increasing concentrations of PF477736 (Fig. 3D). CHK1 and CIP2A inhibition by siRNA, an alternate way to silence the genes, also reduced cell viability (Fig. 3E) and colony-forming capacity (Fig. 3F) in GBM cells; knockdown of CIP2A also reduced cell proliferation (Supplementary Fig. S4B) in GBM cells. Inhibiting CHK1 and CIP2A by siRNA also inhibited tumorsphere-forming capacity of U251MG as well as WK1, primary glioma CSC line (Fig. 3G and H). We then tested whether the effect of CHK1 knockdown was mediated by CIP2A. Increased expression of CIP2A rescued the reduced colony-forming capacity observed when CHK1 was reduced in U251MG, U87MG, and WK1 cells (Fig. 3I), confirming that CHK1 acts via CIP2A in promoting growth of GBM cells.

Figure 3.

Depleting CHK1 and CIP2A impairs GBM cell viability, proliferation, clonogenicity, and tumorsphere-forming capacity. A, Relative cell viability of U251MG, U87MG, and WK1 primary cells at day 6 following treatment with a small-molecule inhibitor against CHK1 (PF477736) compared with vehicle (DMSO) and no treatment (Noth; n = 3). B, Colony-forming capacity of untreated and PF477736-treated U251MG cells. C, xCELLigence U251MG cell proliferation assays in the presence of DMSO control or increasing concentrations of PF477736 (n = 4). D, Tumorsphere-forming capacity (3D cultures) of untreated and PF477736-treated U251MG cells. E, Relative cell viability of U251MG, U87MG, and WK1 primary cells at 72 hours following exposure to two separate CIP2A or CHK1 siRNAs or control siRNA (Scr; n = 3). F, Colony-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) U251MG cells. G, Tumorsphere-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) U251MG and WK1 cells. H, Tumorsphere-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) WK1 primary cells. I, Colony-forming capacity of CHK1-depleted (siRNA) and control (Scr) GBM cells in the presence (CIP2A-flag) or absence (pcDNA3.1) of overexpressed CIP2A. Representative colony images for U251MG (left). Images shown across panels are at identical magnification as indicated. Colony counts for U251MG, U87MG, and WK1 (n = 3; right). Indicated P values were calculated using a t test.

Figure 3.

Depleting CHK1 and CIP2A impairs GBM cell viability, proliferation, clonogenicity, and tumorsphere-forming capacity. A, Relative cell viability of U251MG, U87MG, and WK1 primary cells at day 6 following treatment with a small-molecule inhibitor against CHK1 (PF477736) compared with vehicle (DMSO) and no treatment (Noth; n = 3). B, Colony-forming capacity of untreated and PF477736-treated U251MG cells. C, xCELLigence U251MG cell proliferation assays in the presence of DMSO control or increasing concentrations of PF477736 (n = 4). D, Tumorsphere-forming capacity (3D cultures) of untreated and PF477736-treated U251MG cells. E, Relative cell viability of U251MG, U87MG, and WK1 primary cells at 72 hours following exposure to two separate CIP2A or CHK1 siRNAs or control siRNA (Scr; n = 3). F, Colony-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) U251MG cells. G, Tumorsphere-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) U251MG and WK1 cells. H, Tumorsphere-forming capacity of CHK1- and CIP2A-depleted (siRNA) and control (Scr) WK1 primary cells. I, Colony-forming capacity of CHK1-depleted (siRNA) and control (Scr) GBM cells in the presence (CIP2A-flag) or absence (pcDNA3.1) of overexpressed CIP2A. Representative colony images for U251MG (left). Images shown across panels are at identical magnification as indicated. Colony counts for U251MG, U87MG, and WK1 (n = 3; right). Indicated P values were calculated using a t test.

Close modal

CIP2A expression helps maintain GBM tumorspheres

To evaluate whether CIP2A plays a role in tumor maintenance, we used a tetracycline-based inducible lentiviral-knockdown system (Fig. 4A). U251MG cells were transduced with lentiviruses expressing TetR (tetracycline repressor) in conjunction with red fluorescence protein (RFP) and CIP2A or control shRNA in conjunction with GFP. The H1 promoter of the shRNA-GFP vector is suppressed by TetR expressed from the RFP vector. This suppression is released in the presence of tetracycline. The efficiency of CIP2A knockdown was tested using two different shRNAs (Fig. 4B). Next, we plated equal numbers of U251MG cells carrying either control shRNA or CIP2A shRNA in 3D cell culture and allowed them to form tumorspheres. Following the formation of tumorspheres, tetracycline was added to the culture medium (day 0) to induce expression of control and CIP2A shRNAs and tumorspheres were followed for 22 days. Pictures were taken on day 0 (Fig. 4C, left) and day 22 (Fig. 4C, right). Tumorspheres formed at day 0 were abrogated upon induced silencing of the CIP2A gene using two different CIP2A shRNAs (Fig. 4C).

Figure 4.

Inducible depletion of CIP2A abrogates GBM tumorspheres. A, Schematic diagrams of the shRNA-GFP (top) and TetR-RFP (bottom) lentiviral vectors which together allow inducible expression of shRNAs. The H1 promoter of the shRNA-GFP vector is inhibited by TetR protein constitutively produced by the TetR-RFP vector. This inhibition is released upon tetracycline treatment. B, Western blots of U251MG cells transduced with lentiviral particles as shown in A and treated with tetracycline (1 μg/mL). C, Brightfield microscopy images of U251MG tumorspheres generated from control and CIP2A shRNA-transduced cells prior to (day 0) and after (day 22) tetracycline-induced CIP2A depletion.

Figure 4.

Inducible depletion of CIP2A abrogates GBM tumorspheres. A, Schematic diagrams of the shRNA-GFP (top) and TetR-RFP (bottom) lentiviral vectors which together allow inducible expression of shRNAs. The H1 promoter of the shRNA-GFP vector is inhibited by TetR protein constitutively produced by the TetR-RFP vector. This inhibition is released upon tetracycline treatment. B, Western blots of U251MG cells transduced with lentiviral particles as shown in A and treated with tetracycline (1 μg/mL). C, Brightfield microscopy images of U251MG tumorspheres generated from control and CIP2A shRNA-transduced cells prior to (day 0) and after (day 22) tetracycline-induced CIP2A depletion.

Close modal

Depletion of CIP2A impairs in vivo GBM growth

To test whether depleting CIP2A impairs glioma progression in vivo, we used a heterotopic transplant model. U251MG cells were transfected with CIP2A and scrambled (control) siRNAs and transplanted into the flanks of BALB/c nude mice 72 hours posttransfection and harvested at days 22 and 32 for analysis as shown in the timeline (Fig. 5A). U251MG cells transfected with CIP2A siRNA had little or no CIP2A protein at the time of transplantation (Fig. 5B). Weights and volumes of tumors generated from CIP2A-depleted cells were significantly lower than in controls (Fig. 5CE). As previously shown, CIP2A siRNAs achieved prolonged depletion of target protein (Fig. 5F; refs. 26, 36) and these tumors showed less necrosis and fewer pseudopalisades (Fig. 5G) and lower proliferative indices (Fig. 5H).

Figure 5.

CIP2A depletion retards in vivo GBM tumor growth. A, Schema of the heterotopic experiment (n = 5 for each of Scr. and CIP2A siRNA groups). B, Western blot analysis of U251MG cells transfected with control (Scr.) and CIP2A siRNAs (72 hours posttransfection). C, Weights of individual tumors harvested from mice at day 22. P = 0.0004, unpaired t test. D, Serial measurements and volume estimates of tumors at the site of transplantation. P = 0.0134, two-way ANOVA. E, Weights of individual tumors harvested from mice at day 32. P = 0.0005, unpaired t test. F, IHC showing CIP2A expression in sections from control (Scr) and CIP2A siRNA–transfected tumors harvested at day 32. G, Hematoxylin and eosin (H&E)-stained sections of control (Scr) and CIP2A siRNA–transfected tumors harvested at day 32. H, IHC showing Ki-67 expression per high-power field in sections from control (Scr) and CIP2A siRNA transfected tumors harvested at day 32. Indicated P values were calculated using a Mann–Whitney test. F–H, Images shown across panels are at identical magnification as indicated. I, Schema of the orthotopic experiment (n = 5 for each of Scr. and CIP2A siRNA groups). J, Bioluminescence of intracranial tumors generated with U251MG-Luc cells transfected with control or CIP2A siRNAs, at day 1 and day 27 posttransplantation. K, Survival curves of mice with intracranial tumors generated with U251MG-Luc cells transfected with control or CIP2A siRNAs. P = 0.0176, log-rank test.

Figure 5.

CIP2A depletion retards in vivo GBM tumor growth. A, Schema of the heterotopic experiment (n = 5 for each of Scr. and CIP2A siRNA groups). B, Western blot analysis of U251MG cells transfected with control (Scr.) and CIP2A siRNAs (72 hours posttransfection). C, Weights of individual tumors harvested from mice at day 22. P = 0.0004, unpaired t test. D, Serial measurements and volume estimates of tumors at the site of transplantation. P = 0.0134, two-way ANOVA. E, Weights of individual tumors harvested from mice at day 32. P = 0.0005, unpaired t test. F, IHC showing CIP2A expression in sections from control (Scr) and CIP2A siRNA–transfected tumors harvested at day 32. G, Hematoxylin and eosin (H&E)-stained sections of control (Scr) and CIP2A siRNA–transfected tumors harvested at day 32. H, IHC showing Ki-67 expression per high-power field in sections from control (Scr) and CIP2A siRNA transfected tumors harvested at day 32. Indicated P values were calculated using a Mann–Whitney test. F–H, Images shown across panels are at identical magnification as indicated. I, Schema of the orthotopic experiment (n = 5 for each of Scr. and CIP2A siRNA groups). J, Bioluminescence of intracranial tumors generated with U251MG-Luc cells transfected with control or CIP2A siRNAs, at day 1 and day 27 posttransplantation. K, Survival curves of mice with intracranial tumors generated with U251MG-Luc cells transfected with control or CIP2A siRNAs. P = 0.0176, log-rank test.

Close modal

Although heterotopic tumor transplants are convenient, orthotopic transplants more accurately reflect in vivo realities. As such, U251MG-Luciferase (U251MG-Luc) cells transfected with either control (Scr.) or CIP2A siRNAs were implanted into the brains of NOD/SCID mice (Fig. 5I). Ideally such a model would utilize primary patient samples. However, preliminary experiments indicated that CIP2A knockdown was not sustained over the long time periods required to establish WK1 tumors (Supplementary Fig. S5A). Therefore, we continued using U251MG cells where CIP2A knockdown was sustained for the duration of the experiment (Supplementary Fig. S5A). U251MG-Luc cells were first tested both in vitro and in vivo to confirm the luciferase activity (Supplementary Fig. S5B and S5C). The tumors were imaged using bioluminescence with animal survival as the primary endpoint. U251MG-Luc cells transfected with CIP2A siRNA had significantly retarded tumor growth measured by bioluminescence (Fig. 5J), which translated into a survival advantage for these mice (Fig. 5K).

Depletion of CIP2A induces senescence in GBM cells

We have previously established that depletion of CIP2A induces senescence in cancer cells (37). This, and the strikingly long duration of the effects of CIP2A siRNA observed both in vitro and in vivo (26, 36) prompted us to assess whether CIP2A depletion induced senescence in GBM cells. Accordingly, U251MG cells were transfected with two different CIP2A siRNAs and the morphology of these cells assessed under the microscope. Cells depleted of CIP2A were larger in size and had flattened cell morphology (Supplementary Fig. S5D). Acidic senescence–associated β-galactosidase (SA-β-Gal) activity has been demonstrated to be a biochemical marker of senescent cells in vitro and in vivo (38). Therefore, using a fluorometric-based assay, we estimated the activity of SA-β-Gal in control (Scr.) and CIP2A-depleted cells. Attenuation of CIP2A expression by two different siRNAs resulted in increased SA-β-Gal activity compared with control (Scr.) siRNA-transfected cells (Supplementary Fig. S5E). Furthermore, CIP2A siRNA and control (Scr.) siRNA-transfected U251MG and WK1 GBM cells were fixed and stained for SA-β-gal at pH 6.0. CIP2A depletion increased the number of senescent-positive cells in U251MG (Supplementary Fig. S5F) and WK1 cells (Supplementary Fig. S5G).

CIP2A expression in GBM is maintained by a recursive pSTAT3–CIP2A loop

To identify potential mediators of CHK1-driven CIP2A expression, we probed the literature for transcription factors associated with DNA damage signaling (39). This search highlighted several potential transcription factors including STAT3, an established therapeutic target in GBM (40). Interestingly, a recent genome-wide study investigating genome-wide binding profiles of STAT3 in GBM cells had revealed enrichment at the CIP2A locus (41). Furthermore, ChIP-Seq data (42) also showed STAT3 enrichment at the CIP2A promoter in HCC70 and MBA-MD-468 (human breast cancer) cells (Supplementary Fig. S6A). Given these links, we hypothesized that CHK1 mediated STAT3 phosphorylation, which in turn enhanced CIP2A expression in GBM.

Therefore, we probed for pSTAT3 levels following CHK1 interference using two different siRNAs in U251MG cells (Fig. 6A) and RN1 and WK1 cells [Supplementary Fig. S6B (i and ii) and S6C (i and ii)]. Although total STAT3 levels were unaltered, pSTAT3 and CIP2A levels were dramatically reduced in CHK1-depleted cells in comparison with the control (Scr.). STAT3 was bound to the CIP2A promoter in U251MG cells (Fig. 6B; Supplementary Fig. S6D) and WK1 and U87MG cells (Supplementary Fig. S6D). Treatment with different small-molecule inhibitors of STAT3 (Stattic and S31-201) decreased CIP2A promoter luciferase activity (Fig. 6C), and treatment with Stattic decreased endogenous CIP2A protein in U251MG cells (Fig. 6D) and RN1 and WK1 cells (Supplementary Fig. S6E). These observations were validated using multiple STAT3 siRNAs [Fig. 6E; Supplementary Fig. S6B (i and iii) and S6C (i and iii)]. Interestingly, depletion of CIP2A also resulted in reduced levels of pSTAT3 [Fig. 6F; Supplementary Fig. S6B (i and iv) and S6C (i and iv)]. Retrospective analysis of tumors harvested from heterotopic transplants (Fig. 5), showed that pSTAT3 protein levels were significantly lower in GBMs generated from U251MG cells transfected with CIP2A siRNA (Fig. 6G). Immunoprecipitation assays revealed that CIP2A and STAT3 form an endogenous protein complex in U251MG cells (Fig. 6H) and in RN1 and WK1 cells (Supplementary Fig. S6F). To evaluate the activity of the CHK1–STAT3–CIP2A axis in primary and recurrent GBMs relative to NHA, we performed immunofluorescence microscopy for pCHK1 (Fig. 6I) and Western blotting for pSTAT3 and CIP2A expression (Fig. 6J). Compared with NHA, GBM cell lines and primary and secondary patient-derived GBM cells had increased pSTAT3-CIP2A expression. Taken together, these results show that high CIP2A expression in GBM is maintained by a pSTAT3-CIP2A recursive loop (Fig. 6K).

Figure 6.

CIP2A expression in GBM is maintained by a recursive pSTAT3–CIP2A loop. A, Western blot analysis of U251MG cells transfected with control (Scr) and CHK1 siRNAs (72 hours posttransfection; left). Corresponding densitometry for STAT3, pSTAT3, CHK1, and CIP2A protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). B, ChIP-PCR analysis of STAT3 binding to the CIP2A promoter in U251MG cells. C, Luciferase reporter assays of U251MG cells stably transfected with a CIP2A promoter luciferase construct and treated with DMSO control or increasing concentrations of small-molecule inhibitors of STAT3 (Stattic and S3I-201). Graph shows firefly luciferase activity normalized to Renilla luciferase activity. P values were calculated using a t test; *, P < 0.05; (n = 3). D, Western blot analysis of U251MG cells showing CIP2A expression following treatment with either DMSO control or 40 μmol/L Stattic (top). Corresponding densitometry of CIP2A protein relative to ACTIN and normalized to DMSO control (bottom). E, Western blot analysis of U251MG cells transfected with control (Scr) and STAT3 siRNAs (72 hours posttransfection; left). Corresponding densitometry for STAT3 and CIP2A protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). F, Western blot analysis of U251MG cells transduced with control (Scr) and CIP2A siRNAs (72 hours posttransfection; left). Corresponding densitometry for CIP2A, STAT3, and pSTAT3 protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). A and D–F, Blots representative of at least two experiments. G, IHC for pSTAT3 expression in tumors (day 32 heterotopic harvests) from U251MG cells transduced with control (Scr) or CIP2A siRNAs (left). Images shown across panels are at identical magnification. Quantification of pSTAT3-expressing cells in sections from the periphery and center of tumors (right). Indicated P values were calculated using a Mann–Whitney test. H, Coimmunoprecipitation of CIP2A using a STAT3 antibody in U251MG cells (n = 3). I, Immunofluorescence showing pCHK1 in U251MG and NHA. Images shown across panels are at identical magnification. J, Western blot analysis showing pSTAT3 and CIP2A expression in NHA and U251MG in relation to levels in primary glioma and recurrent GBM cells (top). Densitometry (numbers) for pSTAT3/ACTIN and CIP2A/ACTIN ratios are relative to those in NHA (bottom). Plotting densitometry numbers indicates a strong correlation between pSTAT3 and CIP2A expression across these cells (Spearman correlation r = 0.9762; P = 0.0004; right). K, A schematic summary of the proposed axis for CIP2A activation in GBM. IB, immunoblotting; IP, immunoprecipitation.

Figure 6.

CIP2A expression in GBM is maintained by a recursive pSTAT3–CIP2A loop. A, Western blot analysis of U251MG cells transfected with control (Scr) and CHK1 siRNAs (72 hours posttransfection; left). Corresponding densitometry for STAT3, pSTAT3, CHK1, and CIP2A protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). B, ChIP-PCR analysis of STAT3 binding to the CIP2A promoter in U251MG cells. C, Luciferase reporter assays of U251MG cells stably transfected with a CIP2A promoter luciferase construct and treated with DMSO control or increasing concentrations of small-molecule inhibitors of STAT3 (Stattic and S3I-201). Graph shows firefly luciferase activity normalized to Renilla luciferase activity. P values were calculated using a t test; *, P < 0.05; (n = 3). D, Western blot analysis of U251MG cells showing CIP2A expression following treatment with either DMSO control or 40 μmol/L Stattic (top). Corresponding densitometry of CIP2A protein relative to ACTIN and normalized to DMSO control (bottom). E, Western blot analysis of U251MG cells transfected with control (Scr) and STAT3 siRNAs (72 hours posttransfection; left). Corresponding densitometry for STAT3 and CIP2A protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). F, Western blot analysis of U251MG cells transduced with control (Scr) and CIP2A siRNAs (72 hours posttransfection; left). Corresponding densitometry for CIP2A, STAT3, and pSTAT3 protein expression is shown relative to ACTIN and normalized to levels in Scr controls (right). A and D–F, Blots representative of at least two experiments. G, IHC for pSTAT3 expression in tumors (day 32 heterotopic harvests) from U251MG cells transduced with control (Scr) or CIP2A siRNAs (left). Images shown across panels are at identical magnification. Quantification of pSTAT3-expressing cells in sections from the periphery and center of tumors (right). Indicated P values were calculated using a Mann–Whitney test. H, Coimmunoprecipitation of CIP2A using a STAT3 antibody in U251MG cells (n = 3). I, Immunofluorescence showing pCHK1 in U251MG and NHA. Images shown across panels are at identical magnification. J, Western blot analysis showing pSTAT3 and CIP2A expression in NHA and U251MG in relation to levels in primary glioma and recurrent GBM cells (top). Densitometry (numbers) for pSTAT3/ACTIN and CIP2A/ACTIN ratios are relative to those in NHA (bottom). Plotting densitometry numbers indicates a strong correlation between pSTAT3 and CIP2A expression across these cells (Spearman correlation r = 0.9762; P = 0.0004; right). K, A schematic summary of the proposed axis for CIP2A activation in GBM. IB, immunoblotting; IP, immunoprecipitation.

Close modal

GBM is a cancer with a dismal prognosis. The current standard of care is surgical resection followed by adjuvant radiotherapy combined with the DNA alkylating agent, temozolomide (3). Overall survival is 27.2% at 2 years and 9.8% at 5 years (4). Although the median survival rate is approximately 15 months, individual survival rates can vary with patient-specific factors including the extent of surgical resection (43). Advances in stem cell biology, genomics, and genetic model systems have progressed our understanding of the biology and clinical behavior of GBM but a better understanding of its etiology is crucial to achieving therapeutic progress. Constitutive activation of DDR kinases, including CHK1 has been shown in human gliomas compared with normal brain tissue (8). However, the mechanisms by which this contributes to gliomagenesis is not known. Here, we show that high-CHK1 expression is associated with poorer survival in GBM and promotes gliomagenesis by driving high-CIP2A expression via a recursive pSTAT3–CIP2A loop. Depleting CIP2A expression in GBM cells induces senescence and impedes tumor growth in vitro and in vivo.

CHK1/2 (NCT02735980) and STAT3 (NCT03195699) inhibitors are in early-phase clinical trials, albeit not for GBM. However, given their roles in maintaining genomic integrity and growth of healthy cells (44, 45), dose limiting toxicities are a concern. On the other hand, CIP2A hypomorphic mice (∼90% loss of protein) are viable with a normal lifespan and no obvious anatomic malformations, although they display impaired spermatogenesis (46). This relatively mild phenotype makes CIP2A an attractive drug target. Small-molecule inhibitors have been shown to decrease CIP2A gene expression (6) and CIP2A structure–function studies have provided important insights into the future development of targeted therapies (29). Although there are currently no direct inhibitors of CIP2A, a naturally occurring compound, cucurbitacin B, has been reported to reduce GBM cell proliferation via the CIP2A pathway (47). siRNA-based therapeutics coupled with approaches designed to penetrate the blood–brain barrier are an alternate approach worth considering. As shown in this report for GBM, and consistent with previously published data in other cancer types (7, 26), a single transfection of CIP2A siRNA resulted in persistent depletion of CIP2A protein. This is possibly a result of interrupting a key component of a recursive feed-forward loop leading to sympathetic inactivation of other components of the loop. Consistent with this, CIP2A-depleted GBM cells showed lower levels of pS727-STAT3 both in vitro and in vivo (Fig. 6F and G). The connectivity of the CHK1-pSTAT3-CIP2A loop suggests that drug synergy could be harnessed to limit toxicity and to enhance antitumor activity.

CHK1 and STAT3 are both constitutively active in GBM (8, 13). GBM cells show preferential phosphorylation of STAT3 at Serine 727 (pS727) and in contrast with canonical phosphorylation at Tyrosine 705 (pY705), pS727-STAT3 has been shown to be associated with lower overall and progression-free survival (15). STAT3 is also constitutively activated in GBM stem cells (12), and mediates increased self-renewal under hypoxic conditions (48). Pretreatment with STAT3 inhibitors also reduces stem cell survival after radiation (15). Radiotherapy and temozolomide both induce DNA damage and promote pS345–CHK1 and pS727-STAT3 levels in GBM cells (15, 49, 50), and large phase III trials evaluating the effectiveness of checkpoint regulators in GBM are currently on-going (NCT02617589). Given the recursive nature of the CHK1–pSTAT3–CIP2A circuit, concurrent targeting of CIP2A may provide synergistic vulnerability to CHK1 or STAT3 inhibition. STAT3 signaling is essential for normal biological processes and healthy tissues are vulnerable to directly targeting STAT3 (45). High-CIP2A expression, on the other hand, is an oncogenic event, which we show stabilizes pSTAT3. CIP2A loss is well tolerated (46) and we believe that targeting CIP2A and thereby indirectly depleting pSTAT3 in high-CIP2A–expressing cells is a superior alternative to direct targeting of STAT3 and will limit unwarranted toxicity to healthy tissues.

In summary, we have established the prognostic significance of CHK1 and CIP2A expression in human gliomas and described a mechanism by which constitutively activated CHK1 and STAT3 promote gliomagenesis. Expression levels of CIP2A could potentially be used to stratify patients for CHK1 or STAT3 therapies in GBM and other malignancies and provide insights into mechanisms of resistance. Importantly, we identify CIP2A as a new drug target in GBM.

No potential conflicts of interest were disclosed.

Funding bodies had no role in the writing of this article nor the decision to submit it for publication.

Conception and design: A. Khanna, K.L. McDonald, J.E. Pimanda

Development of methodology: A. Khanna, B.W. Stringer, Z. Jahan, K.L. McDonald, B.W. Day

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): A. Khanna, J.A.I. Thoms, B.W. Stringer, S.A. Chung, K.S. Ensbey, T.R. Jue, S. Subramanian, H. Shen, B.W. Day

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): A. Khanna, J.A.I. Thoms, B.W. Stringer, S.A. Chung, S. Subramanian, G. Anande, A. Unnikrishnan, B.W. Day

Writing, review, and/or revision of the manuscript: A. Khanna, J.A.I. Thoms, B.W. Stringer, S.A. Chung, H. Shen, K.L. McDonald, J.E. Pimanda

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): S.A. Chung, G. Anande

Study supervision: A. Khanna, K.L. McDonald, J.E. Pimanda

The authors thank Ms. Swapna Joshi for advice and assistance. The authors acknowledge funding from the National Health and Medical Research Council of Australia (Peter Doherty Fellowship and NHMRC project grant APP1081180 to A. Khanna and APP1024364, 1043934, and 1102589 to J.E. Pimanda), The Cancer Institute NSW (CINSW Early Career Fellowship to A. Khanna), Pfizer Australia Cancer Research Grant (WI192438 to A. Khanna), the Translational Cancer Research Network, and a Translational Cancer Research Centre funded by CINSW (J.E. Pimanda).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Ohka
F
,
Natsume
A
,
Wakabayashi
T
. 
Current trends in targeted therapies for glioblastoma multiforme
.
Neurol Res Int
2012
;
2012
:
878425
.
2.
Burnet
NG
,
Jefferies
SJ
,
Benson
RJ
,
Hunt
DP
,
Treasure
FP
. 
Years of life lost (YLL) from cancer is an important measure of population burden–and should be considered when allocating research funds
.
Br J Cancer
2005
;
92
:
241
5
.
3.
Stupp
R
,
Mason
WP
,
van den Bent
MJ
,
Weller
M
,
Fisher
B
,
Taphoorn
MJ
, et al
Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma
.
N Engl J Med
2005
;
352
:
987
96
.
4.
Stupp
R
,
Hegi
ME
,
Mason
WP
,
van den Bent
MJ
,
Taphoorn
MJ
,
Janzer
RC
, et al
Effects of radiotherapy with concomitant and adjuvant temozolomide versus radiotherapy alone on survival in glioblastoma in a randomised phase III study: 5-year analysis of the EORTC-NCIC trial
.
Lancet Oncol
2009
;
10
:
459
66
.
5.
Jackson
SP
. 
The DNA-damage response: new molecular insights and new approaches to cancer therapy
.
Biochem Soc Trans
2009
;
37
:
483
94
.
6.
Khanna
A
,
Pimanda
JE
. 
Clinical significance of cancerous inhibitor of protein phosphatase 2A in human cancers
.
Int J Cancer
2016
;
138
:
525
32
.
7.
Khanna
A
,
Kauko
O
,
Bockelman
C
,
Laine
A
,
Schreck
I
,
Partanen
JI
, et al
Chk1 targeting reactivates PP2A tumor suppressor activity in cancer cells
.
Cancer Res
2013
;
73
:
6757
69
.
8.
Bartkova
J
,
Hamerlik
P
,
Stockhausen
MT
,
Ehrmann
J
,
Hlobilkova
A
,
Laursen
H
, et al
Replication stress and oxidative damage contribute to aberrant constitutive activation of DNA damage signalling in human gliomas
.
Oncogene
2010
;
29
:
5095
102
.
9.
Yi
F
,
Ni
W
,
Liu
W
,
Bai
J
,
Li
W
. 
Expression and biological role of CIP2A in human astrocytoma
.
Mol Med Rep
2013
;
7
:
1376
80
.
10.
Yu
H
,
Lee
H
,
Herrmann
A
,
Buettner
R
,
Jove
R
. 
Revisiting STAT3 signalling in cancer: new and unexpected biological functions
.
Nat Rev Cancer
2014
;
14
:
736
46
.
11.
Singh
M
,
Garg
N
,
Venugopal
C
,
Hallett
R
,
Tokar
T
,
McFarlane
N
, et al
STAT3 pathway regulates lung-derived brain metastasis initiating cell capacity through miR-21 activation
.
Oncotarget
2015
;
6
:
27461
77
.
12.
Villalva
C
,
Martin-Lanneree
S
,
Cortes
U
,
Dkhissi
F
,
Wager
M
,
Le Corf
A
, et al
STAT3 is essential for the maintenance of neurosphere-initiating tumor cells in patients with glioblastomas: a potential for targeted therapy?
Int J Cancer
2011
;
128
:
826
38
.
13.
Sherry
MM
,
Reeves
A
,
Wu
JK
,
Cochran
BH
. 
STAT3 is required for proliferation and maintenance of multipotency in glioblastoma stem cells
.
Stem Cells
2009
;
27
:
2383
92
.
14.
Guryanova
OA
,
Wu
Q
,
Cheng
L
,
Lathia
JD
,
Huang
Z
,
Yang
J
, et al
Nonreceptor tyrosine kinase BMX maintains self-renewal and tumorigenic potential of glioblastoma stem cells by activating STAT3
.
Cancer Cell
2011
;
19
:
498
511
.
15.
Masliantsev
K
,
Pinel
B
,
Balbous
A
,
Guichet
PO
,
Tachon
G
,
Milin
S
, et al
Impact of STAT3 phosphorylation in glioblastoma stem cells radiosensitization and patient outcome
.
Oncotarget
2018
;
9
:
3968
79
.
16.
Stringer
BW
,
Day
BW
,
D'Souza
RCJ
,
Jamieson
PR
,
Ensbey
KS
,
Bruce
ZC
, et al
A reference collection of patient-derived cell line and xenograft models of proneural, classical and mesenchymal glioblastoma
.
Sci Rep
2019
;
9
:
4902
.
17.
Pollard
SM
,
Yoshikawa
K
,
Clarke
ID
,
Danovi
D
,
Stricker
S
,
Russell
R
, et al
Glioma stem cell lines expanded in adherent culture have tumor-specific phenotypes and are suitable for chemical and genetic screens
.
Cell Stem Cell
2009
;
4
:
568
80
.
18.
Day
BW
,
Stringer
BW
,
Al-Ejeh
F
,
Ting
MJ
,
Wilson
J
,
Ensbey
KS
, et al
EphA3 maintains tumorigenicity and is a therapeutic target in glioblastoma multiforme
.
Cancer Cell
2013
;
23
:
238
48
.
19.
Eisenberg
E
,
Levanon
EY
. 
Human housekeeping genes, revisited
.
Trends Genet
2013
;
29
:
569
74
.
20.
Berchtold
NC
,
Cribbs
DH
,
Coleman
PD
,
Rogers
J
,
Head
E
,
Kim
R
, et al
Gene expression changes in the course of normal brain aging are sexually dimorphic
.
Proc Natl Acad Sci U S A
2008
;
105
:
15605
10
.
21.
Brennan
CW
,
Verhaak
RG
,
McKenna
A
,
Campos
B
,
Noushmehr
H
,
Salama
SR
, et al
The somatic genomic landscape of glioblastoma
.
Cell
2013
;
155
:
462
77
.
22.
Gravendeel
LA
,
Kouwenhoven
MC
,
Gevaert
O
,
de Rooi
JJ
,
Stubbs
AP
,
Duijm
JE
, et al
Intrinsic gene expression profiles of gliomas are a better predictor of survival than histology
.
Cancer Res
2009
;
69
:
9065
72
.
23.
Paugh
BS
,
Qu
CX
,
Jones
C
,
Liu
ZL
,
Adamowicz-Brice
M
,
Zhang
JY
, et al
Integrated molecular genetic profiling of pediatric high-grade gliomas reveals key differences with the adult disease
.
J Clin Oncol
2010
;
28
:
3061
8
.
24.
Sun
LX
,
Hui
AM
,
Su
Q
,
Vortmeyer
A
,
Kotliarov
Y
,
Pastorino
S
, et al
Neuronal and glioma-derived stem cell factor induces angiogenesis within the brain
.
Cancer Cell
2006
;
9
:
287
300
.
25.
Murat
A
,
Migliavacca
E
,
Gorlia
T
,
Lambiv
WL
,
Shay
T
,
Hamou
MF
, et al
Stem cell-related "self-renewal" signature and high epidermal growth factor receptor expression associated with resistance to concomitant chemoradiotherapy in glioblastoma
.
J Clin Oncol
2008
;
26
:
3015
24
.
26.
Junttila
MR
,
Puustinen
P
,
Niemela
M
,
Ahola
R
,
Arnold
H
,
Bottzauw
T
, et al
CIP2A inhibits PP2A in human malignancies
.
Cell
2007
;
130
:
51
62
.
27.
Khanna
A
,
Bockelman
C
,
Hemmes
A
,
Junttila
MR
,
Wiksten
JP
,
Lundin
M
, et al
MYC-dependent regulation and prognostic role of CIP2A in gastric cancer
.
J Natl Cancer Inst
2009
;
101
:
793
805
.
28.
Khanna
A
,
Pimanda
JE
,
Westermarck
J
. 
Cancerous inhibitor of protein phosphatase 2A, an emerging human oncoprotein and a potential cancer therapy target
.
Cancer Res
2013
;
73
:
6548
53
.
29.
Wang
J
,
Okkeri
J
,
Pavic
K
,
Wang
Z
,
Kauko
O
,
Halonen
T
, et al
Oncoprotein CIP2A is stabilized via interaction with tumor suppressor PP2A/B56
.
EMBO Rep
2017
;
18
:
437
50
.
30.
Watt
LF
,
Panicker
N
,
Mannan
A
,
Copeland
B
,
Kahl
RGS
,
Dun
MD
, et al
Functional importance of PP2A regulatory subunit loss in breast cancer
.
Breast Cancer Res Treat
2017
;
166
:
117
31
.
31.
Galli
R
,
Binda
E
,
Orfanelli
U
,
Cipelletti
B
,
Gritti
A
,
De Vitis
S
, et al
Isolation and characterization of tumorigenic, stem-like neural precursors from human glioblastoma
.
Cancer Res
2004
;
64
:
7011
21
.
32.
Lei
L
,
Sonabend
AM
,
Guarnieri
P
,
Soderquist
C
,
Ludwig
T
,
Rosenfeld
S
, et al
Glioblastoma models reveal the connection between adult glial progenitors and the proneural phenotype
.
PLoS One
2011
;
6
:
e20041
.
33.
Shimada
M
,
Niida
H
,
Zineldeen
DH
,
Tagami
H
,
Tanaka
M
,
Saito
H
, et al
Chk1 is a histone H3 threonine 11 kinase that regulates DNA damage-induced transcriptional repression
.
Cell
2008
;
132
:
221
32
.
34.
Lee
CH
,
Yu
CC
,
Wang
BY
,
Chang
WW
. 
Tumorsphere as an effective in vitro platform for screening anti-cancer stem cell drugs
.
Oncotarget
2016
;
7
:
1215
26
.
35.
D'Alessandris
QG
,
Biffoni
M
,
Martini
M
,
Runci
D
,
Buccarelli
M
,
Cenci
T
, et al
The clinical value of patient-derived glioblastoma tumorspheres in predicting treatment response
.
Neuro Oncol
2017
;
19
:
1097
108
.
36.
Come
C
,
Laine
A
,
Chanrion
M
,
Edgren
H
,
Mattila
E
,
Liu
X
, et al
CIP2A is associated with human breast cancer aggressivity
.
Clin Cancer Res
2009
;
15
:
5092
100
.
37.
Laine
A
,
Sihto
H
,
Come
C
,
Rosenfeldt
MT
,
Zwolinska
A
,
Niemela
M
, et al
Senescence sensitivity of breast cancer cells is defined by positive feedback loop between CIP2A and E2F1
.
Cancer Discov
2013
;
3
:
182
97
.
38.
Debacq-Chainiaux
F
,
Erusalimsky
JD
,
Campisi
J
,
Toussaint
O
. 
Protocols to detect senescence-associated beta-galactosidase (SA-betagal) activity, a biomarker of senescent cells in culture and in vivo
.
Nat Protoc
2009
;
4
:
1798
806
.
39.
Yun
UJ
,
Park
SE
,
Jo
YS
,
Kim
J
,
Shin
DY
. 
DNA damage induces the IL-6/STAT3 signaling pathway, which has anti-senescence and growth-promoting functions in human tumors
.
Cancer Lett
2012
;
323
:
155
60
.
40.
Kim
JE
,
Patel
M
,
Ruzevick
J
,
Jackson
CM
,
Lim
M
. 
STAT3 activation in glioblastoma: biochemical and therapeutic implications
.
Cancers
2014
;
6
:
376
95
.
41.
Zhang
JX
,
Zhang
J
,
Yan
W
,
Wang
YY
,
Han
L
,
Yue
X
, et al
Unique genome-wide map of TCF4 and STAT3 targets using ChIP-seq reveals their association with new molecular subtypes of glioblastoma
.
Neuro Oncol
2013
;
15
:
279
89
.
42.
McDaniel
JM
,
Varley
KE
,
Gertz
J
,
Savic
DS
,
Roberts
BS
,
Bailey
SK
, et al
Genomic regulation of invasion by STAT3 in triple negative breast cancer
.
Oncotarget
2017
;
8
:
8226
38
.
43.
Marko
NF
,
Weil
RJ
,
Schroeder
JL
,
Lang
FF
,
Suki
D
,
Sawaya
RE
. 
Extent of resection of glioblastoma revisited: personalized survival modeling facilitates more accurate survival prediction and supports a maximum-safe-resection approach to surgery
.
J Clin Oncol
2014
;
32
:
774
82
.
44.
Tse
AN
,
Carvajal
R
,
Schwartz
GK
. 
Targeting checkpoint kinase 1 in cancer therapeutics
.
Clin Cancer Res
2007
;
13
:
1955
60
.
45.
Siveen
KS
,
Sikka
S
,
Surana
R
,
Dai
X
,
Zhang
J
,
Kumar
AP
, et al
Targeting the STAT3 signaling pathway in cancer: role of synthetic and natural inhibitors
.
Biochim Biophys Acta
2014
;
1845
:
136
54
.
46.
Ventela
S
,
Come
C
,
Makela
JA
,
Hobbs
RM
,
Mannermaa
L
,
Kallajoki
M
, et al
CIP2A promotes proliferation of spermatogonial progenitor cells and spermatogenesis in mice
.
PLoS One
2012
;
7
:
e33209
.
47.
Qin
S
,
Li
J
,
Si
Y
,
He
Z
,
Zhang
T
,
Wang
D
, et al
Cucurbitacin B induces inhibitory effects via CIP2A/PP2A/Akt pathway in glioblastoma multiforme
.
Mol Carcinog
2018
;
57
:
687
99
.
48.
Almiron Bonnin
DA
,
Havrda
MC
,
Lee
MC
,
Liu
H
,
Zhang
Z
,
Nguyen
LN
, et al
Secretion-mediated STAT3 activation promotes self-renewal of glioma stem-like cells during hypoxia
.
Oncogene
2018
;
37
:
1107
18
.
49.
Ito
M
,
Ohba
S
,
Gaensler
K
,
Ronen
SM
,
Mukherjee
J
,
Pieper
RO
. 
Early Chk1 phosphorylation is driven by temozolomide-induced, DNA double strand break- and mismatch repair-independent DNA damage
.
PLoS One
2013
;
8
:
e62351
.
50.
Lee
ES
,
Ko
KK
,
Joe
YA
,
Kang
SG
,
Hong
YK
. 
Inhibition of STAT3 reverses drug resistance acquired in temozolomide-resistant human glioma cells
.
Oncol Lett
2011
;
2
:
115
21
.