RCC2 Promotes Esophageal Cancer Growth by Regulating Activity and Expression of the Sox2 Transcription Factor Free

This article is featured in Highlights of This Issue, p. 1613

Esophageal cancer is the eighth most common cancer and one of deadliest worldwide (1). Despite significant advances in treatment, the number of cases has increased over the last few years, with an incidence of 572,000 cases and 508,000 deaths worldwide in 2018 (2). Therefore, innovative therapeutic approaches targeting new oncogenic markers for treatment of esophageal cancer are urgently needed.

Regulator of chromosome condensation 2 (RCC2), also known as TD-60, is a protein required for mitosis to proceed uniformly. Cells with RCC2 suppression cease to proliferate and arrest either in the G₁ or G₂ phase of the cell cycle (3). RCC2 exhibits several activities linked with chromatid segregation and cell division. RCC2 has guanine exchange factor activity for the small GTPase RalA and its depletion causes spindle abnormalities in prometaphase (4). In addition, RCC2 is critical to localize the components of the chromosome passenger complex (CPC) to centromeres (5, 6). The CPC is composed of Aurora B kinase, plus an activation module consisting of inner centromere protein INCENP (Inner centromere protein), survivin and borealin (7). The complex regulates key aspects of mitosis, including chromosome structure, cytokinesis, and spindle assembly. Aurora B kinase activation requires RCC2, and its deletion blocks cells in prometaphase (4–6). These data indicate a key role of RCC2 in the process of cell division and maintenance of genetic stability of normal cells. In addition to its function in spindle assembly and mitosis, RCC2 also has a role in cell migration (8).

RCC2 is overexpressed in a variety of different tumor tissues such as lung (9), ovarian (10), gastric (11), and glioblastoma (12) and is also associated with increased malignancy. In lung cancer, RCC2 overexpression correlates with poor prognosis and shorter overall survival as well as increased cell proliferation, migration, and invasion “in vitro” by activating JNK (9). Besides, RCC2 also may function as an oncogene by regulating the RalA signaling pathway (13). Furthermore, RCC2 influences resistance in cancer. Forced RCC2 expression significantly decreases the sensitivity of tumor cells to apoptotic drugs by blocking Rac1 signaling (10); and cisplatin-resistant ovarian cancer cells show an increased expression of RCC2 compared with sensitive cells (13). Moreover, RCC2 promotes radioresistance and proliferation in glioblastoma through the transcriptional activation of DNMT1 (DNA methyltransferase I) in a STAT3-dependent manner (12). Together, these results strongly suggest that RCC2 may act as an oncogene in cancer. However, the mechanisms explaining how RCC2 functions in esophageal cancer and the role and association of this protein with activation of transcription factors important for the development of esophageal tumors remain unclear.

Sox2 is a transcription factor containing a high-mobility group domain, which permits highly specific DNA binding. It is aberrantly expressed in tumors (14) and has been associated with a cancer stem cell state and with tumorigenesis by inhibiting apoptosis (15, 16). In addition, Sox2 has been shown to promote esophageal cancer development (17, 18). Amplification of SOX2 is found in esophageal cancer, where it promotes proliferation in vitro and tumorigenesis in vivo by activating the AKT/mTOR complex 1 (mTORC1) signaling pathway (17, 18). Furthermore, esophageal squamous cell carcinomas show a positive correlation between expression levels of Sox2 and phosphorylated AKT (17). These findings highlight an important role of Sox2 in esophageal tumor growth.

In this study, we aimed to investigate the role of RCC2 in the development of esophageal cancer and to establish whether Sox2 cooperates with RCC2 to promote oncogenesis. Our data showed that RCC2 was highly expressed in mouse and human tissues as well as esophageal cancer cell lines and promoted proliferation, anchorage-independent growth, transformation, and migration. RCC2 stabilized Sox2 expression, increased binding to promoter regions, and enhanced Sox2 transcriptional activity. Interestingly, RCC2 and Sox2 expression colocalized in the basal cell layer of the esophagus in mice and both proteins were overexpressed in esophageal cancer tissue. In knockout animals, RCC2 deletion decreased Sox2 expression and esophageal tumor formation and progression. Our findings suggest that RCC2 promotes Sox2 stability and transcriptional activation leading to further promotion of tumor growth in the esophagus. Thus, the RCC2–Sox2 axis could be a new therapeutic target to improve prognosis in this cancer.

Human embryonic kidney cells 293T from ATCC (CRL-3216, RRID: CVCL_0063) were cultured in DMEM supplemented with 10% FBS and penicillin-streptomycin 1X (GenDEPOT #CA005-010). Esophageal cancer cells obtained from Leibniz Institute DSMZ; KYSE-30 (DSMZ #ACC 351, RRID: CVCL_1351), KYSE-410 (DSMZ #ACC 381, RRID:CVCL_1352), KYSE-450 (DSMZ #ACC 387, RRID: CVCL_1353), KYSE-510 (DSMZ #ACC 374, RRID: CVCL_1354) were grown in RPMI-F12 medium (1:1 ratio) supplemented with 2% FBS and antibiotics. RPMI 2% FBS was used for culturing SK-GT-4 cells (DSMZ #ACC-712, RRID: CVCL_2195). The HET-1A (ATCC #CRL-2692, RRID: CVCL_3702) cell line was cultured in Bronchial Epithelial Cell Growth Medium (LONZA, catalog no. CC-3171). Cells were maintained at 37°C, 5% CO₂ in a humidified atmosphere and harvested with trypsin (0.25%; GenDEPOT #CA019-010). Cell authentication was commercially performed (by Genetica cell line testing) through short tandem repeat analysis. Cells with less than 10 passages were used for every experiment and kept in culture for no more than 1 month after thawing. After this time, cells were discarded and a new vial thawed for further experiments. Mycoplasma negative testing were obtained from cell's provider and performed by PCR assays. No further Mycoplasma testing was done.

The vector for overexpression of RCC2 was obtained from Dharmacon (Lafayette; Clone ID: 6502476). cDNA was subcloned into the BamHI/KpnI sites of the pcDNA3 vector adding an HA-tag. For lentivirus overexpression, RCC2-HA was inserted into the XhoI/XbaI sites of the pLVX-IRES-puro vector (Clontech; catalog no. 632183). Vector to overexpress Sox2 was obtained from Addgene (Plasmid, #15919). The 6xO/S-luc reporter plasmid was a gift from Lisa Dailey (Addgene plasmid #69445). All vectors for protein overexpression as well as short hairpin RNA (shRNA) were amplified in competent E. coli bacteria transformed by heat shock and selected with ampicillin in agar plates. Colonies were picked and expanded in ampicillin with LB medium. Plasmids were purified using the NucleBond Xtra Midi Kit (MACHEREY-NAGEL #740410) and quantified by absorbance.

The lentiviral vector pLKO.1 puro containing sh sequences were obtained from Dharmacon. shRNA and packaging vectors (pMD2.0G #12259 and psPAX2 #12260, Addgene) were transfected into 293T cells by using iMFectin (GenDEPOT #I7200). To overexpress RCC2-HA with lentivirus, the pLVX-IRES-puro/RCC2-HA vector was used with packaging vectors. At 18 hours after transfection, the medium was changed. After 24 hours, the viral supernatant fractions were collected, filtered through a 0.45 μm syringe filter, and stored at −80°C until use. Cells were infected for 8 hours with viral particles containing 10 μg/mL of polybrene. Infection was repeated twice. Cells were then selected with puromycin (0.5 μg/mL) and used for the specific experiment. shRCC2 sequences are: shRCC2#4: ATGAACTTCCCATCTGAGTTG (Clone ID: TRCN0000153686); and shRCC2#5: AACACAGAACAAGAGATGCGC (Clone ID: TRCN0000154474). Vector for control sequence (scramble) was obtained from Sigma, catalog no. SHC016V.

Cells (4,000) were seeded in 96-well plates and cultured for 18 to 24 hours. Resazurin (1.1 mg/10 mL of PBS; Sigma-Aldrich #R7017) was added to reach 10% of culture volume in the well without changing medium. Resazurin, a nontoxic, cell-permeable compound, can be reduced by intracellular redox activity present in living cells and converted to the highly fluorescent compound, resorufin. Thus, the fluorescence emission can be measured and correlated with active metabolically and proliferating cells. Resazurin was incubated in the dark for 3 hours. The fluorescence excitation/emission wavelengths were measured at 545/595 nm with the Synergy Neo2 Multi-Mode Microplate Reader (BioTek). Results are shown as relative fluorescence intensity average ± SD. and experimental groups were compared with control groups.

Cells were seeded and treated as described previously (19). Briefly, cells were suspended in Basal Minimal Eagle medium and added to 0.6% agar layer. Cells were treated with EGF (10 ng/mL) where indicated. Colony formation was observed and analyzed using a LAICA DM IRB microscope (Nikon Corporation) and the ImagePro Plus software (v.6.1) program (Media Cybernetics Inc.; RRID:SCR_016879).

Esophageal cancer cells (4 × 10⁵) were seeded in serum-free medium in the top chamber of Transwell polycarbonate membrane cell culture inserts (Corning, CLS3422-48EA) and kept in culture for 20 hours. The lower chamber was filled with medium and 10% FBS. Transwells were washed twice by immersion in PBS, fixed with methanol, and stained with 0.2% crystal violet. After washing twice with PBS, the nonmigrated cells were scraped off with a cotton swab. Photos were taken under a light microscopy at 20× magnification and then cells were counted. Data are expressed as mean ± SD in each condition.

Cells were disrupted with lysis buffer (10 mmol/L Tris-HCL pH 7.4, 5 mmol/L EDTA, 150 mmol/L NaCl, 1% Triton X-100, 0.1% SDS, and protease inhibitor cocktail; GenDEPOT #P3100) on ice for 30 minutes. Lysates were cleared by centrifugation at 16,000 × g for 20 minutes at 4°C. Twenty micrograms of protein were separated by electrophoresis in 10% SDS-polyacrylamide gels and then transferred onto polyvinylidene difluoride membranes (EMD Millipore). For blocking, membranes were incubated with TBS containing 0.1% Tween-20 and 5% nonfat skim milk. Antibodies to detect α-RCC2 (Novus Biological, #32602), β-actin (Santa Cruz Biotechnology, catalog no. 47778), α-FLAG (Sigma-Aldrich, catalog no. F1804), α-Sox2 (Cell Signaling Technology, catalog no. 23064), α-GAPDH (Santa Cruz Biotechnology, catalog no. 47724), α-cyclin D1 (Cell Signaling Technology, catalog no. 55506), α-Pea3 (abcam, catalog no. 189826) or α-HA (Biolegend, catalog no. MMS-101R) were added and incubated overnight at 4°C. The bound antibodies were visualized with a horseradish peroxidase–conjugated secondary antibody (dilution 1:4,000) by using chemiluminescence reagents. Membranes were photographed in an Amersham Imager 600 (GE Healthcare Life Sciences).

Cells (2.5 × 10⁵) were seeded into 12-well plates and cotransfected with the plasmids to overexpress RCC2-HA and Sox2 detailed previously in the DNA plasmid section. The signal was generated by cotransfecting the 6xO/S-luc reporter plasmid (40 ng; Addgene plasmid, catalog no. 69445) and an internal control vector (pCMV-β-gal, 20 ng). Transfections were performed as before using iMFectin (GenDEPOT #I7200). At 24 hours after transfection, cells were disrupted with lysis buffer, and then the lysates were used for a reporter assay utilizing the Luciferase Assay System (Promega Corporation). Luciferase activities were measured by a luminometer (Monolight 2010, Analytical Luminescence Laboratory) with the substrate provided (Promega). Firefly luciferase activity was normalized to β-galactosidase activity.

Stable KYSE-30 cells overexpressing RCC2-HA or control sequences were seeded in 10 cm² plates. Chromatin immunoprecipitation (ChIP) was performed using the One-Day Chromatin Immunoprecipitation Kit (Magna ChIP G, Millipore, catalog no. 17-611) according to the manufacturer's protocol. Chromatin samples were immunoprecipitated with an HA antibody overnight at 4°C. The DNA fractions were analyzed by qPCR. Primer sequences were: CCND1 forward: GAGCAGCAGAGTCCGCACGCTC, CCND1 reverse: TGTTCCATGGCTGGGGCTCTT; ETV4 forward: ACACAGCTTCGTGGACACAT, ETV4 reverse: AGAGCTCAGCCCCCAATCTA.

Tissues were fixed in 10% buffered formalin and embedded in paraffin. Slide sections (5 μm) were baked at 60°C for 1 hour, deparaffinized in xylene, and rehydrated in serial amounts of alcohol. Antigenic retrieval and unmasking were performed by submerging slides in sodium citrate buffer (10 mmol/L, pH 6.0) and then boiling for 10 minutes. Slides were treated with 5% H₂O₂ in methanol and then blocked with 50% goat serum albumin in 1 × PBS in a humidified chamber for 1 hour at room temperature. Antibodies to detect α-RCC2 (Novus Biological, #110-40619; 1:300), α-Sox2 (CS-14962), α-keratin 5 (abcam, catalog no. 64081), and α-PCNA (CS-13110; 1:2,000) diluted in 10% goat serum–PBS were incubated with slides overnight at 4°C in humidified chamber. For detection, biotinylated secondary antibodies were added (Vector Laboratories, 1:150) for 1 hour at room temperature. The signal was developed using the Vectastain Elite ABC Kit (Vector Laboratories Inc, catalog no. PK-610) following the manufacturer's recommendations. Slides were counterstained with hematoxylin and photographed using a Zeiss Axio-observer with Apotome microscope at 20× magnification. Quantitation of images was performed using the Image-Pro Plus software program (version 6.1).

RNA total was isolated using PureLink RNA Mini Kit (Thermo Fisher scientific, catalog no. 12183025) according to the manufacturer's protocol. cDNA was synthesized by using amfiRivert cDNA Synthesis Platinum Master Mix from GenDEPOT (catalog no. R5600) according to the manufacturer's protocol. For qPCR, Power SYBR Green PCR Master Mix (Life Technologies, catalog no.4367659) was used. PCR was performed on 7500 Real-Time PCR System (Applied Biosystems). The primer sequences were for SOX2 forward: GCACATGAACGGCTGGAGCAACG; SOX2 reverse: TGCTGCGAGTAGGACATGCTGTAGG; CCND1 forward: GAGCAGCAGAGTCCGCACGCTC; CCND1 Reverse: TGTTCCATGGCTGGGGCTCTTC; ETV4 forward: TGGAAATCAGGAACAAACTGC; ETV4 Reverse: GCCCCTCGACTCTGAAGAT; GAPDH forward: AGCCACATCGCTCAGACAC; GAPDH REVERSE: GCCCAATACGACCAAATCC. Data were normalized to GAPDH and compared with respective controls.

HEK 293T cells were transfected with the indicated plasmids. A total of 8 hours before harvest, cells were treated with 10 μmol/L of MG-132. Cells were lysed in buffer lysis (2% SDS, 150 mmol/L NaCl, 10 mmol/L Tris-HCl, pH 8.0, 2 mmol/L sodium orthovanadate, 50 mmol/L sodium fluoride, 20 mmol/L N-ethylmaleimide and protease inhibitors), boiled 10 minutes and sonicated. Volume was completed to 1 mL (10 mmol/L Tris-HCl, pH 8.0, 150 mmol/L NaCl, 2 mmol/L EDTA, 1% Triton). A total of 500 μg of proteins were pulled down over night with 50 μL of A/G protein beads and 10 μL of α-Sox2 (CS-14962). Pellets were washed twice, and complexes were separated by SDS-PAGE. Antibodies α-FLAG (Sigma, catalog no. F3165) and α-Sox2 (CS-14962) were reacted against membranes and signal developed for Western blot analysis as before.

Mice ^{RCC2 flox/−} (C57BL/6 background; MRC Harwell Institute, Oxfordshire, United Kingdom) were used to generate RCC2-floxed mice in combination with mice^KRT5-CreERT2. Briefly, mice ^flox/− were crossed to obtain the phenotype RCC2 ^flox/flox. RCC2 ^flox/− mice were bred with mice ^KRT5-CreERT2 (The Jackson Laboratory) to obtain the flox/−; KRT5-CreERT2/− genotype. Genotyping for each gene was performed with primers (Supplementary Table S1). Mice ^{flox/−; KRT5-CreERT2/−} were crossed with mice ^flox/flox to obtain the conditional ^{flox/flox; KRT5-CreERT2/−} genotype. 4-Hydroxytamoxifen (4-OHT; Sigma-Aldrich, catalog no. H6278; 1 mg or 50–60 mg/kg body weight) dissolved in corn oil was injected intraperitoneally for 5 consecutive days to deplete the RCC2 gene. To induce esophageal tumors, 100 μg/mL of 4-nitroquinoline N-oxide (4-NQO; TCI America#N0250) or vehicle (DMSO; nontumor control groups) was dissolved in drinking water and given to animals ad libitum for 16 weeks. Then 4NQO was removed and animals were monitored for an additional 9 weeks. Mice were euthanized and samples collected. Tumors were counted and presented as mean values ± SD. Mice between 6 and 10 weeks old were used to begin the experiments. All animal studies were performed following guidelines approved by the University of Minnesota Institutional Animal Care and Use Committee (Minneapolis, MN; protocol number: 1501-32258A).

All statistical analyses were conducted using GraphPad prism 5.0 software (GraphPad Software). Data are shown as mean values ± SD. Statistically significant differences between three or more groups were determined by a one-way ANOVA. Differences between two groups were calculated using a Student t test and P-values ≤ 0.05 were considered to be statistically significant between groups. Experiments were repeated a minimum three times or as otherwise indicated. For correlation analysis between Sox2 and RCC2, the database Xena from University of California (Santa Cruz, CA) was used.

We analyzed the expression of RCC2 in esophageal tumors at the mRNA level by using the The Cancer Genome Atlas (TCGA) database. The data show that RCC2 is highly expressed in esophageal human cancer tissues compared with normal tissue (Fig. 1A). When RCC2 expression in nontumor tissue is compared with adenocarcinoma and squamous cell carcinoma (the two main subtypes of esophagus cancer) individually, this upregulation is equally statistically significant for both cases (Fig. 1B and C). Significant differences were also found between subtypes (Fig. 1D). In addition, we examined the expression of RCC2 at the protein level in human tissue array samples from the esophagus (US Biomax #ES2081) and found that RCC2 expression is significantly upregulated in cancer compared with both normal and cancer adjacent normal tissue (Fig. 1E and F). These data confirm that RCC2 is overexpressed at both the mRNA and protein level in human esophageal cancer. Similarly, we determined the expression of RCC2 in esophagus from tumor-harboring and control mice. RCC2 expression was dramatically increased in esophageal tumors induced with 4-NQO compared with controls (Fig. 1G). Similar results were obtained from cancer cell lines, where RCC2 was upregulated in esophageal cancer cells KYSE-30, KYSE-410, KYSE-450, KYSE-510, and SGKT-4 compared with Het-1A, a nonmalignant esophageal cell line (Fig. 1H). These results clearly show that RCC2 is overexpressed in esophageal tumors compared with normal tissue, suggesting a potential role of RCC2 in esophageal cancer.

We used shRNA to knock down RCC2 in cancer cell lines KYSE-30, KYSE-450, and KYSE-510. RCC2 expression was clearly downregulated in these esophageal cancer cells lines expressing shRNA lentivirus compared with controls (scramble) (Fig. 2A). These cell lines were then used to determine the effect of RCC2 knockdown on proliferation. Our data consistently showed that the downregulation of RCC2 decreased proliferation of all cancer cell lines tested compared with controls (scramble sequence; Fig. 2B–D). We also evaluated the proliferation of cancer and normal cell lines stably expressing RCC2-HA to better support the role of this protein in tumor progression. For this experiment, KYSE-410 and Het-1A cells were seeded in culture plates and cell density was measured by using an IncuCyte S3 live-cell analysis system. We carried out those experiments on these different cell lines because they show different expression patterns for RCC2; the normal cell line Het-1A (low endogenous expression of RCC2) and the cancer cell lines KYSE-410 (high RCC2 expression). Besides, we conducted experiments using Alamar blue on the RCC2 high expression cancer cell line KYSE-450 to confirm our hypothesis. Our data consistently showed that RCC2-HA overexpression increased proliferation in all cell lines, irrespective of their malignity status, observed by cell density and fluorescence assays, consistent with our previous data (Supplementary Fig. S1A–S1C). We further evaluated the ability of esophageal cancer cells to grow under anchorage-independent conditions by using a soft agar assay, a method to measure transformation of normal cells and oncogenic potential of tumor cells. The results demonstrate that RCC2 knockdown decreased the anchorage-independent growth of cancer cells (Fig. 2E–G). We also examined the ability of RCC2 to promote transformation of the nonmalignant esophageal cell line Het-1A. Data show that EGF increased the anchorage-independent growth of Het-1A cells. However, knockdown of RCC2 significantly decreased this effect. In addition, the overexpression of RCC2 increased transformation of Het-1A cells, both in the presence and absence of EGF, compared with controls (Fig. 2H and I). EGF treatment alone did not associated with an upregulation in the RCC2 expression in Het-1A cells (Supplementary Fig. S1E). In addition, RCC2 downregulation also dramatically decreased cell migration, a hallmark of malignancy in KYSE-30 (Fig. 2J) and KYSE-450 (Fig. 2K) esophageal cancer cell lines. These data overall indicate that RCC2 has a very important role in promoting malignancy in esophageal cancer cells.

Sox2 has been reported to be an important transcription factor for the growth and development of esophageal cancer (14, 17, 18). To determine whether the oncogenic effects of RCC2 in esophageal cancer are associated with Sox2, we examined the effects of RCC2 on Sox2 expression. First, we determined the basal Sox2 expression level in esophageal cancer cell lines and compared it with the esophageal normal cell line Het-1A. We observed that Sox2 expression was significatively increased in esophageal cancer cells compared with normal Het-1A cells (Fig. 3A). Furthermore, the knocking down of RCC2 expression with two different sequences of shRNA consistently decreased Sox2 expression in KYSE-30 and KYSE-450 cancer cells in both cases (Fig. 3B). To confirm this result, we used an opposite approach by overexpressing RCC2-HA in esophageal cancer cell lines and then examining Sox2 expression. As expected, forced RCC2 expression increased Sox2 protein levels in KYSE-30 and KYSE-450 cancer cells (Fig. 3C). These data suggest that RCC2 influences Sox2 expression. The upregulation of Sox2 was dose dependent, because the transfection of increasing amounts of RCC2-HA together with Sox2 gradually increased Sox2 expression in 293T cells, while RCC2 overexpression alone had no effect (Fig. 3D). According to our data, the regulation of Sox2 is also observed at the RNA level, because the knockdown of RCC2 decreases the transcription of Sox2 as observed by qPCR experiments (Supplementary Fig. S1D). Why RCC2 has these two apparently redundant functions is unknown. However, the finding that RCC2 has the same effects on Sox2 at both the RNA and protein levels confirms its important role as a key player in the induction and further oncogenic functions of Sox2. Thus, our data consequently showed an oncogenic role for RCC2 which was unknown and independent of its known functions in cell cycle. In addition, we determined whether RCC2 influences Sox2 expression through the inhibition of proteasome degradation pathways resulting in an increased stabilization of its expression. We treated KYSE-30 cells with MG-132, a potent inhibitor of proteasome degradation. The treatment with MG-132 restored the Sox2 expression when RCC2 was downregulated, even at shortest times (6 hours) of treatment with MG-132 (Fig. 3E). These data indicate that Sox2 is overexpressed in esophageal cancer cell lines and its upregulation could be due to a role for RCC2 in stabilizing Sox2 expression through a reduction in its proteasome degradation. For that, we evaluated the effect of RCC2-HA overexpression on ubiquitination of Sox2. We transfected Sox2, RCC2-HA, or Flag-ubiquitin into 293T cells and Sox2 ubiquitination changes were checked. RCC2 overexpression decreased Sox2 ubiquitination in those cells compared with controls (Fig. 3F). Furthermore, we performed a correlation analysis using the browser “UCSC Xena” (University of California, Santa Cruz, CA) to evaluate the correlation between the RCC2 and Sox2 expression using expression data from patients with esophageal cancer. Our results indicated a moderate to weak but still significant positive correlation between the mRNA transcription rate of RCC2 and Sox2 in patient samples (Pearson correlation of r = 0.2582; P = 0.0009430; Fig. 3G).

The importance of Sox2 in esophageal cancer development has been established trough promotion of transcription of several oncogenes (14). Therefore, we aimed to investigate whether RCC2 influences the transcriptional activity of Sox2 to provide insights that will allow us to explain whether the RCC2–Sox2 axis could be responsible for promoting tumor growth in the esophagus. We conducted a luciferase assay to evaluate the transcriptional activity of Sox2 by transfecting several amounts of RCC2 in combination with Sox2. Transfection of RCC2 increased the induction of relative luciferase activity of Sox2 in a dose-dependent manner (Fig. 4A). This luciferase signal was absent when RCC2 was transfected alone (controls), suggesting that RCC2 promotes the transcriptional activity of Sox2. Consequently, we performed a ChIP assay to determine whether RCC2 promotes the binding of Sox2 to the promoter regions of its target genes, CCND1 and ETV4 and further activates its transcriptional activity. Results show that RCC2 overexpression increased the occupancy of Sox2 for CCND1 and ETV4 promoter regions compared with controls (Fig. 4B). These results strongly suggest that RCC2 promotes the binding of Sox2 to the promoter regions of CCND1 and ETV4 and increases the Sox2 transcriptional activity. To confirm the role of RCC2 on Sox2 activation, we evaluated the protein expression of cyclin D1 and Pea3, the protein products of CCND1 and ETV4, in RCC2-HA stably overexpressing cells KYSE-30 and KYSE-450. The overexpression of RCC2 consistently upregulated cyclin D1 and Pea3 expression (Fig. 4C). In the same manner, we used an opposite approach, where we knocked down RCC2 and examined cyclin D1 and Pea3 expression. As expected, the downregulation of RCC2 decreased the expression of these Sox2 targets in both cell lines (Fig. 4D). Furthermore, we investigated this regulation at the RNA level of ETV4 and CCND1. We conduct qPCR real-time experiments to evaluate the genes ETV4 and CCND1 in RCC2 downregulated cells by shRNA. Our data confirm that RCC2 knockdown decreases RNA levels for ETV4 and CCND1 in KYSE-30 (Fig. 4E) and KYSE-450 (Fig. 4F). In addition, the overexpression of Sox2 in RCC2 knocked down cells increases the cell survival, partially reverting the negative role of RCC2 silencing on cell viability (Supplementary Fig. S2A and S2B). Thus, these results confirm our previous findings showing that RCC2 influences Sox2 transcriptional activation and further expression of its transcriptional targets, and this later promotes esophageal cancer progression.

Next, we determined whether the upregulation of RCC2 and Sox2 occurs in in vivo models. First, we examined the expression of both proteins in esophageal tumor-harboring and control mice. As expected, the expression of RCC2 was upregulated in esophageal tumor tissue (Figs. 1G, 5A and C). Moreover, Sox2 also was substantially overexpressed in esophageal tumors compared with controls (Fig. 5B and D). Surprisingly, both upregulated proteins were colocalized in the basal cell layer in the esophagus (Fig. 5A and B). Thus, these data indicate that RCC2 and Sox2 are overexpressed together in esophageal cancer in vivo and this upregulation occurs in the same place for both proteins, the basal cell layer of esophagus. In addition, to evaluate the role of RCC2 on Sox2 in vivo, we analyzed the expression of Sox2 in RCC2 knockout mice and compared it with wild-type mice (controls). For that, RCC2 was deleted after tumor induction (progression model) and Sox2 expression evaluated by IHC. As expected, RCC2 deletion significatively decreases Sox2 expression in vivo, which confirms our previous data showing the regulatory role of RCC2 on Sox2 expression (Fig. 5E and F).

We used an inducible knockout animal model to delete RCC2 and evaluate its role in the development of esophageal tumors. In our model, the enzyme Cre, which is activated by tamoxifen, is associated with KRT5. KRT5 is expressed in the basal cell layer of the epidermis in skin and esophagus (https://www.ncbi.nlm.nih.gov/gene/3852#gene-expression; Supplementary Fig. S2C). Therefore, Cre-KRT5 is present and is activated only in those organs. Thus, this animal model allowed us to delete RCC2 specifically in the esophagus and as a side effect in skin after tamoxifen injection without affecting other organs physiologically relevant as liver, lungs, or kidney. Thus, this model is extremely valuable because it provides us with a more detailed examination of the oncogenic role of RCC2 specifically in the esophagus. We conducted a pilot study to determine whether our genetically modified animal model was working properly. We injected two different doses of tamoxifen into the mice and evaluated the RCC2 expression 3 weeks later. Our data indicated that RCC2 ^flox/flox; KRT5^{−CreERT2/−} mice lost the expression of RCC2 in esophagus at dose of 50–60 mg/kg of body weight (Supplementary Fig. S3). Thus, we used this dose for all animal experiments. Furthermore, the expression of keratin 5 as a marker of basal cells was evaluated in knockout and wild-type animals, to confirm that the deletion of RCC2 does not affect or eradicate these cells in the esophagus. Keratin 5 expression was similar in knockout and wild-type groups, even though at 22 weeks after the deletion of RCC2 with 4-OHT (tumorigenesis model; Fig. 6A), indicating that those cells are not deleted after RCC2 genetic depletion and still can participate in the esophageal oncogenesis by 4-NQO administration (Supplementary Fig. S4).

We performed two different animal experiments to examine how RCC2 depletion affects tumor growth before and after inducing esophageal cancer. In our first study, we examined the effect of RCC2 depletion on esophageal tumorigenesis, by investigating whether RCC2 depletion before tumor induction inhibits or reduces the formation of tumor nodules. Three weeks after the 4-OHT injection, we induced tumors with 4-NQO for 16 weeks and then after an additional 9 weeks of observation, we euthanized the animals for analysis (Fig. 6A). Compared with control groups expressing RCC2 (animals without the KRT5-Cre gene or 4-OHT injection), the depletion of RCC2 significantly reduced tumor formation in the esophagus (Fig. 6B and C). Figure 6D shows that RCC2 was efficiently deleted in mice after 4-OHT injection. We also examined the expression of proliferating cell nuclear antigen (PCNA), a marker of cell proliferation and results showed that RCC2 depletion reduced PCNA expression compared with controls (Fig. 6E).

Next, we used an opposite approach that is clinically more relevant. We performed a tumor regression study where we depleted RCC2 after cancer induction with 4-NQO (Fig. 7A). Compared with controls, RCC2-depleted mice showed a reduction of tumor number in the esophagus (Fig. 7B and C). As before, the reduction in tumor number was associated with a reduction in PCNA expression only in RCC2-depleted mice (Fig. 7D and E). These data overall suggest that RCC2 is a very important oncogenic protein in the promotion of the formation and progression of esophageal cancer in vivo.

A key stage for maintenance of genetic stability is chromosome segregation during mitosis. Instead, a hallmark of tumor cells is the loss of their genomic stability. RCC2 is a centromeric protein that plays an important role in the regulation of chromosome segregation. Initially, RCC2 was shown to function in the spindle midzone for centromeric targeting of CPC and to ensure that mitosis proceeds properly (5). In addition, RCC2 is required in combination with microtubules for Aurora B kinase activity, a key component of CPC encompassing important cell-cycle events, such as chromosome segregation and centrosome duplication (6, 20). Loss of RCC2 delocalizes Aurora B and other CPC members from centromeres affecting proliferation (5, 6). In addition, Aurora B kinase is an important oncogene in cancer (21), which suggests that the RCC2–Aurora B complex could affect tumor cell proliferation. Furthermore, RCC2 depletion causes spindle abnormalities in prometaphase and disrupts the regulation of kinetochore–microtubule interactions in early mitosis by inhibiting the small GTPase RalA (3, 4). RCC2 also binds the GTPase ARF6 (ADP‐ribosylation factor 6), which protects sister chromatid cohesion allowing the establishment of stable kinetochore–microtubule attachments and mitotic progression (22, 23). These types of evidence highlight the importance of RCC2 in mitosis, cell proliferation, and its relevance in genomic stability.

Previous reports suggest that RCC2 plays a potential role in several cancers (9–11); however, the mechanisms by which RCC2 exerts these effects are underinvestigated and no studies investigating the role of RCC2 on esophageal cancer development have been conducted. Here, we demonstrated for first time that RCC2 is highly expressed in esophageal cancer in mice and humans compared with normal tissue (Fig. 1). The high expression of RCC2 is associated with aggressiveness and poor prognosis in lung cancer (24, 25). Furthermore, overexpression of ENST00000439577, a long noncoding RNA promoting cell proliferation and migration, is positively correlated with RCC2 overexpression and poor overall survival in patients with cancer (26). Moreover, the miRNAs miR-1247 and miR-29c inhibit tumor growth and cell proliferation by decreasing RCC2 expression in pancreatic and gastric cancer (11, 27). In addition, RCC2 promotes resistance to cancer treatments and inhibits sensitivity to apoptotic drugs (10, 12, 13, 28). Here, our data show that RCC2 upregulation is linked with proliferation, anchorage-independent growth and migration of esophageal cancer cells and promotes transformation of the esophageal normal Het-1A cell line (Figs. 1 and 2). Thus, we report for the first time an oncogenic role for RCC2 in esophageal cancer.

Sox2 is a transcription factor described as an essential embryonic stem cell gene and a necessary factor for induced cellular reprogramming (14, 29). In cancer, the role of Sox2 has been well established. Sox2 overexpression in colorectal cancer cells induces several characteristics of cancer stem cells, such as spheroid growth pattern, loss of differentiation, and increased expression of markers CD24 and CD44 (16). BRAF, a well-known oncogene, promotes Sox2 expression and is associated with poor prognosis in cancer (30). In esophageal cancer, Sox2 has been shown to have an important role promoting malignancy. SOX2 gene is amplified in esophageal squamous cell carcinomas and is required for proliferation and anchorage-independent growth (18). Sox2 promotes growth of esophageal cancer by activating the AKT/mTORC1 signaling pathway (17). Furthermore, a recent paper showed that AKT protects Sox2 expression from ubiquitin-dependent protein degradation (31), suggesting a feedback between Sox2 and AKT that supports the transcriptional role of Sox2.

Recent evidence shows that RCC2 regulates p-STAT3 activity, a transcription factor upregulating DNMT1 expression and increasing proliferation of glioblastoma (12). Therefore, we investigated whether RCC2 also exerts its tumor effects by influencing Sox2 activity. RCC2 enhanced and stabilized Sox2 expression by inhibiting proteasome-mediated degradation, because MG132 treatment restores Sox2 expression when RCC2 is downregulated by shRNA. Furthermore, RCC2 overexpression decreased Sox2 ubiquitination (Fig. 3). Thus, we hypothesize that Sox2 upregulation by RCC2 might increase its transcriptional activity and provide insights regarding the oncogenic role of RCC2 in esophageal tumor. Our results clearly show that Sox2 transcriptional activity increased when RCC2 was overexpressed (Fig. 4A). Furthermore, our ChIP assay confirmed that forced RCC2 expression enriched and increased the expression of CCND1 and ETV4, both genes under the control of Sox2, at RNA and protein level (Fig. 4B–F). These data overall confirm that RCC2 stimulates the binding of Sox2 to promotor regions of its target genes and increases its transcriptional activity. In addition, the overexpression of Sox2 in RCC2 knocking down cells positively regulate the survival in those cells, antagonizing the inhibitory effect of RCC2 downregulation. This is a clear evidence that RCC2 regulates Sox2 activity to promote its tumoral effects. Nevertheless, the mechanisms explaining how RCC2 exerts this transcriptional control are not clear. Our experiments using IP showed that RCC2 does not bind directly to Sox2 (data not shown). However, because IP assays only detect strong interactions between proteins, we cannot discard the idea that RCC2 and Sox2 are binding transitorily. Therefore, whether RCC2 weakly and momentarily binds Sox2 is unknown and will require further investigation. However, our data clearly show that RCC2 promotes Sox2 transcriptional activity and suggest that the role of RCC2 in esophageal cancer is mediated through Sox2 activity. This evidence supports other works where RCC2 has also shown a regulator role on phosphorylation of Ser/Thr protein kinases and transcription factors (9, 12), evidencing new roles of RCC2 besides its previous known functions on cell-cycle regulation. For example, RCC2 was able to activate JNK which promoted oncogenic hallmarks for lung adenocarcinoma cancer cells (9). In breast cancer, RCC2 promotes tumor progression by activating Wnt pathway through β-catenin transcriptional activity upregulation (32). Similarly, RCC2 promotes tumoral effects on glioblastoma via regulation of DNMT1 expression in a p-STAT3 transcription factor–dependent manner (12). Furthermore, to our knowledge, we are the first to demonstrate the fact that RCC2 controls Sox2 transcriptional activation and expression. This conclusion is supported by our in vivo data, where overexpressed RCC2 and Sox2 colocalized in the cell basal layer in the esophagus and the deletion of RCC2 in knockout mice strongly decreases Sox2 expression (Fig. 5).

In our animal models, we used conditional knockout mice to evaluate the role of RCC2 deletion on tumor progression, specifically in esophagus. In this model, mice expressing the recombinase Cre together with the mutated ligand-binding domain of estrogen receptor fusion recombinase (CreER^T) allow the inducible control of Cre activity after 4-OHT injection. The transgenic construct is driven by the keratin 5 promoter, which is active in the basal epithelial cell lineage (33). Because keratin 5 is only expressed in esophagus and skin, our model allowed us to activate CreER^T and delete RCC2 only in esophagus and as a side effect in skin after 4-OHT injection, allowing us to avoid possible collateral effects of the RCC2 deletion in other organs like lung, liver, heart or pancreas. Even 22 weeks after RCC2 deletion, the expression of keratin 5 is not lost (Supplementary Fig. S4) in knockout mice, which show that deleting RCC2 does not affect the esophageal basal cell integrity. This observation matches with the findings that RCC1, but not RCC2, was listed as an essential gene in human (34). Essential genes are genes that are indispensable to support cellular life. These genes constitute a minimal gene set required for a living cell (35). Here, it could be possible that RCC1, a member of the family of RCC2, with knows function in cell division, could compensate for the RCC2 loss and help to keep the esophageal basal cell integrity. However, it needs to be confirmed. Nevertheless, the most important fact here is that RCC2 deletion did not alter the capacity of the basal cells to participate in the formation of tumors in esophagus and it proves that our animal model is very valuable to study the effects of RCC2 deletion in esophageal cancer progression.

To further confirm the role of RCC2 as an oncogene in esophagus, we conducted in vivo experiments using conditional knockout mice. Our results show that RCC2 depletion inhibited tumorigenesis in the esophagus (Fig. 6). More relevant was the fact that RCC2 depletion promoted a reduction in the tumor number even when tumor induction was done before or after RCC2 knockout (Figs. 6 and 7). These effects were associated with a reduction of a proliferation marker in esophageal cancer for both cases (Figs. 6E and 7E). Interesting, the fact that Sox2 expression was dramatically decreased when RCC2 was deleted confirms the regulation of Sox2 by RCC2 in vivo.

In conclusion, we are the first group to demonstrate that RCC2 is overexpressed in esophageal cancer and promotes tumor growth by increasing proliferation, transformation, and migration. These effects are linked to Sox2 regulation because RCC2 influenced Sox2 expression by inhibiting its ubiquitination-mediated proteasome degradation and increasing its transcriptional activity. RCC2 oncogenic roles were also observed in vivo, where RCC2 knockout mice showed a reduction in tumor number and lower proliferation in the esophagus, associated with a reduction of Sox2 expression. Thus, the RCC2–Sox2 axis could be an important target to consider for the treatment of esophageal cancer clinically.

No potential conflicts of interest were disclosed.

A. Calderon-Aparicio: Conceptualization, formal analysis, investigation, methodology, writing-original draft, writing-review and editing, A. Calderon-Aparicio performs the most of the experiments. H. Yamamoto: Conceptualization, formal analysis, methodology. H. De Vitto: Methodology. T. Zhang: Support with animals. Q. Wang: Support with animals. A.M. Bode: Resources, supervision, funding acquisition, project administration, writing-review and editing. Z. Dong: Resources, supervision, funding acquisition, project administration.

The authors thank Tara Adams for assistance in handling the animal colonies. We also thank The Hormel Foundation for the financial support of this work.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.