The FGFR1 V561M Gatekeeper Mutation Drives AZD4547 Resistance through STAT3 Activation and EMT

FGFRs are a family of receptor tyrosine kinases (RTK) normally involved in tissue repair, hematopoiesis, angiogenesis, and embryonic development (1, 2). However, FGFR amplification and/or mutation drives a number of cancer types, including non–small cell lung cancer (NSCLC), breast cancer, gastric cancer, and multiple myeloma (3–5) due to their roles in regulating cell growth and survival. FGFRs drive tumorigenesis by constitutively activating signaling pathways involved in cell proliferation and survival, which eventually promotes epithelial–mesenchymal transition (EMT), driving invasion and tumor angiogenesis (6, 7).

Gene amplification of FGFR1 resulting in overexpression has been implicated in 20% of squamous cell lung cancer, a type of NSCLC with a 5-year survival rate of only 15% (3, 8–10). FGFR1 is activated upon FGF binding to its extracellular domain, resulting in protein dimerization and transautophosphorylation of the intracellular tyrosine kinase domains. Such phosphorylation events at multiple tyrosine residues subsequently serve as recruitment sites for binding partners that lead to the activation of downstream signaling pathways (11, 12). PLCγ, FRS2, and CrkII directly bind to FGFR1 and lead to activation of protein kinase C, the MAPK and PI3K/Akt signaling pathways, and JNK, respectively (13–15). Upon FGFR1 amplification, Y677 can also become phosphorylated and serve as a recruitment site for STAT3 signaling (16). FGFR family proteins are also important drivers of the EMT, a process important in embryonic development as well as cancer metastasis (17–19).

Due to their implication in numerous cancer types, clinical trials are underway for a number of small-molecule inhibitors targeting FGFRs (20, 21). However, resistance is a major problem with any targeted therapy using small-molecule inhibitors, with one common mechanism of resistance in kinases occurring via the gatekeeper mutation (22, 23). Because many RTK small-molecule inhibitors compete with ATP to bind in the active site, interaction with a hydrophobic region adjacent to the active site is required to improve specificity for a particular target. The accessibility of this hydrophobic pocket is determined by the gatekeeper residue (24) which is normally a relatively small, hydrophobic amino acid, often valine. Upon treatment with various RTK inhibitors, this residue has been shown to mutate to a larger residue (e.g., methionine, leucine, isoleucine), thus blocking the access of the inhibitor to the pocket from which it gains its affinity and specificity for the protein (25). This mutation accommodates ATP binding, but precludes binding of inhibitors that require access to the hydrophobic pocket. FGFR1 has been shown to gain resistance to a number of inhibitors including AZD4547 upon mutation of valine 561 to a methionine (V561M; refs. 26, 27).

In the cases of EGFR, ABL, PDGFR, and Src kinases, it has been shown that the gatekeeper mutation has an activating effect on the kinase domain in addition to conferring resistance (23). The gatekeeper mutants of EGFR, PDGFR, c-ABL, and Src were shown to have activated kinase activity and an increased rate of cellular transformation (16). In addition, the EGFR T790M gatekeeper mutation has been shown to promote EMT (28–30). Previous studies in our lab have kinetically characterized V561M FGFR1 and demonstrated an increase in the k_cat of V561M FGFR1 relative to wild type (WT). We also identified a slight decrease in AZD4547 affinity for V561M FGFR1, although the K_d was still in the nanomolar, clinically relevant range (22). To confirm the efficacy of AZD4547 in a cellular context, we treated cells expressing full-length WT and V561M FGFR1 with AZD4547. To our surprise, although WT cells maintained low nanomolar sensitivity to AZD4547, V561M cells were highly resistant. In this study, we utilize a series of cell-based assays including immunoblotting, proliferation, transwell migration and invasion, and anchorage-independent growth assays to characterize the differences between cells expressing WT and V561M FGFR1. To investigate expression changes with single-cell resolution, we applied the newly emerging technique Mass Cytometry/Cytometry Time-of-Flight (CyTOF). CyTOF is a novel technology similar to flow cytometry in which antibodies are tagged with heavy metal isotopes rather than fluorophores. This enables simultaneous detection of up to 100 parameters per cell, with minimal overlap between channels. We utilized CyTOF to study an NSCLC cell line known to be heterogeneous with a suspected stem cell population (31). Using this technique, we were able to corroborate our immunoblot findings with single-cell data and identify a small percentage of cancer stem cells. This technique provides detailed expression data for multiple signaling partners and markers in a single experiment, enabling profiling of drug-resistant cell lines in a higher throughput, multiplexed manner. Other groups have utilized CyTOF to study tumor samples to better understand drug responses (32, 33), the roles of stem cell populations (34), and in the study of combination therapy (35). CyTOF has also been used to study drug resistance in acute myeloid leukemia (36) and glioblastoma (37). In the current study, we demonstrate that this technique can be a valuable tool to investigate drug resistance mechanisms in NSCLC.

It is imperative to fully understand the mechanistic details of common drug resistance mutations prior to inhibitors reaching the clinic. This study elucidates the mechanisms underlying V561M resistance to AZD4547, demonstrating that STAT3 is required for survival in the presence of inhibitor. It also reveals the metastatic consequences of acquiring the gatekeeper mutation, due to an enhanced EMT and increased invasion in cells expressing V561M FGFR1. These results are critical to guide future targeted and combination therapies including FGFR family proteins, providing insight into pathways and processes activated downstream of V561M FGFR1, as well as suggesting methodology for characterizing additional mechanisms of drug resistance.

The parental L6 cells used in this study were kindly provided by Dr. Joseph Schlessinger (Yale University, New Haven, CT). L6 cells express no endogenous FGFR or FGF proteins, making them an ideal system with which to compare WT and V561M FGFR1. To generate stable, isogenic cell lines overexpressing WT or V561M FGFR1, the following protocol was utilized: GPG cells were grown to 80% confluence, transfected with a pBABE vector containing WT or V561M FGFR1, and grown in viral production media (DMEM supplemented with 10% FBS) until virus was harvested (4 days). Harvested virus was used to infect L6 cells, and cells incorporating the vector were selected using 2.5 μg/mL puromycin for 3 to 4 weeks. These stable cell lines (L6-WT, L6-V561M) were maintained in DMEM supplemented with 10% heat-inactivated FBS, 1% antibiotic–antimycotic (A/A; Gibco #15240062), and 1 μg/mL puromycin. H1581 NSCLC cell lines overexpressing WT or V561M FGFR1 (H1581-WT, H1581-V561M) were a generous gift from Dr. Roman K. Thomas (University of Cologne, Köln, Germany). H1581-derived cell lines were grown in RPMI-1640 supplemented with 10% FBS and 1% A/A. All cells were grown at 37°C in a humidified atmosphere with 5% CO₂. Cells were tested for mycoplasma and only used up to passage 25.

Recombinant FGF2 was purchased from Gibco (#PHG0024). Heparin sulfate was purchased from Stemcell Technologies (#07980). The following antibodies were used (all primary antibodies are rabbit derived unless otherwise noted): anti-FGFR1 (#9740), phospho-FGFR (Y653/654, #3476, mouse derived), phospho-FRS2 (Y436, #3861; Y196, #3864), PLCγ (#5690), phospho-PLCγ (Y783, #2821), ERK (#4695), phospho-ERK (T202/Y204 #4370), Akt (#4691), phospho-Akt (S473, #4060), STAT3 (#4904), phospho-STAT3 (Y705, #9145), E-cadherin (#3195), Vimentin (#5741), ZEB1 (#3396), N-cadherin (#13116), HIF1α (#14179), Bcl-XL (#2764), Hsp90 (#4877), FGF2 (#61977), TGFβ (#3711), Cyclin D1 (#2978), GAPDH (#2118), horseradish peroxidase (HRP)–linked rabbit IgG secondary antibody (#7074), and HRP-linked mouse IgG secondary antibody (#7076), from Cell Signaling Technology. Anti-FRS2 (#10425, mouse derived) was purchased from Abcam. AZD4547 was purchased from Selleck Chemicals. The following CyTOF antibodies were purchased from Fluidigm Inc.: STAT3 (#3173003A), pSTAT3 (#3158005A), Vimentin (#3154014A), TGFβ (#3163010B), SOX2 (#3150019B), and Nanog (#3169014A). Custom antibody–metal conjugations were performed using kits purchased from Fluidigm, Inc. (PRD002), and carrier-free antibodies targeting FGFR1 (#9740), pFGFR1 (#3476), pFRS2 Y196 (#3864), and ZEB1 (#3396) were purchased from Cell Signaling Technology.

L6-WT, L6-V561M, H1581-WT, and H1581-V561M stable cell lines were serum starved for 12 hours (RPMI 1640 + glutamine, supplemented with 1% A/A). For AZD4547 treatment experiments, 1,000 to 5,000 cells were plated in full growth media (RPMI 1640 + glutamine, supplemented with 1% A/A and 10% FBS). Varying concentrations of AZD4547 (2.5 nmol/L–10 μmol/L) were added after 24 hours, and cells were incubated for 2 to 4 days before quantification using an MTT assay as described previously (38). For signaling experiments, cells were serum starved for 12 hours and stimulated with 50 ng/mL FGF2 and 10 μmol/L heparin for 0, 1, 5, and 15 minutes. Timepoints were quenched using ice-cold PBS and immediate addition of lysis buffer [RIPA Lysis Buffer (Sigma #20-188) supplemented with phosphatase (25 mmol/L NaF and 100 mmol/L sodium orthovanadate) and protease inhibitors (cOmplete, mini, EDTA-free; Sigma #11836170001)]. For basal lysates, cells were left untreated, and lysates were collected using ice-cold PBS and immediate addition of lysis buffer. Lysates were cleared by centrifugation, collected, and total protein content was quantified using the Pierce BCA protein assay kit (Thermo Fisher #23225). Phosphorylation and/or total expression of FGFR1, downstream signaling partners, STAT3 gene targets, and EMT marker analysis were detected using immunoblotting.

Equal amounts of protein extracts (5 μg) were resolved by SDS-PAGE (Bio-Rad, 4%–20% gradient #4561096) and then transferred to a nitrocellulose membrane using the iBlot machine from Thermo Fisher. The membrane was blocked using 3% BSA in TBST (Tris-buffered saline with 0.1% Tween-20), then incubated with primary antibodies overnight at 4°C, washed, and incubated at room temperature with secondary antibody. Blots were developed using enhanced chemiluminescence and exposed to X-ray film. The level of protein phosphorylation or marker expression was quantified using ImageJ (NIH, Bethesda, MD). Signal density was normalized to GAPDH loading control and total protein expression for phosphorylation analyses. Every blot included in this study has been normalized to a loading control from the same gel. Representative GAPDH blots are displayed in Figs. 2, 3, and 4. Data were plotted using GraphPad Prism (GraphPad).

L6-WT, L6-V561M, H1581-WT, and H1581-V561M cells were serum starved for 12 hours. 5 × 10³ to 5 × 10⁴ cells were plated in 6-well plates in DMEM or RPMI-1640 (L6 or H1581 cells, respectively) supplemented with 10% FBS and 1% A/A, and appropriate concentration of AZD4547 if applicable. Initial cell counts were confirmed, and cells were then incubated for 48 to 168 hours, trypsinized, and counted using the Countess automated cell counter (Invitrogen; #C10227). Data were plotted as % increase in cell number using GraphPad Prism. Cells were imaged using a Nikon Eclipse Ti-S fluorescence microscope, and images were taken with μManager software.

L6-WT, L6-V561M, H1581-WT, and H1581-V561M cells were serum starved for 12 hours. Cells (1 × 10⁵) were then plated onto 8 μm pore transwell migration filters in 24-well plates (Corning #CLS3464) in starvation media. Growth media (DMEM or RPMI-1640 with 10% FBS) were added to the bottom of the transwell, and cells were incubated for either 8 hours (L6 cells) or 24 hours (H1581 cells) at 37°C under an atmosphere with 5% CO₂. Unmigrated cells on the inner surface of the transwell chamber were removed, and migrated cells were stained with crystal violet. Assays were imaged using the Echo Revolve R4 microscope. Migrated cells were quantified using ImageJ, and data were plotted using GraphPad Prism.

L6-WT, L6-V561M, H1581-WT, and H1581-V561M cells were serum starved for 12 hours. 2.5 × 10⁴ (L6) or 5 × 10⁴ (H1581) cells were then plated onto Matrigel-coated 8 μm pore transwell filters in 24-well plates (Corning #354483) in starvation media. Growth media (DMEM or RPMI-1640 with 10% FBS) were added to the bottom of the transwell, and cells were incubated for 24 hours (L6 cells) or 72 hours (H1581 cells) at 37°C under an atmosphere with 5% CO₂. Unmigrated cells on the inner surface of the transwell chamber were removed, and the transwell chambers were stained with crystal violet and then imaged using Echo Revolve R4 microscope. Invasive cells were quantified using ImageJ, and data were plotted using GraphPad Prism.

The soft-agar anchorage-independent growth assay was performed using a modified protocol based on the CytoSelect 96-well cell transformation assay kit purchased from Cell Biolabs (#CBA130). L6-WT, L6-V561M, H1581-WT, and H1581-V561M cells were serum-starved for 12 hours. A bottom layer of agar was plated in a 96-well plate. 1 × 10⁵ cells were then seeded in agar containing 2x DMEM supplemented with 25% FBS. Finally, complete growth media were plated on top. Plates were incubated for 6 to 8 days and then quantified using the MTT cell viability assay and a Spectramax M5 plate reader. Data were plotted using GraphPad Prism.

CyTOF analyses were performed on the CyTOF 2 instrument (Fluidigm, Inc.) at the Yale University Core Facility. For CyTOF experiments, cells were grown to 80% confluence, stimulated, treated with cisplatin (live/dead stain; Fluidigm, Inc.; #201064), and trypsinized prior to fixation. Different cell types and treatment conditions were treated with Cell-ID 20-plex Pd Barcodes (#201060), combined into one sample, and stained using heavy metal–tagged surface antibodies. Cells were then permeabilized using methanol and stained using heavy metal–tagged intracellular antibodies. Surface- and intracellular-stained cells were then incubated with an Iridium-tagged intercalation solution (Fluidigm, Inc.; #201192B), and then run on the CyTOF 2 instrument. Analysis was performed using FlowJo software (FlowJo, LLC).

We obtained 5 different shRNA constructs targeting various parts of the STAT3 gene, as well as a scrambled, nontargeting control as a generous gift from Dr. Ben Turk and Dr. David Calderwood (Yale University, New Haven, CT; refs. 39, 40). HEK293T cells were cotransfected with a pLKO.1 puro vector (Sigma SHC002) containing the shRNA of interest or the scrambled, nontargeting control, vsvG, and dR8.91 packaging vectors using polyethylenimine. L6 and H1581 cells were subjected to multiple rounds of infection with lentivirus harvested from these cells. The shRNA with the most effective knockdown was selected (shRNA 2: CCTGAGTTGAATTATCAGCTT, scrambled, nontargeting control: CAACAAGATGAAGAGCACCAA). Knockdown efficiency was measured by quantifying immunoblot data using ImageJ. Data were plotted using GraphPad Prism.

Our previous fluorescence binding studies (22) demonstrated that AZD4547 maintains nanomolar binding affinity for V561M FGFR1 (Table 1). To further investigate the potency of AZD4547 against WT versus V561M FGFR1, we performed cell-based assays to observe the effects of AZD4547 on cell viability in two cell lines. We utilized L6 cells, rat myoblasts with no endogenous FGFR expression, to ensure an isogenic background, and validated our findings using an NSCLC cell line, H1581, engineered to overexpress WT or V561M FGFR1. We calculated IC₅₀ values for AZD4547 treatment of WT and V561M FGFR1 in both L6 and H1581 cells and obtained values of 6 ± 4 nmol/L for L6-WT cells, 1,400 ± 700 nmol/L for L6-V561M cells, 4.8 ± 0.8 nmol/L for H1581-WT cells, and 510 ± 90 nmol/L for H1581-V561M cells (Table 1; Fig. 1A–D). Thus, although our previously obtained in vitro data demonstrated a 32-fold, modest decrease in binding affinity of AZD4547 for V561M FGFR1 relative to WT, cell-based assays display a 100- to 200-fold increase in IC₅₀ for cells expressing V561M relative to those expressing WT FGFR1. To understand the mechanism behind V561M-driven resistance, we further characterized the FGFR1 V561M mutation, studying differences in downstream signaling and cellular tumorigenicity between cells expressing WT and V561M FGFR1.

To compare the signaling downstream of WT and V561M FGFR1, we starved cells for 12 hours, which was the amount of time required to ablate WT FGFR1 phosphorylation. We stimulated cells with FGF and heparin, and measured activation of downstream signaling partners after a series of timepoints using immunoblotting. We found significantly and consistently increased phosphorylation of STAT3 in L6-V561M and H1581-V561M cells (2-fold and 3-fold, respectively; P = 0.03 and 0.01, Fig. 2A and B). PLCγ and CrkII were activated to similar levels between WT and V561M in both cell lines. In L6-V561M cells, we observed minimal phosphorylation of Akt and ERK upon FGF stimulation. However, Akt and ERK phosphorylation levels are similar between H1581-WT and H1581-V561M cells, suggesting that this is a cell line–specific phenomenon (Fig. 2A). Because STAT3 was consistently upregulated in both L6-V561M and H1581-V561M cells, we chose to further investigate the activation of STAT3 signaling in cells expressing V561M FGFR1. We performed immunoblots probing for known STAT3 gene targets, including ZEB1, HIF1α, Cyclin D1, Bcl-XL, TGFβ, Hsp90, and FGF2 (Fig. 2C–E). In H1581-V561M cells, we observed significantly higher levels of pSTAT3, ZEB1, HIF1α, Cyclin D1, and Bcl-XL relative to H1581-WT cells. L6-V561M cells expressed higher levels of pSTAT3, ZEB1, Bcl-XL, and TGFβ relative to H1581-WT cells, but we observed no obvious difference in HIF1α or Cyclin D1 expression. Neither cell line displayed differences in Hsp90 expression. Interestingly, we observed that FGF2 was upregulated in H1581-V561M cells relative to WT (Fig. 2C). We confirmed FGF2 expression in the H1581-V561M cells, and demonstrated that the FGF2 levels in L6 cells are extremely low, using qPCR (Supplementary Fig. S1). The STAT3 marker upregulation was much more pronounced in the H1581 cells, suggesting that an autocrine loop may be present in the V561M H1581 cells, enhancing the effects of the V561M mutation. Coamplification of FGFR1 and FGF2 resulting in a similar autocrine signaling loop has been identified as a driver of resistance to EGFR-targeted therapies (41).

Among the upregulated STAT3 targets observed in cells expressing V561M FGFR1 are multiple EMT regulators, including TGFβ and ZEB1 (42, 43). This led us to investigate whether L6 and H1581 cells expressing V561M FGFR1 display more mesenchymal characteristics relative to WT cells. We performed immunoblotting experiments probing for epithelial and mesenchymal markers (Fig. 3A–C) and found that L6-V561M and H1581-V561M cells express consistently higher levels of mesenchymal markers relative to L6-WT and H1581-WT (ZEB1; 3.7-fold and 15-fold, respectively, N-cadherin; 2-fold and 5-fold, respectively; Vimentin, not significant but moderately increased), as well as consistently lower levels of epithelial marker E-cadherin (1.3-fold and1.5-fold, respectively; Fig. 3A–C).

We then examined the effects of this mutation on cellular behaviors associated with EMT: proliferation, migration, invasion, and anchorage-independent growth (Fig. 3D–H). L6-V561M and H1581-V561M cells demonstrated significantly enhanced levels of each of these processes relative to their WT counterparts. We observed a 2-4-fold increase in proliferation in V561M cells relative to WT in both L6 and H1581 cell lines by validating initial cell counts and quantifying the % increase in cell number after 72, 96, 144, and 168 hours of cell growth (see Supplementary Tables S1 and S2 for cell counts and P values). Through Boyden chamber transwell migration assays, we found a 2-fold increase in migration in both L6-V561M and H1581-V561M cells relative to WT (P = 0.04, 0.01, respectively) by quantifying DAPI-stained migrated cells on the bottom layer of the Boyden chamber. Using transwell Matrigel invasion assays, we observed a 1.5-fold increase in invasion in L6 V561M cells relative to WT (P = 0.01) and a 2-fold increase in H1581-V561M cells relative to WT (P = 0.0004). We observed a 2-fold increase in anchorage-independent growth in L6-V561M cells relative to WT (P = 0.001) and a 4-fold increase in H1581-V561M cells (P < 0.0001) using an MTT assay. Representative images of proliferation, transwell migration, Matrigel invasion, and anchorage-independent growth experiments are shown in Fig. 3D, and quantifications are shown in Fig. 3E–H. These findings, in combination with the consistently higher expression of mesenchymal markers and lower expression of epithelial markers, demonstrate that the V561M mutation biases cells toward a more mesenchymal phenotype relative to cells expressing WT FGFR1.

To investigate the role of STAT3 in the enhanced EMT and AZD4547 resistance observed in H1581-V561M cells relative to WT, we used shRNA to knock down STAT3. We obtained a 10-fold knockdown in H1581-WT and H1581-V561M cells (H1581-WT-STAT3-KD, H1581-VM-STAT3-KD; Fig. 4A and B) and performed cell proliferation assays using H1581-WT-STAT3-KD and H1581-V561M-STAT3-KD cells and control cells treated with a scrambled, nontargeting shRNA. H1581-WT-STAT3-KD cell lines displayed slightly decreased cell proliferation relative to those treated with scrambled shRNA, and proliferation was abolished in both cases with 250 nmol/L AZD4547 (Fig. 4C and D). Interestingly, H1581-V561M-STAT3-KD cells did not display a decreased level of proliferation relative to those treated with scrambled shRNA, suggesting that STAT3 alone is not responsible for the increased EMT in H1581-V561M cells. However, H1581-V561M-STAT3-KD cells are significantly sensitized to AZD4547 treatment (P = 0.03; Fig. 4C and D), demonstrating that they are dependent on STAT3 for survival in the presence of AZD4547. We confirmed this sensitization using cell viability assays and found IC₅₀ values of 50 ± 30 nmol/L for H1581-V561M-STAT3-KD cells and 700 ± 300 nmol/L for V561M cells treated with the nontargeting scrambled control (Table 2; Fig. 4E and F). The sensitivity of H1581-WT cells to AZD4547 was largely unaffected by STAT3 knockdown, with IC₅₀s of 4 ± 1 nmol/L for cells treated with the scrambled control and 13 ± 4 nmol/L in H1581-WT-STAT3-KD cells.

To confirm that this effect was not cell line specific, we repeated the STAT3 knockdown experiments in L6-WT and L6-V561M cells and saw a similar sensitization to AZD4547 in L6-V561M cells. We obtained IC₅₀ values of 140 ± 50 nmol/L for L6-V561M-STAT3-KD cells and 700 ± 400 for L6-V561M cells treated with the nontargeting scrambled control. As observed with H1581-WT cells, sensitivity of L6-WT cells was unaffected by STAT3 knockdown, with IC₅₀ values of 1.4 ± 0.6 nmol/L and 1.2 ± 0.7 nmol/L for L6-WT cells treated with the scrambled, nontargeting control and STAT3 targeting shRNA, respectively (Supplementary Fig. S2; Supplementary Table S3). Together, these data suggest that STAT3 plays a critical role in the survival of cells expressing V561M FGFR1 in the presence of AZD4547.

Immunoblot experiments probing for signaling pathway activation downstream of WT and V561M FGFR1 identified STAT3 as a driver of AZD4547 resistance. The value of this type of analysis in guiding combination therapies inspired us to search for a method to expand this type of analysis to characterize drug-resistant cell lines in a more high-throughput context. To address this, we utilized CyTOF, a novel technology that enables single-cell analysis of up to 20 sample conditions and 38 markers in one experiment (44). Using palladium barcoding (45) and metal-tagged antibodies, we were able to simultaneously probe multiple sample conditions for activation of FGFR1 and its downstream signaling partners, as well as EMT and stem cell marker expression. The power of CyTOF to identify small subpopulations of cells led us to focus our CyTOF studies on H1581 cells due to their previously suggested cancer stem cell population and clinical relevance (31, 46). We stained unstimulated and stimulated (5 or 15 min + FGF2 and heparin) cells with the antibodies listed in Table 3.

CyTOF data were largely consistent with immunoblots, showing significantly increased levels of TGFβ, ZEB1, and Vimentin expression in V561M H1581 cells relative to WT (Fig. 5C and D). Consistent with data demonstrating the enhanced k_cat of V561M FGFR1, unstimulated H1581-V561M cells demonstrated higher levels of total phosphotyrosine relative to WT, as well as a corresponding increase with FGF stimulation. We observed slightly increased basal levels of pSTAT3 in H1581-V561M cells relative to WT, as well as a corresponding increase upon FGF stimulation. We also observed similarly increased levels of pFRS2, pERK, and pAKT (Fig. 5A and B). We postulate that the increase in STAT3 phosphorylation may have been underestimated in our CyTOF analysis due to limitations with the antibody. Phosphoantibodies often have an appreciable amount of nonspecific binding, which can be accounted for in immunoblot experiments by confirming the correct molecular weight. In CyTOF analysis, this is not possible; because the pSTAT3 signal was already low, the nonspecific background may have masked the increase in pSTAT3. Additional optimization studies are necessary to generate phospho-specific antibodies with reduced background for CyTOF experiments. Notably, we observed a small population of highly SOX2-positive cells in H1581-WT and H1581-V561M cell lines, consistent with studies that have demonstrated cancer stem cell activity in H1581 cells (31). H1581-V561M cells displayed slightly higher overall SOX2 and Nanog levels relative to H1581-WT cells, suggesting that cancer stem cells could play a role in the enhanced EMT observed in H1581-V561M cells, although further studies are required to confirm this possibility.

CyTOF is an exciting new technology being used by many labs to obtain single-cell expression data to understand cancer biology (34–36, 44, 45). In this study, we have utilized this powerful technique to obtain single-cell data confirming our findings regarding pathway activation, epithelial and mesenchymal marker expression, and STAT3 gene target expression. In addition, CyTOF enabled us to observe a potential cancer stem cell population that may play a role in drug resistance. Our findings, combined with impressive studies from other labs (34–36, 44, 45), demonstrate the power of CyTOF as a method to profile drug-resistant tumors. Through the generation of an antibody panel containing signaling proteins, EMT, and stem cell markers, drug-resistant tumors can be profiled efficiently, providing an initial snapshot of signaling pathway activation. Subsequent validation using immunoblots can then guide application of combination therapies in the clinic.

Targeted therapies are a promising option for cancer treatments, offering the ability to specifically target cancer cells through inhibition of a signaling molecule responsible for oncogenesis. The major drawback of this type of treatment is the development of drug resistance, which can occur through activation of a bypass pathway, or by mutation of the targeted protein (47, 48). The gatekeeper mutation is a devastating mechanism of the latter form of resistance in established kinase targets such as BCR-ABL, EGFR, PDGFR, and Src (23). Thus, identifying corresponding gatekeeper mutations in novel targets allows an understanding of their consequences before they reach the clinic. FGFRs are a relatively recent family of proteins to be addressed through targeted therapy, with multiple inhibitors in clinical trials for the treatment of cancers such as NSCLC and breast cancer (20, 49). In addition, the V561M mutation of FGFR1 has been observed in humans (50) and requires only a single-nucleotide substitution to occur. FGFR gatekeeper mutations have been identified in the literature through acquired resistance experiments using multiple TKIs (26, 51), demonstrating the importance of further characterizing this mutation.

AZD4547 is currently in clinical trials for NSCLC (52), and our lab recently found that this inhibitor is able to maintain nanomolar binding affinity for V561M FGFR1 in in vitro–binding experiments (22). We determined the IC₅₀ of AZD4547 in L6 and H1581 cells expressing WT or V561M FGFR1 and found that cells expressing V561M FGFR1 are highly resistant to AZD4547, demonstrating that an alternative mechanism is responsible for driving V561M resistance to AZD4547 in addition to the modest decrease in binding affinity. We performed an in-depth analysis of signaling downstream of WT and V561M FGFR1 and identified STAT3 as the driver of AZD4547 resistance through shRNA knockdown. Although STAT3 has been a notoriously undruggable target in past years, recent advances using antisense oligonucleotides (ASO) have been successful in attenuating cancers driven by STAT3 (53). AZD9150 is an ASO with nanomolar potency for STAT3 that is currently in phase I and II clinical trials for numerous cancer types, including NSCLC, lymphoma, and neuroblastoma (53, 54).

Another vitally important characteristic we identified in cells expressing V561M FGFR1 is an enhanced EMT relative to cells expressing WT FGFR1. The increased proliferation, migration, invasion, and transformation observed in L6-V561M and H1581-V561M suggest that tumors that have acquired this resistance mutation will be more likely to metastasize to surrounding tissues (19). This demonstrates a major pitfall of utilizing single targeted therapies in the clinic; the mechanism of drug resistance has a secondary effect of increasing the metastatic potential of the tumor. EMT has also been identified as a mechanism of drug resistance in EGFR T790M–driven cancers (28, 29, 55), suggesting that this may be a common phenomenon among RTK gatekeeper mutations.

We confirmed that the V561M mutation imparts a growth advantage to both L6 and H1581 cells relative to WT FGFR1, leading to the question of whether V561M could be a driver of tumorigenesis independently of FGFR1 amplification in a clinical setting. Because FGFR family proteins are more recent cancer targets, inhibitors are still progressing through clinical trials, and there are not yet any FDA-approved FGFR-specific inhibitors. We postulate that the V561M likely occurs in cancer patients but has not yet been reported, and we turn to the long-established target EGFR to speculate on what may occur with FGFR1 V561M as inhibitors become more commonly used in the clinic. A study by Bemanian and colleagues has demonstrated that the EGFR T790M mutation is present at low abundance in early breast cancer patients prior to treatment with kinase inhibitors (56). Furthermore, Bell and colleagues have identified EGFR T790M as a germline mutation that increases inherited susceptibility to lung cancer in a European family (57). In addition, the EGFR T790M mutation in parallel with the L858R-activating mutation has been shown to drive more aggressive tumors in mice relative to those expressing the T790M mutation alone (58). This indicates that the activating effects of gatekeeper mutations are context-dependent, and that the V561M mutation may only incur a significant growth advantage when it occurs in addition to FGFR1 amplification. The example of the EGFR T790M mutation demonstrates that the gatekeeper mutation can be present at a low abundance independently of kinase inhibition, and become more tumorigenic when it occurs in the context of an additional activating event. Similarly to the EGFR T790M mutation, the V561M FGFR1 mutation may be present at low levels that are difficult to detect, and if patients are treated with inhibitors that are ineffective against V561M FGFR1, this may unintentionally select for more aggressive tumor cells. In addition, the FGFR4 V550L and V550E gatekeeper mutations have been observed in rhabdomyosarcoma tumors (59), and the FGFR2 V564F gatekeeper mutation has arisen as a mechanism of resistance in cholangiocarcinoma patients expressing FGFR2 fusion proteins treated with the FGFR-specific inhibitor BGJ398 in the clinic (60). Taken together, these studies demonstrate a precedent for FGFR gatekeeper mutations occurring clinically, both before and after treatment with targeted therapies.

RTKs signal through many pathways, and drug resistance can occur through activation of any of these signaling partners. We identified STAT3 activation downstream of V561M FGFR1 through immunoblot experiments and recognized the potential of the novel technique CyTOF to extend the utility of this type of analysis to a higher throughput method that can be completed at a timescale applicable to clinical studies. As a proof of concept, we confirmed the upregulation of STAT3 gene target and mesenchymal marker expression in H1581-V561M cells relative to WT cells using CyTOF. We also analyzed signaling pathway activation downstream of FGFR1 in H1581-WT and H1581-V561M cells and observed a modest increase in STAT3 phosphorylation in H1581-V561M cells. However, we also observed similarly increased levels of FRS2, Akt, and ERK phosphorylation. We hypothesize that the limitations associated with phospho-specific antibodies, including low signal strength and decreased specificity, mask the differences between STAT3 phosphorylation in H1581-WT and H1581-V561M cells. Our data suggest that CyTOF is a valuable technique to identify subpopulations of cells and to obtain an overall idea of pathway activation downstream of mutant receptors, but that parallel immunoblot analysis is still imperative to confirm CyTOF data. This study shows that CyTOF analysis provides an invaluable set of data that can identify signaling pathway activation, epithelial or mesenchymal characteristics of cells, and even isolate small populations of cancer stem cells that are undetectable with immunoblot approaches.

In this study, we have demonstrated that cells expressing the V561M drug resistance mutation of FGFR1 display increased mesenchymal characteristics and depend on STAT3 activity for survival in the presence of AZD4547. Our findings are relevant for clinicians treating NSCLC patients with FGFR1 amplification; although previous data suggested that AZD4547 would be effective against V561M FGFR1 (22), this study confirms the importance of using second-generation FGFR inhibitors that are effective toward the gatekeeper mutant, such as the covalent inhibitors FIIN-1 and 2 (61), or combination therapies including drugs targeting STAT3 such as AZD9150 (53). In addition, the enhanced EMT, including increased invasion, observed in cells expressing V561M FGFR1 reveals the consequences of acquiring this mutation on cancer metastasis. We suggest that patients be screened for FGFR1 mutational status prior to treatment with FGFR-targeted inhibitors, and when possible, an inhibitor that maintains efficacy against V561M be utilized as part of a combination therapy. We demonstrate the strength of combining immunoblotting and CyTOF analysis to obtain a thorough understanding of signaling pathway activation in drug-resistant cell lines and identify small cellular populations, and affirm CyTOF as a promising technology for rapid cellular characterization in a clinical setting. Our data also suggest that STAT3 is a promising option for targeting FGFR1-driven cancers that have acquired the V561M drug resistance mutation.

No potential conflicts of interest were disclosed.

Conception and design: M.R. Ryan, K.S Anderson

Development of methodology: M.R. Ryan, C.D. Sohl, B. Luo

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): M.R. Ryan

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): M.R. Ryan, K.S Anderson

Writing, review, and/or revision of the manuscript: M.R. Ryan, C.D. Sohl, K.S Anderson

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): B. Luo

The authors thank Dr. Joseph Schlessinger for kindly providing L6 parental cell lines. The authors also thank Drs. Roman K. Thomas, Florian Malchers, Graziella Bosco, and Ilona Dahmen for generously providing H1581-WT and H1581-V561M cell lines. We appreciate the help of Dr. Ruth Montgomery and Shelly Ren for access to the Yale CyTOF Core Facility.

This research was supported by NIH Grant NCI F31 CA216915-02 to M.R. Ryan.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.