TAGLN Is Downregulated by TRAF6-Mediated Proteasomal Degradation in Prostate Cancer Cells

Transgelin (TAGLN, also known as SM22) was first identified as an abundant protein in smooth muscle cells. It is an actin binding protein, and plays important roles in actin cytoskeleton stabilization and gelation. Therefore, it mainly participates in actin skeleton remodeling processes such as cell proliferation, differentiation, migration, invasion, and matrix remodeling (1, 2). Deregulation of transgelin was indicated in the development of several types of cancers, including colorectal cancer, breast cancers, lung cancers, and prostate cancers (3–7). Depletion of TAGLN increases actin dynamics and enhances tumorigenic phenotypes of cell (2). Therefore, Transgelin was commonly described as a tumor suppressor (8). It has been reported that TAGLN could prevent the migration of prostate cancer cells (9) by suppressing MMP9 (10). Sayar and colleagues found that TAGLN expression was significantly and frequently downregulated via promoter DNA hypermethylation in breast cancer cells (11), but more studies are needed to further explore the mechanism which regulates TAGLN at protein level during cancer progression.

Prostate cancer is the second most common cancer in men (12). Previous studies showed that TAGLN is downregulated in prostate cancer tissues (13–15), and was downregulated in prostate cancer cell lines except DU145 (6). But how TAGLN is regulated in prostate cancer, and what is the biological function of TAGLN in prostate cancer have not been elucidated extensively.

Dong and colleagues found that TRAF6 mediated K63 linked ubiquitination of TAGLN on K21 residue by in vivo assays, and K63 linked ubiquitination of TAGLN mediated its cellular localization (16). TRAF6 was showed to interact with TAGLN by in vitro pull-down assay (16). But whether TRAF6 serves as an E3 ubiquitin ligase to regulate the degradation of TAGLN and what is the E2 for TAGLN ubiquitination remain unclear.

In this study, we confirmed that TAGLN is downregulated in prostate cancer tissues, and found that the degradation of TAGLN is proteasome dependent. We then investigated the ubiquitination mechanism of TAGLN, and found that TRAF6 coupled with multiple E2s, such as E2A, to catalyze ubiquitination of TAGLN at K89 or K108. Mutating K89 and K108 rendered TAGLN resistant to TRAF6-mediated degradation. Knocking down of TRAF6 significantly increased the protein level of TAGLN, suggesting TRAF6-mediated TAGLN ubiquitination is important for TAGLN degradation. We further explored the biological function of TAGLN in prostate cancer, and found that knocking down TAGLN promoted proliferation and suppressed the migration of prostate cells, and activated NF-KB and Myc signaling pathways. Thus, our study provided new insights into the mechanisms of downregulation of TAGLN in prostate cancer.

All the prostate cancer tissues were collected from 6 patients at Changhai Hospital, Shanghai, China, following the standard operating procedures of the hospital Ethics Committee. The patient information was removed and unavailable to investigators to protect the patients' privacy. BPH-1 cells, DU145 cells, PC-3 cells, LNCaP cells, and C4–2 cells were obtained from Shanghai Life Academy of Sciences Cell Library (Shanghai, China). Cell lines were authenticated using high resolution small tandem repeats (STR) profiling. They were routinely tested for mycoplasma and confirmed free of contamination (GMyc-PCR Mycoplasma Test Kit, YEASEN). Cells were cultured in RPMI1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37°C with 5% CO₂. Cells were grown for 20 passages and then replaced with fresh stocks.

The band of ubiquitinated TAGLN on SDS-PAGE gel, which was generated by in vitro ubiquitination assay, was cut off and applied for in-gel digestion, and the digested peptides were used for tandem mass spectrometry analysis (MS-MS) in Orbitrap Fusion Tribrid (Thermo Fisher Scientific).

Cell pellets were lysed with RIPA buffer [50 mmol/L Tris-HCl (pH 7.4), 1% TritonX-100, 1 mmol/L EDTA, 150 mmol/L NaCl, 0.1% SDS, 2 mmol/L sodium pyrophosphate, 50 mmol/L NaF, and cocktail protease inhibitor] on ice. The prostate tissues were homogenized and then lysed in RIPA buffer on ice. All lysates were centrifuged at 12,000 rpm for 15 minutes at 4°C. Supernatant was used for protein quantification and SDS-PAGE analysis. Separated proteins were transferred from the gels to polyvinylidene fluoride (PVDF) membranes by wet electro transfer. The membranes were blocked by 5% milk in PBS and blot using corresponding antibodies. Anti-SM22α/TAGLN (ab14106) and PI3K (ab191606) antibody is purchased from Abcam. anti-TRAF6 antibody is from Proteintech (12809-AP). FLAG (#8146), GAPDH (#2118), p-IKK (#2697), IKK (#2682), IκBα (#9242), p-IκBα (#9246), AR (#68492), Cyclin B1 (#4138), and C-Myc (#9402) antibody is purchased from Cell Signaling Technology. IL6 (sc-53865) and His (sc-8036) antibody is purchased from Santa Cruz Biotechnology. For immunofluorescence experiment, the secondary antibody Goat Anti-Mouse IgG (H+L) Alexa Fluor-594 (AB0152) and Goat Anti-Rabbit IgG (H+L) Alexa Fluor 488 (AB0141) were purchase from Abways.

For immunoprecipitation, purified GST or His tagged proteins for reaction were quantified by BCA Protein Assay Kit (Thermo Fisher Scientific, 23225). In a 50 μL reaction system, 0.5 μg E1, 2 μg E2, 3 μg E3, and 4 μg ubiquitin were added into the reaction, and then 0.1 μmol/L ATP to start reaction. The 10X reaction buffer contains 200 mmol/L Tris, 100 mmol/L MgCl2 (pH 7.4). For substrate ubiquitination assay, 5 μg TAGLN was added to the reaction system. The reaction system is incubated at 37°C for 15 minutes, then stopped reaction by adding SDS loading buffer with DTT.

The pLKO.1 vector was used for shRNA construction. TAGLN shRNA targeting sequence was 5′-GCATGTCATTGGCCTTCAGAT-3′. The TRAF6 shRNA targeting sequence was 5′- AGCGCTGTGCAAACTATATAT-3′. The scramble hairpin contains the 21 mer 5′- CAACAAGATGAAGAGCACCAA-3′ was used as control. Recombinant Lentiviruses were generated by homologous recombination in HEK293 cells. The qPCR primers for TAGLN: forward: GGCAGCAGTGCAGAGGAC, reverse: TTATGATCCTGCGCTTTCTT. TRAF6: forward: TTGCCATGAAAAGATGCAGAGG, reverse: AGCCTGGGCCAACATTCTC.

Prostate tissues were lysed with Nonidet P40 buffer [50 mmol/L Tris-HCl (pH 7.4), 1% Nonidet P40, 10 mmol/L EDTA, 150 mmol/L NaCl, 50 mmol/L NaF, and cocktail protease inhibitor]. Primary antibody was incubated with protein A/G agarose for 2 hours. Then samples were added and incubated overnight at 4°C. After immunoprecipitation, the samples were washed with Nonidet P40 buffer three times. The immunoprecipitates were subjected to immunoblotting using specific primary antibodies and goat anti-mouse/rabbit IgG secondary antibody (HRP).

GST-tagged TAGLN and His-tagged IκBα was mixed in PBS containing 0.5% Triton X-100, then added glutathione Sepharose 4B, and incubated for 30 minutes at 4°C. After washing three times with PBS, proteins were eluted with 10 mmol/L Glutathione. The eluates were subjected to SDS-PAGE, and proteins were detected by immunoblot.

For cell proliferation assay, 2,000 cells were seeded into to 96-well microplates. Then the cell numbers were evaluated by AlamarBlue assay.

For transwell migration assay, 1 × 10⁵ cells were seeded in the transwell chamber with 200 μL warm cell culture media without FBS (FCS). A total of 500 μL cell culture media with FBS was placed below the transwell chamber. After 2 to 3 day's incubation, transwell chamber were gently submerged in PBS several times to remove unattached cells. The noninvading cells are removed from the upper surface of the membrane by scrubbing with a cotton tipped swab. Then fixed by 10% polyformaldehyde (PFA) for 10 minutes. After washed with PBS, cells were stained by Crystal Violet Staining Solution for 20 minutes, then washed again with PBS and used for imaging.

RNA from shCtrl and shTAGLN BPH-1 cells were extracted using the RNA isolater Total RNA Extraction Reagent (Vazyme, R401–01) according to the manufacturer's protocol. After quantification and qualification, a total amount of 3 μg RNA per sample was used as input material for the RNA sample preparations. Sequencing libraries were generated using NEBNext UltraTM RNA Library Prep Kit for Illumina (NEB, E7775), following manufacturer's recommendations and index codes were added to attribute sequences to each sample. The library preparations were sequenced on Illumina Novaseq 6000 and 125 bp-150 bp paired-end reads were generated. Raw RNA-sequencing data from this study are available at the Sequence Read Archive (SRA), BioProject ID: PRJNA715250 (https://www.ncbi.nlm.nih.gov/sra/PRJNA715250).

Raw data of fastq format were first processed through in-house perl scripts. In this step, clean data (clean reads) were obtained by removing reads containing adapter, reads containing ploy-N, and low-quality reads from raw data. Paired-end clean reads were aligned to the reference genome using Hisat2 v2.0.5. featureCounts v1.5.0-p3 was used to count the reads numbers mapped to each gene, and then fragments per kilobase of transcript sequence per millions base pairs sequenced (FPKM) of each gene was calculated on the basis of the length of the gene and reads count mapped to this gene. Differential expression analysis was performed using the DESeq2 R package. The P values were adjusted using the Benjamini & Hochberg method. Corrected P value of 0.05 and absolute fold-change of 2 were set as the threshold for significantly differential expression.

Previous studies have investigated the proteome profiles of prostate cancer using cell lines or patient tumor tissues (13, 17–22). To understand the molecular mechanisms of prostate cancer at protein level, we performed biological pathway analysis on published proteomic data by Iglesias-Gato and colleagues (13), which identified the highest numbers of proteins (9,623 proteins) compared with other proteome study in prostate cancer in recent years (14, 22). We found that many of the differentially expressed proteins belong to signaling pathways involved in actin filament and cytoskeleton organization, muscle contraction, and cell morphogenesis (Fig. 1A).

TAGLN is an actin binding protein, which is involved in calcium-independent smooth muscle contraction, and is very important for cell motility. It has been reported that the expression level of TAGLN was downregulated in prostate cancer (13–15, 22), and was negatively associated with the progression of prostate cancer (6), indicating that TAGLN may participates in prostate cancer progression. However, the function of TAGLN in prostate cancer progression remains unclear.

To investigate the function of TAGLN in prostate cancer, we first analyzed the mRNA expression level of TAGLN from The Cancer Genome Atlas (TCGA) database, and found that mRNA level of TAGLN was indeed significantly downregulated in prostate cancer tissues (Fig. 1B). Data from cBioPortal (https://www.cbioportal.org/) showed that amplification or deep deletion of TAGLN were observed in prostate cancer patients (Fig. 1C). Patients without alterations of TAGLN showed higher survival rate than patients with TAGLN deep deletion (Fig. 1D; refs. 23, 24). We analyzed the gene expression level of TAGLN in different prostate cancers types using TCGA database, and found that TAGLN deletion was mostly enriched in prostate adenocarcinoma group, whereas TAGLN amplification was mostly observed in castration-resistant or neuroendocrine prostate cancer (Supplementary Fig. S1), suggesting TAGLN downregulation primary plays an important role in the early stage of prostate cancer development.

To validate this, we collected tumor tissues and neighboring normal tissues from localized patients with prostate cancer and examined the expression level of TAGLN in these tissues. We confirmed that the expression of TAGLN was decreased both in mRNA level and in protein level in tumor tissues when compared with the neighboring normal tissue (Fig. 1E and F). We then tested the expression level of TAGLN in different prostate cancer cell lines. We found that the expression of TAGLN was significantly decreased in LNCaP and C4–2 cell lines (AR dependent), but almost no significant changes were observed in DU145 and PC3 cell lines (AR independent) when compared with normal cell line BPH-1 (Fig. 1G). But the mRNA level of TAGLN in these cells were not consistent with their protein expression levels, indicating posttranslational modifications of TAGLN in these cells (Fig. 1H).

Proteins are degraded mainly through autophagy or ubiquitin-dependent proteasome system. To explore the degradation mechanisms for TAGLN, we treated LNCaP cells with MG132 or chloroquine (CHL), then examined the protein level of TAGLN. We found that TAGLN was accumulated when treated with proteasome inhibitor MG132, but no significant changes were observed when treated with CHL (Fig. 2A and B), suggesting that TAGLN was mainly degraded by ubiquitin-dependent proteasome system.

Previous study reported that E3 ligaseTRAF6 mediates K63 linked ubiquitination of TAGLN on K21 residue, which mediated G6PD membrane translocation (16). We then examined the protein level of TRAF6 and found that the TRAF6 was upregulated in prostate cancer tissues (Fig. 2C). Knocking down TRAF6 in LNCaP cell line resulted in upregulation of TAGLN (Fig. 2D), but the mRNA level of TAGLN did not change significantly (Fig. 2E), suggesting that TRAF6 may play a role in TAGLN degradation.

TRAF6 and TAGLN colocalized in the cytosol (Supplementary Fig. S2). We then overexpressed TRAF6 WT or RING domain mutant TRAF6-C70A (which is defective in ubiquitination activity) in BPH1, and examined the protein level of TAGLN. We found that overexpression of TRAF6 led to degradation of TAGLN, whereas overexpression of RING domain mutant did not affect the expression level of TAGLN, suggesting that the degradation of TAGLN is dependent on the ubiquitination activity of TRAF6 (Fig. 2F). TRAF6 mainly catalyzes K63 linked poly-ubiquitination on substrate proteins, whereas protein degradation is usually through a K48 linked poly-ubiquitination (25). Therefore, the mechanisms of how TRAF6 mediated the ubiquitination and degradation of TAGLN needs further investigation.

In the protein ubiquitination process, ubiquitin conjugating enzyme E2 couples with different ubiquitin ligases E3, and transfer the charged ubiquitin from E2 to a specific substrate. In this process, E3 ligase controls the selectivity for substrate proteins. TRAF6 is reported to be an E3 ligase for TAGLN, which catalyzes K63 linked ubiquitination (16), however no direct evidence for the ubiquitination of TAGLN by TRAF6 was available. The E2 for TAGLN ubiquitination also remains unknown. We screened 24 E2–E3 pairs by ubiquitination assay in vitro, and found that about half of the E2 tested (including E2A, E2D1, E2D2, E2D3, E2D4, E2E2, E2E3, E2J2, E2R1, and E2S) can couple with TRAF6 to catalyze ubiquitin chain formation (Fig. 3A). Furthermore, we tested which of these E2s can couple with TRAF6 to catalyze ubiquitination of TAGLN. In our in vitro ubiquitination assay system, we observed that these E2–E3 pairs mainly catalyzed mono-ubiquitin of TAGLN, no significant, if any, poly-ubiquitination of TAGLN was observed (Fig. 3B). E2Q2 and E2S cannot catalyze ubiquitination of TAGLN in our assay (Fig. 3B).

We then applied mass spectrometry to identify the ubiquitination site on TAGLN catalyzed by E2A and TRAF6. The in vitro ubiquitination reaction product was first separated by SDS-PAGE, then the corresponding mono ubiquitination band of TAGLN was cut off for MS analysis. K89 and K108 residues of TAGLN were identified that contained di-glycine residues (Fig. 3C), suggesting that the E2A–TRAF6 pair catalyzed mono ubiquitination of TAGLN on either K89 or K108. To validate this, we expressed and purified K89R and/or K108R TAGLN mutant protein, and found that that single mutation (K89R or K108R) of TAGLN did not abolish mono-ubiquitination of TAGLN, but K89R/K108R double mutant of TAGLN completely abolished this ubiquitination (Fig. 3D). We then investigated whether the ubiquitination of TAGLN on K89/K108 is important for its proteasomal degradation mediated by TRAF6. We overexpressed TRAF6 together with WT TAGLN or K89R/K108R TAGLN mutant in HEK293 cells, and found that WT TAGLN was degraded when co-expressed with TRAF6; however, TAGLN K89R/K108R double mutation is resistant to degradation (Fig. 3E), suggesting that ubiquitination of TAGLN on K89/108 residues is important for TRAF6-mediated proteasomal degradation. We also overexpressed WT TAGLN or K89R/K108R TAGLN mutant in TRAF6 knockdown C4–2 cell, no significant degradation of TAGLN was observed in either conditions (Fig. 3F), which suggests that TRAF6 is important in mediating TAGLN degradation.

As an actin binding protein, TAGLN participates in processes related with actin skeleton remodeling, such as cell morphogenesis, proliferation, differentiation, and migration. However, the detailed function of TAGLN in prostate cancer remains unclear. When we cultured prostate cancer cells, we observed that LNCaP and C4–2 cells attached to the culture dish loosely and were easy to detach, whereas the BPH-1, DU145, and PC3 cells attached on dish much more tightly, which is in line with the protein expression level of TAGLN (Fig. 1G), suggesting that TAGLN is important for cell adhesion. To further investigate the function of TAGLN in prostate cancer, we knocked down TAGLN by shRNA in BPH-1 cells (TAGLN high expression cell line). We found that the cell proliferation rate was increased when TAGLN was knocked down in BPH-1 cells (Fig. 4A). However, overexpression of TAGLN in LNCaP cells (TAGLN low expression cell line) had no significant effect on the proliferation rate (Fig. 4B). We then examined the effect of TAGLN on cell migration by transwell assay. Knocking down TAGLN decreased cell migration ability in BPH-1 cells (Fig. 4C), whereas overexpression of TAGLN significantly enhanced cell migration activity in LNCaP cells (Fig. 4D). These data suggested that TAGLN is important for cell migration in prostate cells.

To further explore the biological function of TAGLN in prostate cancer, we performed mRNA-sequencing on control BPH-1 cells and TAGLN knocked down BPH-1 cell (Fig. 5A). The expression level of 2831 genes were significantly altered (more than 2-fold change) when TAGLN was knocked down in BPH-1 cells (Supplementary Table S1). Gene ontology analysis of differentially expressed mRNA revealed that these genes were involved in cellular processes involved in DNA metabolic, organelle envelop, cellular protein catabolic, generation of neurons or ion channel activity (Supplementary Fig. S3A). KEGG pathway analysis showed that these genes function in cell adhesion, extracellular matrix organization, systemic lupus erythematosus, sensory organ morphogenesis, generation of neurons, and neuron system (Supplementary Fig. S3B). A pathway enrichment analysis revealed that Myc signaling pathway was overrepresented in the up regulated genes in shTAGLN BPH-1 cells (Fig. 5B and C; Supplementary Table S2). We also performed Gene Set Enrichment Analysis (GSEA; refs. 26, 27) analysis on the mRNA sequencing data of 66 prostate cancer patient tumor and paired normal tissue (28), and found that Myc target genes also have the highest enrichment score (ES), similar to that of shTAGLN BPH-1 cells (Supplementary Table S3). c-Myc belongs to the Myc family, which is a well-known transcription factor and a cancer driver oncogene in many human cancers. We examined the expression level of c-Myc in different prostate cancer cell lines and found that c-Myc expressed higher in prostate cancer cells especially in C4–2, which has low TAGLN expression level (Figs. 1G and 5D). Knocking down TAGLN significantly increased c-Myc expression in BPH-1 cells (Fig. 5E). Collectively, these data suggested that TAGLN could affect the progression of prostate cancer possibly through regulating Myc signal pathway.

To further dissect the interplay between TAGLN and Myc signal pathway, we inhibited the c-Myc signal using the inhibitor 10058-F4 (29) in TAGLN knocked-down BPH1 cells. We found that the inhibition of c-Myc can reverse the phenotype caused by TAGLN downregulation: inhibition of c-Myc in TAGLN knocked down BPH1 cells decreased the cell proliferation and cell migration (Fig. 5F–H).

It was reported that TAGLN could interact with IκBα and stabilize IκBα in smooth muscle cells (30, 31). So, we then investigated whether TAGLN can regulate the NF-κB signaling in prostate cancer. As expected, we observed significant downregulation of IKK and IκBα proteins in TAGLN knocked down BPH1 cells, whereas the phosphorylation state of these two protein are upregulated obviously (Fig. 6A). However, the AR and PI3K signal pathway did not show significant changes in shTAGLN cells (Fig. 6B). To investigate the interplay between TAGLN and NF-κB signaling pathway, we examined the interaction between TAGLN with IκBα in prostate cancer. We found that TAGLN directly interacted with IκBα as TAGLN or IκBα could be immonoprecipitated by each other (Fig. 6C). To further investigate the IκBα binding domain for TAGLN, we generated two IκBα fragments, N-terminal fragment containing residue 1–67, and C-terminal fragment containing residue 70–317 (the binding motif for p65). When we pulled down GST-TAGLN by GST Agarose, we found that full length and C-terminal fragment of IκBα eluted together with TAGLN, but the N terminal fragment (residue 1–69) of IκBα did not (Fig. 6D–F), indicating that TAGLN interacts with C-terminal part of IκBα, and this interaction may protect IκBα from phosphorylation and degradation. We also stimulated BPH1 cells with TNFα for different time. The expression level of TRAF6 was upregulated upon stimulation, but no significant changes were observed in the expression of TAGLN (Fig. 6G), suggesting that the ubiquitination and degradation of TAGLN by TRAF6 was not a fast response process. Furthermore, stimulation of NF-κB signaling by TNFα did not affect the interplay between TAGLN and TRAF6 (Figs. 2D and 6G). These data collectively demonstrated that TAGLN has crosstalk with NF-KB signal in prostate cancer.

As an actin-associated protein, TAGLN plays important roles in cell migration and matrix remodeling (1, 2). Downregulation of TAGLN has been indicated in different types of cancer including prostate cancer, therefore, it is also considered as a tumor suppressor. In this study, we observed that TAGLN was downregulated in indolent and AR dependent cell lines (LNCaP and C4–2), but not in AR independent and aggressive prostate cancer cell lines (PC3 and DU145; ref. 32). We also confirmed that TAGLN was downregulated in tumor tissues from localized prostate cancer both in mRNA level and in protein level. However, the biological function of TAGLN in prostate cancer and how TAGLN is regulated in the development of prostate cancer remain unclear.

Proteins are usually degraded through proteasome or autophagy-lysosome systems. Previous report showed that TRAF6 catalyzed K63 linked ubiquitination of TAGLN on K21 (16). Here we investigated the degradation mechanism for TAGLN in prostate cancer. We found that both the protein level and mRNA level of TAGLN were down regulated in prostate cancer cells (Fig. 1E and F). We also observed that expression level of the E3 ligase TRAF6 was negatively correlated with TAGLN in prostate cancer tissues. Knocking down TRAF6 resulted in accumulation of TAGLN (Fig. 2C and D), suggesting that TRAF6 may be involved in TAGLN degradation. After screening a series of E2s by in vitro ubiquitination assay, we identified several E2s that could couple with TRAF6 to catalyze ubiquitination reaction. However, the E2s tested here, coupled with TRAF6, mainly catalyzed mono-ubiquitination of TAGLN (Fig. 3B). Furthermore, we identified the mono-ubiquitination site of TAGLN to be on K89 or K108 residues by in vitro ubiquitination assay and subsequent mass spectrometry analysis (Fig. 3C). TALGN with K89R/K108R double mutation failed to get ubiquitinated by E2A/TRAF6 pair (Fig. 3D), validating the mono-ubiquitination sites of TAGLN by E2A/TRAF6 pair. Although proteins targeted for proteasome degradation were mainly tagged with K48 linked polyubiquitin chain, proteins tagged with monoubiquitin or K63-linked polyubiquitin chain could also be targeted for proteasomal degradation (25). Therefore, mono-ubiquitination of TAGLN by TRAF6 could be a potential mechanism for its proteasomal degradation. However, other E2-E3 pairs could also be responsible for the ubiquitination and degradation of TAGLN, and a broader screen would be needed to clarify this. To further validate the finding that TRAF6/E2A-mediated mono-ubiquitination is required for proteosome degradation of TAGLN, we overexpressed TAGLN WT or K89R/K108R mutant in TRAF6-plus and minus cells, and found that TAGLN K89R/K108R become resistant to degradation, supporting that TRAF6 mediated ubiquitination of TAGLN is important for TAGLN degradation.

TAGLN is considered as a tumor suppressor in many cancers (4, 6, 9), but the underlying mechanisms still remains unclear. To further investigate the function mechanisms of TAGLN in prostate cancer, we performed mRNA sequencing in TAGLN knocked down BPH-1 cells. We found that Myc signaling pathway was significantly upregulated, whereas PI3K or AR signaling pathway were not significantly altered in shTAGLN cells (Fig. 5C), suggesting TAGLN could function through repressing Myc signaling. Deregulated activation of NF-κB was indicated in many autoimmune diseases and cancers (33, 34), and it was reported that TAGLN could serve as a suppressor for NF-κB signaling pathway (31). In our study, we found knocking down TAGLN activated NF-κB signaling (Fig. 6A). We also showed that TAGLN directly interacted with IκBα at the C-terminus, suggesting TAGLN could also interplay with NF-κB signaling pathway to regulate the progression of prostate cancer.

In summary, our study provided new insights on the mechanisms of how TAGLN is degraded in prostate cancer cell, and identified novo sites in TAGLN for its ubiquitination and degradation. Moreover, our study revealed that TAGLN could function through regulating Myc and NF-κB signaling pathway activities, thus participates in the pathogenesis of prostate cancer.

No disclosures were reported.

F. Wen: Conceptualization, resources, data curation, software, supervision, funding acquisition, validation, investigation, visualization, methodology, writing–original draft, project administration, writing–review and editing. X. Sun: Resources, data curation, software, validation, investigation, visualization, methodology. C. Sun: Data curation, formal analysis, validation, investigation, methodology. Z. Dong: Data curation, formal analysis, validation, methodology. G. Jia: Data curation, software. W. Bao: Data curation, validation. H. Yu: Formal analysis, validation. C. Yang: Supervision, funding acquisition, investigation, methodology, writing–original draft, project administration, writing–review and editing.

This study has been supported by grants from the National Natural Science Foundation of China (Nos. 81602604 and 81772695).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.