Purpose: Previous studies have shown a high rate of allelic loss in esophageal squamous cell carcinoma (ESCC) in the vicinity of the BRCA2 gene. We aimed to assess whether the tumor suppressor gene BRCA2 was the inactivation target for allelic loss observed on chromosome 13q in ESCC.

Experimental Design: We examined the entire coding sequence of the BRCA2 gene for mutations using single-strand conformation polymorphism analysis and DNA sequencing in 56 ESCC patients from Shanxi, China.

Results: Eight mutations were identified in 5 patients (9%), including 3 with germ-line mutations and 2 with only somatic mutations. However, all but 1 of the mutations were missense or silent changes and of unknown significance. Evidence for potential biallelic inactivation was seen in only 4 (7%) cases.

Conclusions: BRCA2 mutations occur in ESCC but are infrequent and of unknown consequence. The putative target tumor suppressor gene corresponding to the high rate of chromosome 13q allelic loss remains unknown.

The BRCA2 gene is located on chromosome 13q (1). Alterations in the BRCA2 gene result in increased risk of breast cancer in both women and men, and a moderately increased risk for a variety of other cancers, including carcinomas of the ovary, pancreas, prostate, colon, and liver (2, 3, 4, 5, 6, 7). Thus far only infrequent alterations in BRCA2 have been reported in ESCC (8).3 Not surprisingly, few studies have reported mutation frequencies for all of the coding exons of BRCA2 because of its large size. BRCA2 is thought to be involved in double-strand DNA break repair (9, 10). Several studies have demonstrated that BRCA2 and BRCA1 bind to Rad51, a protein involved in maintaining the integrity of the genome. Rad51 also physically associates with the TP53 tumor suppressor protein. Physical and functional interactions of BRCA2 with these key components of cell cycle control and DNA repair pathways suggest that it likely participates with them in some way to maintain genomic integrity (11). This association is additionally supported by the fact that somatic mutations of TP53 are commonly seen with germ-line mutations of BRCA1 and BRCA2 in breast/ovarian cancer (12, 13).

Esophageal cancer is a very common disease in many areas of China, especially in Shanxi Province (14). In previous studies in Shanxi Province, China, we found frequent LOH on chromosome 13 (15, 16), including chromosome 13q12 where BRCA2 is located (15, 16, 17). In the present study we characterized genetic alterations in BRCA2 in ESCC patients by screening the entire BRCA2 gene for mutations using SSCP analysis and DNA sequencing in 56 ESCC patients examined previously for both TP53 mutations and LOH on chromosome 13q (18, 19).

Patient Selection.

Patients presenting in 1995 and 1996 to the Shanxi Cancer Hospital in Taiyuan, Shanxi Province, People’s Republic of China, who were diagnosed with ESCC and considered candidates for curative surgical resection, were identified and recruited to participate in this study. The study was approved by the Institutional Review Boards of the Shanxi Cancer Hospital and the United States National Cancer Institute. A total of 56 patients with ESCC were selected who had a histological diagnosis of ESCC confirmed by pathologists at both the Shanxi Cancer Hospital and the National Cancer Institute. None of the patients had prior therapy, and Shanxi was the ancestral home for all of the patients.

After obtaining informed consent, patients were interviewed to obtain information on demographic and cancer lifestyle risk factors, and a detailed family history of cancer. A total of 56 ESCC patients, including 34 males and 22 females, were evaluated. Details on these ESCC patients have been described previously (19). All of the patients were previously evaluated for allelic loss on 13q, including D13S260 and D13S267, which flank BRCA2 (15, 16, 17) and mutations in TP53 (exons 4 to 9; Ref. 18). The frequencies of LOH on D13S260 and D13S267 were 57% (17 of 30 informative cases) and 83% (33 of 40 informative cases), respectively (17). Mutations in TP53 were found in 77%, and intragenic allelic loss was observed in 76% (18).

Biological Specimen Collection and Processing.

Venous blood (10 ml) was taken from each patient before surgery, and genomic DNA was extracted and purified. Tumor tissue obtained during surgery was fixed in ethanol and embedded in paraffin.

Laser Microdissection and Extraction of DNA.

Tumor cells were microdissected under light microscopic visualization using methods described previously (20).

PCR and SSCP Analysis.

Mutations in all 26 coding exons of the BRCA2 gene were screened by PCR-SSCP. The 57 pairs of PCR primers used to cover all of the intron/exon boundaries are listed in Table 1. DNA extracted from tumor cells was microdissected from the resection specimen, and genomic DNA extracted from venous blood was used for each patient. PCR reactions and SSCP analyses were conducted using methods described previously (19) except the annealing temperature was adjusted to 55–60°C.

DNA Sequencing.

DNA sequencing was performed using methods described previously (19). All of the mutations were confirmed by repeating the procedures outlined above. Subcloning was performed in 1 case (SHE247) with the TOPO Cloning kit (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.

Statistical Analysis.

All of the statistical analyses were performed using Statistical Analysis Systems (SAS; SAS Corp., Cary, NC). Associations were tested using Fisher’s exact test. All P were two-sided and considered statistically significant if P < 0.05.

Screening the entire coding region of the BRCA2 gene in tumor and blood DNA of 56 ESCC patients identified 8 mutations in 5 cases (5 of 56; 9%). Three cases had germ-line mutations, whereas 2 had only somatic mutations. These mutations are listed in Table 2,a, and examples are shown in Figs. 1 and 2. Demographic characteristics and previously determined genetic alterations of TP53, and LOH on D13S260 and D13S267 for these 5 cases are listed in Table 2b. No significant association was seen between alterations (mutations or intragenic allelic loss) in BRCA2 and TP53 (data not shown).

Allelic Loss at Polymorphic Sites in BRCA2.

SSCP analysis of BRCA2 exons 2–27 performed in this search for mutations in ESCC samples revealed bandshifts in some samples in exons 2, 10 (primer 10.3), and 11 (primer 11.7; Fig. 3). Direct sequencing of the genomic DNA/PCR products of these exons after SSCP showed the presence of three polymorphic sites (203G>A, N372H, and K1132K) reported previously in the Breast Cancer Information Core database.4 The frequency of allelic loss in tumor DNA atthese three polymorphic sites was 20% (10 of 51), 81% (13 of 16), and 64% (16 of 25) for 203G>A, N372H, and K1132K, respectively. Forty-six percent of ESCC cases (26 of 56) were found to have intragenic allelic loss at one or more of these polymorphic sites, including 16 with one, 7 with two, and 3 with loss at all three of the sites. Ten cases lost a wild-type allele at 203G>A; 5 cases lost a wild-type allele and 8 lost a polymorphic allele at N372H; and 8 lost a wild-type allele and 8 lost a polymorphic allele at K1132K (for example, see Fig. 3 for N372H).

Potential Biallelic Inactivation of BRCA2.

We found evidence for potential biallelic inactivation of BRCA2 in 4 of 56 (7%) cases (Table 2a). Two cases (SHE138 and SHE437) had a germ-line mutation in one allele and LOH in the other (wild-type) allele. A third case (SHE360) had a germ-line mutation in one allele (at codon 315) and LOH near the mutation position (at codon 372), but we could not determine whether the LOH was in the wild-type or mutant allele. A fourth case (SHE247) had two mutations (one missense and one frameshift) in different exons, but we do not know if these mutations occurred on different alleles. The fifth case (SHE150) also had two mutations, but because one mutation was silent and no other alterations were identified, it is unlikely that biallelic inactivation occurred. In addition, 10 cases without mutation had intragenic allelic loss at either two (n = 7) or all three (n = 3) of the polymorphic sites (data not shown). While it is possible that these losses occurred in different alleles, it seems more likely that these findings were the result of a single large allelic loss rather than multiple discrete events that occurred on different alleles.

Genetic Alterations of BRCA2 and LOH at D13S260 and D13S267.

The number of cases with a BRCA2 mutation was too small for meaningful comparison with LOH at microsatellite markers D13S260 or D13S267; however, LOH at D13S267 was significantly associated with allelic loss of at least one of the polymorphisms within BRCA2 (P = 0.004). Furthermore, among the 36 cases informative for both D13S267 and BRCA2, D13S267 showed LOH for all 20 cases with an intragenic BRCA2 allelic loss (sensitivity = 20 of 20 = 100%, specificity = 6 of 16 = 38%). Twenty of the 30 cases with LOH at D13S267 were subsequently found to have intragenic allelic loss in BRCA2 (positive predictive value = 67%). No significant association between LOH at D13S260 and loss at these three polymorphic sites was seen (data not shown).

Genetic Alterations of BRCA2 and Family History.

All 3 cases with germ-line mutations had a positive family history of UGI cancer. The frequency of BRCA2 mutations was somewhat higher in patients with a family history of UGI cancer (12%) compared with patients without such a family history (5%), but this difference was not significant (P = 0.36). Also, there was a slightly higher frequency of allelic loss (53%, 18 of 34) at polymorphic sites in patients with a family history of UGI cancer compared with patients without such a family history (36%, 8 of 22; P = 0.28).

Somatic mutations in BRCA2 are very rare in breast cancer and other tumors (4, 5, 6, 7, 21). Only one previous study has reported testing all of the coding exons in BRCA2 in ESCC, and no mutations were detected in those Japanese patients (8). To our knowledge, our report is the first to identify germ-line or somatic mutations in BRCA2 in ESCC patients. In the present study of 56 ESCC patients from a high-risk population in China, we found that 5 patients (9%) had 8 BRCA2 mutations. However, none of the 56 tumors showed classic Knudsen two-hit inactivation with clear cut functionally inactivating mutations. Two cases showed LOH with missense mutations of unknown significance. Thus, we conclude that BRCA2 is not the target of LOH on chromosome 13q. Because we did not evaluate BRCA2 mRNA or protein levels, we do not know if function was altered in the cases with either biallelic or single allele changes. At present there are no compelling clinical or experimental data that we are aware of indicating that BRCA2 haplo-insufficiency contributes to tumorigenesis (22). The three germ-line mutations we saw included one not reported previously, whereas the three polymorphisms we observed have all been reported before.4 Distinguishing between mutations and polymorphisms in these patients is complicated by the fact that previous studies of these alterations in Chinese populations have not been reported. The overall significance of our findings is not known and may represent either biallelic inactivation of BRCA2 in a small percentage of ESCC cases, or simply missense changes with no functional consequence. Whereas functional studies will be required to determine whether BRCA2 has any role in ESCC, it is apparent from our results here that BRCA2 is not frequently inactivated by the traditional two-hit mechanism. In summary, we showed for the first time that mutations in the BRCA2 gene do occur in ESCC patients but at low frequency. Moreover, the functional significance of these predominantly missense mutations remains to be determined. Evidence for classic biallelic inactivation was not seen. The putative target tumor suppressor gene corresponding to the high rate of chromosome 13q allelic loss remains unknown.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

3

The abbreviations used are: ESCC, esophageal squamous cell carcinoma; SSCP, single-strand conformation polymorphism; LOH, loss of heterozygosity; UGI, upper gastrointestinal.

4

Internet address: http://www.nchgr.nih.gov/Intramural_research/Lab_transfer/BIC.

Fig. 1.
Fig. 1. Somatic mutation of BRCA2 gene in case 247. A, SSCP gel, sequencing result shows that bands 1 and 3 are strands of the mutant allele, bands 2 and 4 are strands of the wild-type allele in the tumor. B, sequencing gel demonstrates somatic mutation with 7-bp (ccaatga) insertion after codon 25 of BRCA2 resulting in a reading frameshift in the tumor.
View largeDownload slide

Somatic mutation of BRCA2 gene in case 247. A, SSCP gel, sequencing result shows that bands 1 and 3 are strands of the mutant allele, bands 2 and 4 are strands of the wild-type allele in the tumor. B, sequencing gel demonstrates somatic mutation with 7-bp (ccaatga) insertion after codon 25 of BRCA2 resulting in a reading frameshift in the tumor.

Fig. 1.
Fig. 1. Somatic mutation of BRCA2 gene in case 247. A, SSCP gel, sequencing result shows that bands 1 and 3 are strands of the mutant allele, bands 2 and 4 are strands of the wild-type allele in the tumor. B, sequencing gel demonstrates somatic mutation with 7-bp (ccaatga) insertion after codon 25 of BRCA2 resulting in a reading frameshift in the tumor.
View largeDownload slide

Somatic mutation of BRCA2 gene in case 247. A, SSCP gel, sequencing result shows that bands 1 and 3 are strands of the mutant allele, bands 2 and 4 are strands of the wild-type allele in the tumor. B, sequencing gel demonstrates somatic mutation with 7-bp (ccaatga) insertion after codon 25 of BRCA2 resulting in a reading frameshift in the tumor.

Close modal
Fig. 2.
Fig. 2. Germline mutation and wild-type allelic loss in the tumor in case 437. A, SSCP gel shows an abnormal migration pattern in germ-line DNA; sequencing result demonstrates that bands 1 and 3 are strands of the mutant allele and bands 2 and 4 are strands of the wild-type allele in germ-line DNA. B, sequencing gel shows a missense mutation, C → T, resulting amino acid change of Pro → Ser at codon 3300 (P3300S).
View largeDownload slide

Germline mutation and wild-type allelic loss in the tumor in case 437. A, SSCP gel shows an abnormal migration pattern in germ-line DNA; sequencing result demonstrates that bands 1 and 3 are strands of the mutant allele and bands 2 and 4 are strands of the wild-type allele in germ-line DNA. B, sequencing gel shows a missense mutation, C → T, resulting amino acid change of Pro → Ser at codon 3300 (P3300S).

Fig. 2.
Fig. 2. Germline mutation and wild-type allelic loss in the tumor in case 437. A, SSCP gel shows an abnormal migration pattern in germ-line DNA; sequencing result demonstrates that bands 1 and 3 are strands of the mutant allele and bands 2 and 4 are strands of the wild-type allele in germ-line DNA. B, sequencing gel shows a missense mutation, C → T, resulting amino acid change of Pro → Ser at codon 3300 (P3300S).
View largeDownload slide

Germline mutation and wild-type allelic loss in the tumor in case 437. A, SSCP gel shows an abnormal migration pattern in germ-line DNA; sequencing result demonstrates that bands 1 and 3 are strands of the mutant allele and bands 2 and 4 are strands of the wild-type allele in germ-line DNA. B, sequencing gel shows a missense mutation, C → T, resulting amino acid change of Pro → Ser at codon 3300 (P3300S).

Close modal
Fig. 3.
Fig. 3. Polymorphism and allelic loss at exon 11 (primer 11.7) of BRCA2. A, SSCP gel for 9 cases. B, sequencing demonstrates that bands 1 and 3 are strands of the wild-type allele (His, H), and bands 2 and 4 are strands of the polymorphic allele (Asn, N) at codon 372 (N372H). Genotype of case 459 is heterozygous and shows loss of the polymorphic allele in tumor. N, germ-line DNA; t, tumor DNA.
View largeDownload slide

Polymorphism and allelic loss at exon 11 (primer 11.7) of BRCA2. A, SSCP gel for 9 cases. B, sequencing demonstrates that bands 1 and 3 are strands of the wild-type allele (His, H), and bands 2 and 4 are strands of the polymorphic allele (Asn, N) at codon 372 (N372H). Genotype of case 459 is heterozygous and shows loss of the polymorphic allele in tumor. N, germ-line DNA; t, tumor DNA.

Fig. 3.
Fig. 3. Polymorphism and allelic loss at exon 11 (primer 11.7) of BRCA2. A, SSCP gel for 9 cases. B, sequencing demonstrates that bands 1 and 3 are strands of the wild-type allele (His, H), and bands 2 and 4 are strands of the polymorphic allele (Asn, N) at codon 372 (N372H). Genotype of case 459 is heterozygous and shows loss of the polymorphic allele in tumor. N, germ-line DNA; t, tumor DNA.
View largeDownload slide

Polymorphism and allelic loss at exon 11 (primer 11.7) of BRCA2. A, SSCP gel for 9 cases. B, sequencing demonstrates that bands 1 and 3 are strands of the wild-type allele (His, H), and bands 2 and 4 are strands of the polymorphic allele (Asn, N) at codon 372 (N372H). Genotype of case 459 is heterozygous and shows loss of the polymorphic allele in tumor. N, germ-line DNA; t, tumor DNA.

Close modal
Table 1

Sequence of primers used for PCR-SSCP analysis of BRCA2

ExonaSense primer (5′–3′)Antisense primer (5′–3′)
2 CTCAGTCACATAATAAGGAATGC CAACACTGTGACGTACTGGGT 
3 CAAATTTGTCTGTCACTGGTTA CTAAATTCCTAGTTTGTAGTTC 
4 ACACTTCCAAAGAATGCAAAT TCTTCCTACAGGCTCTTAG 
5 ATATCTAAAAGTAGTATTCCAACA AAACTCCCACATACCACTGG 
6 CTACAATGTACATGTAACAC AATCTCAGGGCAAAGGTATAAC 
7 CGTTAAGTGAAATAAAGAGTGAATGA TAACAGAATTATTAGATGACAATT 
8 GTGTCATGTAATTCAAATAGTAGATGT AATGTAAGATAAATAATTTAACAAGG 
9 TACTACTATATGTGCATTGAGA ACAGAGCAAGACTCCACCT 
10.1 TAATGTGCTTCTGTTTTATAC ACATTCATCAGCGTTTGCTTC 
10.2 CAAAGACCACATTGGAAAGTC GATCAGTATCATTTGGTTCCAC 
10.3 AAGCAAACGCTGATGAATGTG TGGTCACATGAAGAAATATGC 
10.4 CAGGTCTAAATGGAGCCCAG GAGAAGTTCCAGATATTGCC 
10.5 AAGCCTCTGAAAGTGGACTG GCAAATGTAAGTGGTGCTTC 
11 AAGTGAAAGACATATTTACAGACAG TATGAAGCTTCCCTATACT 
11.1 GATGGTACTTTAATTTGTCAC CAAGATCCTGAGAGATTACTG 
11.2 GCTCTTTTGGGACAATTCTG ATAAAAGATTTTCTGGGATTG 
11.3 TGGAATACAGTGATACTGAC TTTTCAGGTGGCAACAGCTC 
11.4 CCCATGGAAAAGAATCAAGATG GTTCCTTAGTATTCCTAAAGC 
11.5 TGTCTTCCAAGTAGCTAATG CTGTGATTTGAAATTGGACC 
11.6 ACATGAACAAATGGGCAGGAC TGGTTTGAATTAAAATCCTGC 
11.7 GTCATATAACCCCTCAGATG CTGTACCTTCAAATTGCTTGC 
11.8 CGATTGGTCAGGTAGACAGC CTCTGCAGAAGTTTCCTCAC 
11.9 TGTTTCTACTGAAGCTCTGC GTTATCTTCATTTTCAGTATTTCTC 
11.10 TTGAAATGACTACTGGCAC CCTTCATAAACTGGCCAGATAAT 
11.11 TGTCTTAAATTATCTGGCCAG AAATGACTCTTTGGCGACAC 
11.12 AGATTTTGAGACTTCTGATAC TCCAGTACCAACTGGGACAC 
11.13 TGGACATTCTAAGTTATGAGG ATTTCACTAGTACCTTGCTCTTTT 
11.14 TGATGAAAAAGAGCAGGTAC ACAAGGTTTTTATCATTATTG 
11.15 CTGCCCCAAAGTGTAAAGAAAT AATGACTGAATAAGGGGACTGAT 
11.16 TCCTGCAACTTGTTACAC GATTTTTGTCATTTTCAGC 
11.17 AACCAGAAAGAATAAATACT CCTCAACGCAAATATCTTCAT 
11.18 TTCCAAAGTAATATCCAATGTA ATTTTTGATTTATTCTCGTTGTT 
11.19 AAGTGAAAGACATATTTACAGACAG TATGAAGCTTCCCTATACT 
11.20 CACCTTGTGATGTTAGTTTG TTGGGATATTAAATGTTCTGGAGTA 
11.21 TACTCCAGAACATTTAATATCCCAA CGTAGGTGTGAATAGTGAAGAC 
11.22 GTCTTCACTATTCACCTACG AGTGAGACTTTGGTTCCTAAT 
11.23 TTCAACAAGACAAACAACAGT GTCAGTTCATCATCTTCCATAAA 
11.24 CTTACTCCAAAGATTCAGAAAACTAC AGCATACCAAGTCTACTGAATAAAC 
12 AAAATGGTCTATAGACTTTTGAG ACCTATAGAGGGAGAACAGAT 
13 ACAGTAACATGGATATTCTCTTA AAACGAGACTTTTCTCATACTG 
14.1 ATAAACTTATATATTTTCTCCC AGGTGGAACAAAGACTTTGGT 
14.2 TGAGACACTTGATTACATCAG ATATCTAACTGAAAGGCAAA 
15 ATTTAATTACAAGTCTTCAGAATG ATAAAAGCCATCAGTATTGTAG 
16 TTTATTGTGTGATACATGTTTACT AAAGAGGGATGAGGGAATAC 
17 GTTGAATTCAGTTACATCCTAT ATAGGATGATACTGAATTCAAC 
18 CTTGTTTAAACAGTGGAATTCTA TAACTGAATCAATGACTGAT 
19 GAATTGAATACATATTTAACTACTA CCATCTCAAACAAACAAACAAAT 
20 CACTGTGCCTGGCCTGATAC AGTCTCTAAGACTTTGTTCTC 
21 TATGCTTGGTTCTTTAGTTTTAG CTCACCTTGAATAATCATCAAG 
22 GTTCTGATTGCTTTTTATTCC AGTAAGGTCATTTTTTAAGTTAAT 
23 TTTAAATGATAATGACTTCTTCC TCCATAAACTAACAAGCACTTAT 
24 TTTATGGAATCTCCATATGTTGA CTGGTAGCTCCAACTAATCTA 
25 CTTAAAATTCATCTAACACATCTA AAAAATACCAAAATGTGTGGTGA 
26 ACATAAATATGTGGGTTTGCAAT ACGATGGCCTCCATATATACT 
27.1 GAGACTGTGTGTAATTATTTGCGT GGTAAAGGCAGTCTACTCAAG 
27.2 AGAGAAGAGCCTTGGATTTCT TGGGTATTTATCAATGCAAGT 
27.3 TCTTTTGTCTGGTTCAACAGG AAGCGTCAATAATTTATTGTC 
ExonaSense primer (5′–3′)Antisense primer (5′–3′)
2 CTCAGTCACATAATAAGGAATGC CAACACTGTGACGTACTGGGT 
3 CAAATTTGTCTGTCACTGGTTA CTAAATTCCTAGTTTGTAGTTC 
4 ACACTTCCAAAGAATGCAAAT TCTTCCTACAGGCTCTTAG 
5 ATATCTAAAAGTAGTATTCCAACA AAACTCCCACATACCACTGG 
6 CTACAATGTACATGTAACAC AATCTCAGGGCAAAGGTATAAC 
7 CGTTAAGTGAAATAAAGAGTGAATGA TAACAGAATTATTAGATGACAATT 
8 GTGTCATGTAATTCAAATAGTAGATGT AATGTAAGATAAATAATTTAACAAGG 
9 TACTACTATATGTGCATTGAGA ACAGAGCAAGACTCCACCT 
10.1 TAATGTGCTTCTGTTTTATAC ACATTCATCAGCGTTTGCTTC 
10.2 CAAAGACCACATTGGAAAGTC GATCAGTATCATTTGGTTCCAC 
10.3 AAGCAAACGCTGATGAATGTG TGGTCACATGAAGAAATATGC 
10.4 CAGGTCTAAATGGAGCCCAG GAGAAGTTCCAGATATTGCC 
10.5 AAGCCTCTGAAAGTGGACTG GCAAATGTAAGTGGTGCTTC 
11 AAGTGAAAGACATATTTACAGACAG TATGAAGCTTCCCTATACT 
11.1 GATGGTACTTTAATTTGTCAC CAAGATCCTGAGAGATTACTG 
11.2 GCTCTTTTGGGACAATTCTG ATAAAAGATTTTCTGGGATTG 
11.3 TGGAATACAGTGATACTGAC TTTTCAGGTGGCAACAGCTC 
11.4 CCCATGGAAAAGAATCAAGATG GTTCCTTAGTATTCCTAAAGC 
11.5 TGTCTTCCAAGTAGCTAATG CTGTGATTTGAAATTGGACC 
11.6 ACATGAACAAATGGGCAGGAC TGGTTTGAATTAAAATCCTGC 
11.7 GTCATATAACCCCTCAGATG CTGTACCTTCAAATTGCTTGC 
11.8 CGATTGGTCAGGTAGACAGC CTCTGCAGAAGTTTCCTCAC 
11.9 TGTTTCTACTGAAGCTCTGC GTTATCTTCATTTTCAGTATTTCTC 
11.10 TTGAAATGACTACTGGCAC CCTTCATAAACTGGCCAGATAAT 
11.11 TGTCTTAAATTATCTGGCCAG AAATGACTCTTTGGCGACAC 
11.12 AGATTTTGAGACTTCTGATAC TCCAGTACCAACTGGGACAC 
11.13 TGGACATTCTAAGTTATGAGG ATTTCACTAGTACCTTGCTCTTTT 
11.14 TGATGAAAAAGAGCAGGTAC ACAAGGTTTTTATCATTATTG 
11.15 CTGCCCCAAAGTGTAAAGAAAT AATGACTGAATAAGGGGACTGAT 
11.16 TCCTGCAACTTGTTACAC GATTTTTGTCATTTTCAGC 
11.17 AACCAGAAAGAATAAATACT CCTCAACGCAAATATCTTCAT 
11.18 TTCCAAAGTAATATCCAATGTA ATTTTTGATTTATTCTCGTTGTT 
11.19 AAGTGAAAGACATATTTACAGACAG TATGAAGCTTCCCTATACT 
11.20 CACCTTGTGATGTTAGTTTG TTGGGATATTAAATGTTCTGGAGTA 
11.21 TACTCCAGAACATTTAATATCCCAA CGTAGGTGTGAATAGTGAAGAC 
11.22 GTCTTCACTATTCACCTACG AGTGAGACTTTGGTTCCTAAT 
11.23 TTCAACAAGACAAACAACAGT GTCAGTTCATCATCTTCCATAAA 
11.24 CTTACTCCAAAGATTCAGAAAACTAC AGCATACCAAGTCTACTGAATAAAC 
12 AAAATGGTCTATAGACTTTTGAG ACCTATAGAGGGAGAACAGAT 
13 ACAGTAACATGGATATTCTCTTA AAACGAGACTTTTCTCATACTG 
14.1 ATAAACTTATATATTTTCTCCC AGGTGGAACAAAGACTTTGGT 
14.2 TGAGACACTTGATTACATCAG ATATCTAACTGAAAGGCAAA 
15 ATTTAATTACAAGTCTTCAGAATG ATAAAAGCCATCAGTATTGTAG 
16 TTTATTGTGTGATACATGTTTACT AAAGAGGGATGAGGGAATAC 
17 GTTGAATTCAGTTACATCCTAT ATAGGATGATACTGAATTCAAC 
18 CTTGTTTAAACAGTGGAATTCTA TAACTGAATCAATGACTGAT 
19 GAATTGAATACATATTTAACTACTA CCATCTCAAACAAACAAACAAAT 
20 CACTGTGCCTGGCCTGATAC AGTCTCTAAGACTTTGTTCTC 
21 TATGCTTGGTTCTTTAGTTTTAG CTCACCTTGAATAATCATCAAG 
22 GTTCTGATTGCTTTTTATTCC AGTAAGGTCATTTTTTAAGTTAAT 
23 TTTAAATGATAATGACTTCTTCC TCCATAAACTAACAAGCACTTAT 
24 TTTATGGAATCTCCATATGTTGA CTGGTAGCTCCAACTAATCTA 
25 CTTAAAATTCATCTAACACATCTA AAAAATACCAAAATGTGTGGTGA 
26 ACATAAATATGTGGGTTTGCAAT ACGATGGCCTCCATATATACT 
27.1 GAGACTGTGTGTAATTATTTGCGT GGTAAAGGCAGTCTACTCAAG 
27.2 AGAGAAGAGCCTTGGATTTCT TGGGTATTTATCAATGCAAGT 
27.3 TCTTTTGTCTGGTTCAACAGG AAGCGTCAATAATTTATTGTC 
a

Total n = 57.

View Large
Table 2

Genetic changes and demographics for patients with BRCA2 alterations

A. BRCA2 genetic alterations in 5 of 56 ESCC patients
Patient IDMutationAllelic lossBiallelic alterations
MutationExonBRCA2 mutationDesignation/ mutation typeAllelic lossEvidence for biallelic alterations
Codon/nucleotideBase changeAmino acid changePresence of LOHWild-type LOH
SHE138 Germline 4 118/581 G→A Arg→His R118H/missense Yes Yes Yes 
    CGC→CAC      
 Somatic 11 1682/5274 T→C Ser→Ser S1682Sa/silent No —  
    AGT→AGC      
SHE150 Somatic 11 1338/4242 C→T Gly→Gly G1338Ga/silent No — No 
    GGC→GGT      
 Somatic 11 1988/6190 G→A Val→Ile V19881a/missense No —  
    GTA→ATA      
SHE247 Somatic 3 25–26/after 303 insertion 7bp stop codon 30 303ins7a/frame shift No — Possible 
    TTAGGA(ccaatga) CCAATA      
 Somatic 20 2842/8752 C→T Arg→Cys R2842Ca/missense No —  
    CGC→TGC      
SHE360 Germline 10 315/1171 T→A Cys→Ser C315S/missense Yes Unknown Possible 
    TGT→AGT      
SHE437 Germline 27 3300/10126 C→T Pro→Ser P3300Sa/missense Yes Yes Yes 
    CCA→TCA      
A. BRCA2 genetic alterations in 5 of 56 ESCC patients
Patient IDMutationAllelic lossBiallelic alterations
MutationExonBRCA2 mutationDesignation/ mutation typeAllelic lossEvidence for biallelic alterations
Codon/nucleotideBase changeAmino acid changePresence of LOHWild-type LOH
SHE138 Germline 4 118/581 G→A Arg→His R118H/missense Yes Yes Yes 
    CGC→CAC      
 Somatic 11 1682/5274 T→C Ser→Ser S1682Sa/silent No —  
    AGT→AGC      
SHE150 Somatic 11 1338/4242 C→T Gly→Gly G1338Ga/silent No — No 
    GGC→GGT      
 Somatic 11 1988/6190 G→A Val→Ile V19881a/missense No —  
    GTA→ATA      
SHE247 Somatic 3 25–26/after 303 insertion 7bp stop codon 30 303ins7a/frame shift No — Possible 
    TTAGGA(ccaatga) CCAATA      
 Somatic 20 2842/8752 C→T Arg→Cys R2842Ca/missense No —  
    CGC→TGC      
SHE360 Germline 10 315/1171 T→A Cys→Ser C315S/missense Yes Unknown Possible 
    TGT→AGT      
SHE437 Germline 27 3300/10126 C→T Pro→Ser P3300Sa/missense Yes Yes Yes 
    CCA→TCA      
B. Demographics and results of TP53 mutation and microsatellite marker LOH testing in ESCC patients with BRCA2 mutations
Patient IDAge/sexFamily history of cancerbTP53 mutation in exons 4–9Intragenic allelic loss in R72P of TP53cLOH at D13S260/267
SHE 138 55/F EC (mother) 12bp del (codon 174) Retention Loss/homozygous 
SHE 150 57/M EC (mother), cervical cancer (paternal aunt) No Homozygous (Pro/Pro) Retention/retention 
SHE247 45/M No 2bp del (codon 69) Homozygous (Arg/Arg) Homozygous/homozygous 
SHE360 55/M EC (father), BC (brother) No Loss (Arg allele) Loss/loss 
SHE437 47/F 2 EC (father and mother) 18bp del (Codon 134) Retention Loss/loss 
B. Demographics and results of TP53 mutation and microsatellite marker LOH testing in ESCC patients with BRCA2 mutations
Patient IDAge/sexFamily history of cancerbTP53 mutation in exons 4–9Intragenic allelic loss in R72P of TP53cLOH at D13S260/267
SHE 138 55/F EC (mother) 12bp del (codon 174) Retention Loss/homozygous 
SHE 150 57/M EC (mother), cervical cancer (paternal aunt) No Homozygous (Pro/Pro) Retention/retention 
SHE247 45/M No 2bp del (codon 69) Homozygous (Arg/Arg) Homozygous/homozygous 
SHE360 55/M EC (father), BC (brother) No Loss (Arg allele) Loss/loss 
SHE437 47/F 2 EC (father and mother) 18bp del (Codon 134) Retention Loss/loss 
a

Not reported in the BIC as of February 2001.4 

b

Includes complete family history of cancer in first, second, and third degree relatives; EC, esophageal cancer; BC, body of stomach cancer.

c

Polymorphism at codon 72, Arg→Pro, in exon 4 of TP53.

View Large

We thank Maxwell Lee, National Cancer Institute, for his very helpful discussion.

1
Wooster R., Neuhausen S. L., Mangion J., Quirk Y., Ford D., Collins N., Nguryen K., Seal S., Tran T., Averill D., Fields P., Marshall G., Narod S., Lenoir G. M., Lynch H., Feunteun J., Devilee P., Cornelisse C. J., Menko F. H., Daly C. M., Ormiston W., McManus R., Pye C., Lewis C. M., Cannon-Albright L. A., Peto J., Ponder B. A., Skolinick M. H., Easton D. F., Goldgar D. E., Stratton M. Localization of a breast cancer susceptibility gene, BRCA2, to chromosome 13q12-13.
Science (Wash. DC)
,
265
: 
2088
-2090,  
1994
.
2
Kuroki T., Fujiwara Y., Nakamori S., Imaoka S., Kanematsu T., Nakamura Y. Evidence for the presence of two tumor-suppressor genes for hepatocellular carcinoma on chromosome 13q.
Br. J. Cancer
,
72
: 
383
-385,  
1995
.
3
Wooster R., Bignell G., Lancaster J., Swift S., Seal S., Mangion J., Collins N., Gregory S., Gumbs C., Micklem G., Barfoot R., Hamoudi R., Patel S., Rice C., Biggs P., Hashim Y., Smith A., Connor F., Arason A., Gudmundsson J., Ficenec D., Kelsell D., Ford D., Tonin P., Bishop D. T., Spurr N. K., Ponder B. A. J., Eeles R., Peto J., Devilee P., Cornellsses C., Lynch H., Narod S., Lenoir G., Egilsson V., Barkadottir R. B., Easton D. F., Bentley D. R., Futreal P. A., Ashworth A., Stratton M. R. Identification of the breast cancer susceptibility gene BRCA2.
Nature (Lond.)
,
378
: 
789
-792,  
1995
.
4
Gundmundsson J., Johannesdottir G., Bergthorsson J., Arason A., Ingvarsson S., Egilsson V., Barkardottir R. Different tumor types from BRCA2 carriers show wild-type chromosome deletion on 13q12q13.
Cancer Res.
,
55
: 
4830
-4832,  
1995
.
5
Goggins M., Schutte M., Lu J., Moskaluk C. A., Weinstein C. L., Petersen G. M., Yeo C. J., Jackson C. E., Lynch H. T., Hruban R. H., Kern S. E. Germ-line BRCA2 gene mutations in patients with apparently sporadic pancreatic carcinomas.
Cancer Res.
,
56
: 
5360
-5364,  
1996
.
6
Katagiri T., Nakamura Y., Miki Y. Mutations in BRCA2 gene in hepatocellular carcinomas.
Cancer Res.
,
56
: 
4575
-4577,  
1996
.
7
Teng D. H. F., Bodgen R., Mitchell J., Baumgard M., Bell R., Berry S., Davis T., Ha P. C., Kehrer R., Jammulapati S., Chen Q., Offit K., Skolnick M. H., Tavtigian S., Jhanwar S., Swedlund B., Wong A. K. C., Kamb A. Low incidence of BRCA2 mutations in breast carcinoma and other cancers.
Nat. Genet.
,
13
: 
241
-244,  
1996
.
8
Harada H., Tanaka H., Shimada Y., Shinoda M., Imamura M., Ishizaki K. Lymph node metastasis is associated with allelic loss on chromosome 13q12-13 in esophageal squamous cell carcinoma.
Cancer Res.
,
59
: 
3724
-3729,  
1999
.
9
Sharan S. K., Morimmatsu M., Albrecht U., Lim D. S., Regel E., Dinh C., Sands A., Eichele G., Hasty P., Bradley A. Embryonic lethality and radiation hypersensitivity mediated by Rad51 in mice lacking Brca2.
Nature (Lond.)
,
386
: 
804
-810,  
1997
.
10
Pater K. J., Yu V. P. C. C., Lee H., Corcoram A., Thistlethwaite F. C., Evans M. J., Colledge W. H., Friendman L. S., Ponder B. A. J., Venkitaraman A. R. Involvement of Brca2 in DNA repair.
Mol. Cell
,
1
: 
347
-357,  
1998
.
11
Marmorstein L. Y., Quchi T., Aronson S. A. The BRCA2 gene product functionally interacts with p53 and RAD51.
Proc. Natl. Acad. Sci. USA
,
95
: 
13869
-13874,  
1998
.
12
Gretarsdottir S., Thorlacius S., Valgardsdottir R., Gudlaugsdottir S., Sigurdsson S., Steinarsdottir M., Jonasson J. G., Anamthawat-Jonsson K., Eyfjord J. E. BRCA2 and p53 mutations in primary breast cancer in relation to genetic instability.
Cancer Res.
,
58
: 
859
-862,  
1998
.
13
Ramus S. J., Bobrow L. G., Pharoah P. D. P., Finnigan D. S., Fishman A., Altaras M., Harrington P. A., Gayther S. A., Ponder B. A. J., Friedman L. S. Increased frequency of TP53 mutations in BRCA1 and BRCA2 ovarian tumors.
Genes Chromosomes Cancers
,
25
: 
91
-96,  
1999
.
14
Hu N., Dawsey S. M., Wu M., Bonney G. E., He L. J., Han X. Y., Fu M., Taylor P. R. Familial aggregation of oesophageal cancer in Yangcheng county. Shanxi Province, China.
Int. J. Epidemiol.
,
21
: 
877
-881,  
1992
.
15
Hu N., Roth M. J., Emmert-Buck M. R., Tang Z. Z., Polymeropolous M., Wang Q. H., Goldstein A. M., Han X. Y., Dawsey S. M., Ding T., Giffen C., Taylor P. R. Allelic loss in esophageal squamous cell carcinoma patients with and without family history of upper gastrointestinal tract cancer.
Clin. Cancer Res.
,
5
: 
3476
-3482,  
1999
.
16
Hu N., Roth M. J., Polymeropolous M., Tang Z. Z., Emmert-Buck M. R., Wang Q. H., Goldstein A. M., Feng S. S., Dawsey S. M., Ding T., Zhuang Z. P., Han X. Y., Reid T., Giffen C., Taylor P. R. Identification of novel regions of allelic loss from a genomewide scan of esophageal squamous cell carcinoma in a high-risk Chinese population.
Genes Chromosomes Cancer
,
27
: 
217
-228,  
2000
.
17
Li G., Hu N., Goldstein A. M., Tang Z. Z., Roth M. J., Wang Q. H., Dawsey S. M., Han X. Y., Ding T., Huang J., Giffen C., Taylor P. R. Allelic loss on chromosome bands 13q11-q13 in esophageal squamous cell carcinoma.
Genes Chromosomes Cancer
,
31
: 
390
-397,  
2001
.
18
Hu N., Huang J., Emmert-Buck M. R., Tang Z. Z., Roth M. J., Wang C. Y., Dawsey S. M., Li G., Li W. J., Wang Q. H., Han X. Y., Ding T., Giffen C., Goldstein A. M., Taylor P. R. Frequent inactivation of the p53 gene in esophageal squamous cell carcinoma from a high risk population in China.
Clin. Cancer Res.
,
7
: 
883
-891,  
2001
.
19
Huang J., Hu N., Goldstein A. M., Emmert-Buck M. R., Tang Z. Z., Roth M. J., Wang Q. H., Dawsey S. M., Han X. Y., Ding T., Li G., Giffen C., Taylor P. R. High frequency allelic loss on chromosome 17p13.3-p11.1 in esophageal squamous cell carcinomas from a high incidence area in northern China.
Carcinogenesis (Lond.)
,
21
: 
2019
-2016,  
2000
.
20
Welsch P. L., Owens K. N., King M. C. Insight into the functions of BRCA1 and BRCA2..
Trends Genet.
,
16
: 
69
-74,  
2000
.
21
Miki Y., Katagiri T., Kasumi F., Yoshimoto T., Nakamura Y. Mutation analysis in the BRCA2 gene in primary breast cancer.
Nat. Genet.
,
13
: 
245
-247,  
1996
.
22
Welsch P. L., King M. C. BRCA1 and BRCA2 and the genetics of breast and ovarian cancer.
Hum. Mol. Genet.
,
10
: 
705
-713,  
2001
.
2002