Purpose: The methylation profile of nasopharyngeal carcinoma (NPC) has been investigated by a candidate gene approach.

Experimental Design: Four NPC cell lines, 4 NPC xenografts, 33 NPC primary tumors, and 6 samples of normal nasopharyngeal epithelium were subjected to methylation-specific PCR for analysis of promoter methylation of eight cancer-related genes. These eight genes were RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1. The correlation between methylation status of these genes and clinical features such as stage, local-regional recurrence, distant metastasis, and survival has been analyzed.

Results: The incidence of promoter methylation in NPC samples was 84% for RASSF1A, 80% for RARβ2, 76% for DAP-kinase, 46% for p16, 17% for p15, 20% for p14, 20% for MGMT, and 3% for GSTP1. No methylation of these genes was detected in the six normal nasopharyngeal epithelium samples. All NPC tumor samples in this study displayed aberrant methylation in at least one of these eight genes. No significant correlation between methylation status of these genes and clinical parameters of the patients was found.

Conclusions: A high frequency of aberrant methylation of the 5′ CpG island of the RASSF1A, RARβ2, DAP-kinase, and p16 genes in the present study was noted. Our findings suggest that methylation of the genes in the critical pathways is common in NPC.

NPC3 is a serious health problem in southern China because it has an unusually high incidence among our population. The annual male incidence rate in Hong Kong is 24.6 cases per 100,000 persons (Hong Kong Cancer Registry, 1997), which contrasts with a frequency of <1 case per 100,000 persons in Caucasians in other countries. The incidence of NPC peaks at the relatively young age of 45 years. Previous etiological studies demonstrated that the development of NPC might be attributable to a complex interaction of genetic factors, dietary exposure to chemical carcinogen, and EBV infection (1).

The tumorigenesis of NPC is thought to be a multistep process and involves multiple genetic and epigenetic changes. For the past decade, we have focused on the investigation of the molecular basis of this cancer and thereby expanded the prospects for development of early diagnostic markers and novel therapeutic strategies (1, 2).

There is growing evidence demonstrating that alterations in the distribution of 5-methylcytosine are an important factor in multistep carcinogenesis (3, 4). These changes include genome-wide hypomethylation (5, 6) and hypermethylation of CpG sites in 5′-promoter regions leading to genomic instability and inhibition of gene expression, respectively (7, 8, 9). Promoter hypermethylation has been proposed to be an alternative way to inactivate tumor suppressor genes in cancer (3, 4). Recent studies showed that this epigenetic change is common in human cancer. Some tumor suppressor genes such as p16, VHL, and MLH1 have been found to harbor promoter hypermethylation associated with loss of protein expression in cancer cells (7, 8, 9). Several tumor types have also shown aberrant methylation at CpG islands in other genes, including the detoxifying gene GSTP1(10), the DNA repair gene MGMT(11), and the apoptosis-related and potential metastasis inhibitor gene DAP-kinase(12). In NPC, a high frequency of epigenetic inactivation of the tumor suppressor genes p16 and RASSF1A was detected (13, 14). The identification of genes targeted by hypermethylation may provide insights into NPC tumorigenesis. In addition, hypermethylated genes may serve as targets for the development of a novel screening test for cancer (15).

In the present study, we have analyzed the promoter hypermethylation pattern of the human Ras association domain family 1A (RASSF1A), retinoic acid receptor β-2 (RARβ2), death-associated protein kinase (DAP-kinase), p16 (CDKN2A), p15 (INK4b), p14 (ARF), O6-methylguanine-DNA methyltransferase (MGMT), and GSTP1 genes in 4 NPC cell lines, 4 xenografts, and 33 primary tumors together with normal nasopharyngeal epithelium. The correlation between methylation status of these genes and clinical features such as stage, local-regional recurrence, distant metastasis, and survival of the patients has been analyzed.

Cell Lines and Xenografts.

Two cell lines (C666-1 and CNE-1) derived from undifferentiated NPCs and two cell lines (HK-1 and CNE-2) derived from differentiated NPCs were examined (16, 17). Cell line C666-1 was derived from xenograft Xeno-666 in our laboratory (17). These cell lines were maintained in RPMI 1640 with 10% fetal bovine serum. Four NPC xenografts (Xeno-2117, Xeno-1915, Xeno-666, and Xeno-8) were also involved (18). High molecular weight DNA was extracted from the tumor samples according to conventional methods (19).

Tissue Samples.

Thirty-three cases of primary tumors (NPC1T–NPC33T) were included. Twenty-five paraffin-embedded tumors and 6 samples of normal tissue (FN1E–FN6E) of the nasopharynx from aborted fetuses were obtained from the Pathology Tissue Bank of the Department of Anatomical and Cellular Pathology at the Princes of Wales Hospital (Hong Kong SAR, People’s Republic of China). Eight tumor biopsies were obtained from NPC patients with consent before treatment at the Department of Clinical Oncology at the Prince of Wales Hospital. The latter samples were embedded in OCT compound. All of the specimens were subjected to histological diagnosis by a pathologist (K-F.T.). These tumors were classified as WHO grade II or III (20).

The male:female ratio of the above-mentioned NPC patients was 4.8:1. The age range was 36–68 years (mean age, 52 years). On the basis of Ho’s stage classification (21), four patients had stage I disease (12.1%), nine patients had stage II disease (27.3%), eight patients had stage III disease (24.2%), four patients had stage IVA disease (12.1%), and eight patients had stage IVB disease (24.2%). Data regarding the development of local-regional recurrence, distant metastasis, and survival were available on 33 patients with a mean follow-up time of 24 months.

Microdissection and DNA Extraction.

For each primary tumor or sample of normal nasopharyngeal epithelium, 40–60 serial sections (5-μm thick) were subjected to microdissection manually or by laser-captured microdissection using a PixCell LCM system (Arcturus Engineering, Mountain View, CA), under the guidance of a pathologist. All sections were lightly stained with hematoxylin. Neoplastic cells of the tumor samples or epithelial cells of the normal nasopharyngeal samples were isolated and collected for DNA extraction. DNA was extracted from isolated tumor cells and normal epithelial cells according to conventional methods (19).

MSP.

The methylation status at the promoter region of RASSF1A, RARβ2, DAP kinase, p16, p15, p14, MGMT, and GSTP1 was assessed by MSP as described previously (22). Genomic DNAs from the cell lines, xenografts, microdissected primary tumors, and microdissected normal epithelium were subjected to bisulfite modification by using the CpGenome DNA modification kit (Intergen, New York, NY). Treatment of genomic DNA with sodium bisulfite converts unmethylated cytosines (but not methylated cytosines) to uracil, which is then converted to thymidine during the subsequent PCR step, giving sequence differences between methylated and unmethylated DNA. PCR primers that distinguish between these methylated and unmethylated DNA sequences were used. Primer sequences of all genes for both the methylated and the unmethylated form, annealing temperatures, and the expected PCR product sizes are summarized in Table 1. For PCR amplification, 2 μl of bisulfite-modified DNA were added in a final volume of 25 μl of PCR mixture containing 1× PCR buffer, MgCl2, deoxynucleotide triphosphates, and primers (100 pmol each per reaction), and 1 unit of AmpiTaq Gold (Applied Biosystems, Branchburg, NJ). Amplification was carried out in a 9700 Perkin-Elmer thermal cycler under the following conditions: 95°C for 12 min; 35 cycles of 95°C for 1 min, the specific annealing temperature for each gene for 1 min, and 72°C for 1 min; followed by a final 7-min extension at 72°C. PCR products (15 μl) were loaded onto a 10% nondenaturing polyacrylamide gel, stained with ethidium bromide, and visualized under UV illumination. The MSP for all samples was repeated to confirm their methylation status.

Statistical Analysis.

All statistical analysis was performed using the SPSS 10.0 statistical software for Windows. The χ2 test or Fisher’s exact test was used to assess the association between various parameters. In the univariate analysis of patient survival, development of local-regional recurrence, and metastasis, Kaplan-Meier survival analysis was used to compare the different patient groups. The significance of these differences was determined by the Breslow test for a P < 0.05 or by the Cox model, as appropriate.

Frequency of Methylation in NPC Cell Lines, Xenografts, Primary Tumors, and Normal Nasopharyngeal Epithelia.

We determined the frequency of methylation of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in 4 NPC cell lines, 4 xenografts, and 33 primary tumors together with 6 normal nasopharyngeal epithelia by MSP. Fig. 1,A shows MSP analysis in NPC cell lines and xenografts, and Fig. 1,B shows representative examples of MSP analysis on normal nasopharyngeal epithelia and NPC primary tumors. Table 2 summarizes the promoter hypermethylation frequency of each gene in the NPC samples and in normal nasopharyngeal epithelia. The RASSF1A gene was methylated in 84% (31of 37) of the NPC samples. The incidence of promoter hypermethylation in NPC samples was 80% (32 of 40) for RARβ2, 76% (31 of 41) for DAP-kinase, 46% (19 of 41) for p16, 17% (7 of 41) for p15, 20% (8 of 41) for p14, 20% (8 of 40) for MGMT, and 3% (1 of 41) for GSTP1. No methylated templates of the six genes were detected by MSP in all six normal nasopharyngeal epithelia.

In the NPC cell lines and xenografts, multiple epigenetic changes were demonstrated (Table 2). Aberrant methylation was frequently observed in the RASSF1A, RARβ2, and DAP-kinase genes. Methylation of p16 and p14 was also found in C666-1 and Xeno-666. For MGMT and GSTP1 genes, promoter hypermethylation was found in three NPC cell lines. No p15 methylation was found in NPC cell lines and xenografts (Fig. 2). For the three genes (p16, p14, and p15) located on chromosome 9p21, no signal of both methylated and unmethylated sequences was detected in Xeno-1915 or Xeno-2117. No signal of p16 gene was detected in Xeno-8 (Fig. 1 A).

In the primary tumors, although microdissection was performed in each case, the presence of the remaining nonmalignant cell elements may still contribute to the signal of unmethylated sequence. Thus, the unmethylated sequence of all genes was detected in the NPC primary tumors (Fig. 1,B). In all 33 primary tumors, at least one of these eight genes showed aberrant methylation in all tumor samples. Methylation of only one gene was found in 10% (3 of 33) of tumors. The percentage of the tumors with methylation in genes 2, 3, 4, 5, and 6 is 18% (6 of 33), 24% (8 of 33), 33% (11 of 33), 12% (4 of 33), and 3% (1 of 33), respectively (Fig. 3). None of the 33 primary tumors showed methylation in all genes examined.

Correlations with Clinical Parameters.

Among the NPC samples, the percentage of primary tumors with methylation for specific genes is as follows: (a) RASSF1A, 83% (24 of 29); (b) RARβ2, 81% (26 of 32); (c) DAP-kinase, 73% (24 of 33); (d) p16, 52% (17 of 33); (e) p15, 21% (7 of 33); (f) p14, 18% (6 of 33); (g) MGMT, 16% (5 of 32); and (h) GSTP1, 0% (0 of 33; Table. 22). We have correlated the methylation status of each of the genes with clinical characteristics from the NPC patients. We found no significant correlation between the methylation status of each gene and clinical parameters including the stage, development of local-regional recurrence, distant metastasis, and survival. However, methylation of MGMT may be associated with the development of the metastasis (Breslow, P = 0.0623). We also investigated the clinical correlation of the multiple methylation phenotype in NPC among these 33 primary tumors. In our results, 49% (16 of 33) of the primary tumors were methylated at four or more markers. When we considered this portion of primary tumors as multiple methylation phenotype, no significant correlation between multiple methylation phenotype and stage was found.

Transcriptional silencing by hypermethylation of CpG islands in the promoter region is becoming recognized as a common mechanism for the inactivation of tumor suppressor genes (3, 4, 26). Many studies have demonstrated that the CpG islands in the RB, p16, VHL, APC, MLH1, and BRCA1 genes are frequently methylated in a variety of human cancers but are usually unmethylated in the corresponding normal tissues (3, 4, 26). Studies showed that when these CpG islands are methylated in cancer cells, expression of the corresponding gene is silenced, and the silencing can be partially relieved by demethylation of the promoter region (4, 26). Recently, the growing list of genes inactivated by promoter hypermethylation provided an opportunity to examine the epigenetic alteration of multiple cancer-related genes in different tumors. In the present study, we determined the frequency of promoter hypermethylation of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in NPC. These are genes that are involved in different pathways in cells. Epigenetic inactivation of them may affect all of the molecular pathways involved in cell immortalization and transformation (27). It is possible to find simultaneous inactivation of several pathways by aberrant methylation in NPC.

RASSF1A is a novel tumor suppressor gene that was isolated recently from the lung tumor suppressor locus 3p21.3(28). The presence of a Ras association domain in RASSF1A suggests that this protein may function as an effector of Ras signaling (or signaling of a Ras-like molecule) in normal cells. Its protein structure also suggests that RASSF1A may participate in the DNA damage response or in DNA damage-induced regulation of other cell signaling events (28, 29). Promoter hypermethylation of RASSF1A was found in lung and breast cancers (28, 30, 31, 32). Our recent study also demonstrated that the promoter of RASSF1A was highly methylated in primary NPCs (67%; Ref. 14). In the present study, we recruited a different cohort of primary NPC samples, and we observed an even higher percentage of RASSF1A promoter hypermethylation in the samples (83%). The results suggest that promoter hypermethylation inactivates the critical function of RASSF1A in NPC.

Retinoids are known to possess antiproliferative, differentiative, immunomodulatory, and apoptosis-inducing properties. The regulation of cell growth and differentiation of normal, premalignant, and malignant cells by retinoids is thought to result from the direct and indirect effects of retinoids on gene expression. These effects are mediated by the nuclear receptors, including retinoic acid receptor β2 (RARβ2) located at 3p24. Consistent 3p deletion is a unique feature of NPC tumors. From previous studies, hypermethylation of RARβ2 was common in pancreatic cancers (20%; Ref. 33), breast cancers (23, 34, 35), and lung carcinomas (small cell lung cancer, 72%; non-small cell lung cancer, 41%; Ref. 36). In this study, we found high-frequency hypermethylation of the RARβ2 promoter in 81% of primary NPC samples. Thus, promoter hypermethylation of RARβ2 may block or interfere with the retinoid signaling pathways in NPC.

Promoter hypermethylation of DAP-kinase was also found in 73% of primary NPCs. This protein is a positive mediator of apoptosis induced by IFN-γ. Sanchez-Cespedes et al.(37) observed a positive correlation between methylation of DAP-kinase and the presence of lymph node metastases in patients with head and neck cancer. Although we did not find any correlation in our small number of NPC samples, we believe that promoter hypermethylation would inactivate the function of this potential metastasis inhibitor gene in NPC.

The p16 protein is a common tumor suppressor that plays a central role in control of cell proliferation during G1(38). Our group has reported previously that mutations of the p16 gene were found in three NPC cell lines (HK-1, CNE-1, and CNE-2). Homozygous deletion of the p16 gene has been identified in three NPC xenografts (Xeno-2117, Xeno-1915, and Xeno-8) and 35% of primary NPCs (39). Moreover, aberrant methylation of the 5′ CpG island of the p16 gene was found in a NPC xenograft (Xeno-666) and in 22% of primary tumors (13). In the present study, the hypermethylation of p16 promoter was detected in 52% of microdissected primary tumors by a more sensitive method, MSP.

The INK4a/ARF locus encodes two cell cycle-regulatory proteins, p16 and p14, which share an exon using different reading frames. Recent work suggests that p14 interacts in vivo with MDM2 protein, neutralizing MDM2-mediated degradation of p53 (40). Promoter hypermethylation of p14 was found in 18% of primary NPCs in the present study. Epigenetic inactivation of the p14 gene may thus interfere with the p53 network in a subset of NPC tumors.

The p15 gene is also an inhibitor of cyclin-dependent kinase 4, which is an important mediator of cell cycle control, especially in a pathway stimulated by transforming growth factor β (41). In the present study, we demonstrated promoter hypermethylation of p15 in 21% of primary NPCs. Our finding suggests that the p15 gene may play a role in NPC tumorigenesis.

Of the three genes mentioned above that are located on chromosome 9p21, methylation of p16 showed the highest rate.

MGMT is a DNA repair protein that removes mutagenic and cytotoxic adducts from O6-guanine in DNA (42). Frequent methylation of MGMT associated with gene silencing occurs in human cancers (11, 43, 44). GSTs are a family of isoenzymes that play important roles in protecting cells from cytotoxic and carcinogenic agents (45). GSTP1 hypermethylation was most frequent in prostate, breast, and renal carcinomas. However, we found little promoter hypermethylation of MGMT (15%) and GSTP1 (0%) in our primary tumor samples. Aberrant methylation of MGMT and GSTP1 may occur only in selected tumor types.

In the present study, we did not find any significant correlation between methylation status of the tested genes and clinical characteristics of the NPC patients. Although there may be some correlation between MGMT methylation and the development of metastasis, this observation needs to be confirmed by a larger study with more NPC patients.

In conclusion, our study demonstrated a methylation profile of NPC by using a candidate gene approach. Our data stress the high frequency of promoter hypermethylation of multiple cancer-related genes in these samples and demonstrate that methylation may be the most common mechanism of inactivating genes in NPC. The epigenetic silencing of multiple cancer-related genes, including RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, and MGMT, may cause disruption of the Ras signaling pathway, the retinoid signaling pathway, the metastasis-related process, cell cycle, p53 network, and DNA repair in NPC.

A number of recent studies also demonstrated the detection of gene promoter hypermethylation in the serum and sputum of lung cancer patients (46, 47). The methylation changes were also used as molecular markers in the serum and saliva from patients with head and neck tumors (37, 48). Promoter hypermethylation may thus be useful as a tumor marker for early diagnosis and disease monitoring. A nasopharyngeal brush biopsy procedure and PCR-based assay for EBV were recently introduced for detection of NPC in a high-risk population (49). In addition to EBV, we believe that the methylation markers identified in the present study may improve the sensitivity and specificity of the detection of NPC in nasopharyngeal brush biopsy samples.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

        
1

This work was carried out within the Hong Kong Cancer Genetics Research Group supported by the Kadoorie Charitable Foundations, Institute of Molecular Oncology and by the Hong Kong Research Grant Council (Grant CUHK4154/00 M).

                
3

The abbreviations used are: NPC, nasopharyngeal carcinoma; MSP, methylation-specific PCR; GST, glutathione S-transferase.

Fig. 1.

A, MSP analysis of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in NPC cell lines (C666, CNE1, CNE2, and HK1) and xenografts (X1915, X2117, X666, and XNPC8). The PCR products in the Lanes u show the presence of unmethylated templates of each gene, whereas the products in Lanesm indicate the presence of methylated templates. H2O, water control. B, MSP analysis of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in normal nasopharyngeal epithelium and primary NPC. The PCR products in Lanes u show the presence of unmethylated templates of each gene, whereas the products in Lanes m indicate the presence of methylated templates. FNE, normal nasopharyngeal epithelia; T, primary tumor; H2O, water control.

Fig. 1.

A, MSP analysis of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in NPC cell lines (C666, CNE1, CNE2, and HK1) and xenografts (X1915, X2117, X666, and XNPC8). The PCR products in the Lanes u show the presence of unmethylated templates of each gene, whereas the products in Lanesm indicate the presence of methylated templates. H2O, water control. B, MSP analysis of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in normal nasopharyngeal epithelium and primary NPC. The PCR products in Lanes u show the presence of unmethylated templates of each gene, whereas the products in Lanes m indicate the presence of methylated templates. FNE, normal nasopharyngeal epithelia; T, primary tumor; H2O, water control.

Close modal
Fig. 2.

Summary of methylation of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in NPC xenografts, cell lines, primary tumors, and normal nasopharyngeal epithelium. Filled boxes, methylated loci; open boxes, unmethylated loci. ▵, only methylated signal detected; #, both methylated and unmethylated signal detected; HD, homozygous deletion; ND, not done.

Fig. 2.

Summary of methylation of RASSF1A, RARβ2, DAP-kinase, p16, p15, p14, MGMT, and GSTP1 in NPC xenografts, cell lines, primary tumors, and normal nasopharyngeal epithelium. Filled boxes, methylated loci; open boxes, unmethylated loci. ▵, only methylated signal detected; #, both methylated and unmethylated signal detected; HD, homozygous deletion; ND, not done.

Close modal
Fig. 3.

Percentage distribution of the number of genes methylated in primary tumors.

Fig. 3.

Percentage distribution of the number of genes methylated in primary tumors.

Close modal
Table 1

Summary of primer sequences,a annealing temperatures, and PCR product sizes used for MSP

GeneForward primer (5′→3′)Reverse primer (5′→3′)Annealing temperature (°C)Product size (bp)
RASSF1A M: bGTGTTAACGCGTTGCGTATC M: AACCCCGCGAACTAAAAACGA 60 93 
 U: TTTGGTTGGAGTGTGTTAATGTG U: CAAACCCCACAAACTAAAAACAA 60 105 
RARβ2 M: GGTTAGTAGTTCGGGTAGGGTTTATC M: CCGAATCCTACCCCGACG 58 235 
 U: TTAGTAGTTTGGGTAGGGTTTATT U: CCAAATCCTACCCCAACA 58 233 
DAP-kinase M: GGATAGTCGGATCGAGTTAACGTC M: CCCTCCCAAACGCCGA 58 98 
 U: GGAGGATAGTTGGATTGAGTTAATGTT U: CAAATCCCTCCCAAACACCAA 58 106 
p16 M: TTATTAGAGGGTGGGGCGGATCGC M: GACCCCGAACCGCGACCGTAA 65 150 
 U: TTATTAGAGGGTGGGGTGGATTGT U: CAACCCCAAACCACAACCATAA 60 151 
p15 M: GCGTTCGTATTTTGCGGTT M: CGTACAATAACCGAACGACCGA 60 148 
 U: TGTGATGTGTTTGTATTTTGTGGTT U: CCATACAATAACCAAACAACCAA 60 154 
p14 M: GTGTTAAAGGGCGGCGTAGC M: AAAACCCTCACTCGCGACGA 60 122 
 U: TTTTTGGTGTTAAAGGGTGGTGTAGT U: CACAAAAACCCTCACTCACAACAA 60 132 
MGMT M: TTTCGACGTTCGTAGGTTTTCGC M: GCACTCTTCCGAAAACGAAACG 61 81 
 U: TTTGTGTTTTGATGTTTGTAGGTTTTTGT U: AACTCCACACTCTTCCAAAAACAAAACA 61 93 
GSTP1 M: TTCGGGGTGTAGCGGTCGTC M: GCCCCAATACTAAATCACGACG 60 91 
 U: GATGTTTGGGGTGTAGTGGTTGTT U: CCACCCCAATACTAAATCACAACA 60 97 
GeneForward primer (5′→3′)Reverse primer (5′→3′)Annealing temperature (°C)Product size (bp)
RASSF1A M: bGTGTTAACGCGTTGCGTATC M: AACCCCGCGAACTAAAAACGA 60 93 
 U: TTTGGTTGGAGTGTGTTAATGTG U: CAAACCCCACAAACTAAAAACAA 60 105 
RARβ2 M: GGTTAGTAGTTCGGGTAGGGTTTATC M: CCGAATCCTACCCCGACG 58 235 
 U: TTAGTAGTTTGGGTAGGGTTTATT U: CCAAATCCTACCCCAACA 58 233 
DAP-kinase M: GGATAGTCGGATCGAGTTAACGTC M: CCCTCCCAAACGCCGA 58 98 
 U: GGAGGATAGTTGGATTGAGTTAATGTT U: CAAATCCCTCCCAAACACCAA 58 106 
p16 M: TTATTAGAGGGTGGGGCGGATCGC M: GACCCCGAACCGCGACCGTAA 65 150 
 U: TTATTAGAGGGTGGGGTGGATTGT U: CAACCCCAAACCACAACCATAA 60 151 
p15 M: GCGTTCGTATTTTGCGGTT M: CGTACAATAACCGAACGACCGA 60 148 
 U: TGTGATGTGTTTGTATTTTGTGGTT U: CCATACAATAACCAAACAACCAA 60 154 
p14 M: GTGTTAAAGGGCGGCGTAGC M: AAAACCCTCACTCGCGACGA 60 122 
 U: TTTTTGGTGTTAAAGGGTGGTGTAGT U: CACAAAAACCCTCACTCACAACAA 60 132 
MGMT M: TTTCGACGTTCGTAGGTTTTCGC M: GCACTCTTCCGAAAACGAAACG 61 81 
 U: TTTGTGTTTTGATGTTTGTAGGTTTTTGT U: AACTCCACACTCTTCCAAAAACAAAACA 61 93 
GSTP1 M: TTCGGGGTGTAGCGGTCGTC M: GCCCCAATACTAAATCACGACG 60 91 
 U: GATGTTTGGGGTGTAGTGGTTGTT U: CCACCCCAATACTAAATCACAACA 60 97 
a

References for primer sequences: Ref. 11, 12, 14, and 22,23,24,25.

b

M, methylated-specific primers; U, unmethylated-specific primers.

Table 2

Methylation of multiple genes in NPC and normal nasopharyngeal epithelia

SamplesRASSF1ARARB2DAP-kinasep16p15p14MGMTGSTP1
NPC xenografts (a) 100% (4/4) 50% (2/4) 75% (3/4) 25% (1/4) 0% (0/4) 25% (1/4) 0% (0/4) 0% (0/4) 
NPC cell lines (b) 75% (3/4) 100% (4/4) 100% (4/4) 25% (1/4) 0% (0/4) 25% (1/4) 75% (3/4) 25% (1/4) 
NPC primary tumors (c) 83% (24/29) 81% (26/32) 73% (24/33) 52% (17/33) 21% (7/33) 18% (6/33) 15% (5/32) 0% (0/33) 
Total(a + b + c) 84% (31/37) 80% (32/40) 76% (31/41) 46% (19/41) 17% (7/41) 20% (8/41) 20% (8/40) 3% (1/41) 
Normal nasopharyngeal epithelia 0% (0/6) 0% (0/4) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 
SamplesRASSF1ARARB2DAP-kinasep16p15p14MGMTGSTP1
NPC xenografts (a) 100% (4/4) 50% (2/4) 75% (3/4) 25% (1/4) 0% (0/4) 25% (1/4) 0% (0/4) 0% (0/4) 
NPC cell lines (b) 75% (3/4) 100% (4/4) 100% (4/4) 25% (1/4) 0% (0/4) 25% (1/4) 75% (3/4) 25% (1/4) 
NPC primary tumors (c) 83% (24/29) 81% (26/32) 73% (24/33) 52% (17/33) 21% (7/33) 18% (6/33) 15% (5/32) 0% (0/33) 
Total(a + b + c) 84% (31/37) 80% (32/40) 76% (31/41) 46% (19/41) 17% (7/41) 20% (8/41) 20% (8/40) 3% (1/41) 
Normal nasopharyngeal epithelia 0% (0/6) 0% (0/4) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 0% (0/6) 

We thank Dr. David T. L. Liu for retrieving paraffin-embedded tumor samples from the Pathology Tissue Bank, Department of Anatomical and Cellular Pathology, The Chinese University of Hong Kong.

1
Huang D. P., Lo K. W. Aetiological factors and pathogenesis 2nd ed. van Hasselt G. A. Gibb A. G. eds. .
Nasopharyngeal Carcinoma
,
:
31
-60, The Chinese University Press Hong Kong  
1999
.
2
Jeannel D., Bouvier G., Huber A. Nasopharyngeal carcinoma: an epidemiological approach to carcinogenesis.
Cancer Surv.
,
33
:
125
-155,  
1999
.
3
Baylin S. B., Herman J. G., Graff J. R., Vertino P. M., Issa J. P. Alternations in DNA methylation: a fundamental aspect of neoplasia.
Adv. Cancer Res.
,
72
:
141
-196,  
1998
.
4
Jones P. A., Laird P. W. Cancer epigenetics comes of age.
Nat. Genet.
,
21
:
163
-167,  
1999
.
5
Goelz S. E., Vogelstein B., Hamilton S. R., Feinberg A. P. Hypomethylation of DNA from benign and malignant human colon neoplasms.
Science (Wash. DC)
,
228
:
187
-190,  
1985
.
6
Cravo M., Pinto R., Fidalgo P., Chaves P., Gloria L., Nobre-Leitao C., Costa Mira F. Global DNA hypomethylation occurs in the early stages of intestinal type gastric carcinoma.
Gut
,
39
:
434
-438,  
1996
.
7
Merlo A., Herman J. G., Mao L., Lee D. J., Gabrielson E., Burger P. C., Baylin S. B., Sidransky D. 5′CpG island methylation is associated with transcriptional silencing of the tumor suppressor p16/CDKN2/MTS1 in human cancers.
Nat. Med.
,
1
:
686
-692,  
1995
.
8
Herman J. G., Latif F., Weng Y., Lerman M. I., Zbar B., Liu S., Samid D., Duan D. S. R., Gnarra J. R., Linehan W. M., Baylin S. B. Silencing of the VHL tumor-suppressor gene by DNA methylation in renal carcinoma.
Proc. Natl. Acad. Sci. USA
,
91
:
9700
-9704,  
1994
.
9
Herman J. G., Umar A., Polyak K., Graff J. R., Ahuja N., Issa J. P., Markowitz S., Willson J. K. V., Hamilton S. R., Kinzler K. W., Kane M. F., Kolodner R. D., Vogelstein B., Kunkel T. A., Baylin S. B. Incidence and functional consequences of hMLH1 promoter hypermethylation in colorectal carcinoma.
Proc. Natl. Acad. Sci. USA
,
95
:
6870
-6875,  
1998
.
10
Lee W. H., Morton P. A., Epstein J. I., Brooks J. D., Campbell P. A., Bova G. S., Hsieh W. S., Isaacs W. B., Nelson W. G. Cytidine methylation of regulatory sequences near the π-class glutathione S-transferase gene accompanies human prostatic carcinogenesis.
Proc. Natl. Acad. Sci. USA
,
91
:
11733
-11737,  
1994
.
11
Esteller M., Hamilton S. R., Burger P. C., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O6-methylguanine-DNA-methyltransferase by promoter hypermethylation is a common event in multiple human neoplasia.
Cancer Res.
,
59
:
793
-797,  
1999
.
12
Katzenellenbogen R. A., Baylin S. B., Herman J. G. Hypermethylation of the DAP-kinase CpG island is a common alternation in B-cell malignancies.
Blood
,
93
:
4347
-4353,  
1999
.
13
Lo K. W., Cheung S. T., Leung S. F., van Hasselt A., Tsang Y. S., Mak K. F., Chung Y. F., Woo J. K. S., Lee J. C. K., Huang D. P. Hypermethylation of the p16 gene in nasopharyngeal carcinoma.
Cancer Res.
,
56
:
2721
-2725,  
1996
.
14
Lo K. W., Kwong J., Hui A. B. Y., Chan S. Y. Y., To K. F., Chan A. S. C., Chow L. S. N., Teo P. M. L., Johnson P. J., Huang D. P. High frequency of promoter hypermethylation of RASSF1A in nasopharyngeal carcinoma.
Cancer Res.
,
61
:
3877
-3881,  
2001
.
15
Belinsky S. A., Nikula K. J., Palmisano W. A., Michels R., Saccomanno G., Gabrielson E., Baylin S. B., Herman J. G. Aberrant methylation of p16INK4a is an early event in lung cancer and a potential biomarker for early diagnosis.
Proc. Natl. Acad. Sci. USA
,
95
:
11891
-11896,  
1998
.
16
Huang D. P., Lau W. H., Lung M., Saw D., Lui M. Establishment of a cell line (NPC/HK1) from a differentiated squamous carcinoma of nasopharynx.
Int. J. Cancer
,
26
:
127
-132,  
1980
.
17
Cheung S. T., Huang D. P., Hui A. B., Lo K. W., Ko C. W., Tsang Y. S., Wong N., Whitney B. M., Lee J. C. K. Nasopharyngeal carcinoma cell line (C666-1) consistently harboring Epstein-Barr virus.
Int. J. Cancer
,
83
:
121
-126,  
1999
.
18
Huang D. P., Ho J. H. C., Chan W. K., Lau W. H., Lui M. Cytogenetics of undifferentiated carcinoma xenografts from southern Chinese.
Int. J. Cancer
,
43
:
936
-939,  
1989
.
19
Lo K. W., Tsao S. W., Leung S. F., Choi P. H. K., Lee J. C. K., Huang D. P. Detailed deletion mapping on the short arm of chromosome 3 in nasopharyngeal carcinoma.
Int. J. Oncol.
,
4
:
1359
-1364,  
1994
.
20
Shanmugaratnam K. Histological typing of upper respiratory tract tumor .
International Histological Typing of Tumors
,
19
:
19
-29, WHO Geneva  
1978
.
21
Ho J. H. C. Stage classification of nasopharyngeal carcinoma: a review de Thé G. Ito Y. eds. .
Nasopharyngeal Carcinoma: Etiology and Control, IARC Scientific Publ. No. 20
,
:
99
-113, WHO New York  
1978
.
22
Herman J. G., Graff J. R., Myohanen S., Nelkin B. D., Baylin S. B. Methylation-specific PCR. A novel PCR assay for methylation status of CpG islands.
Proc. Natl. Acad. Sci. USA
,
93
:
9821
-9826,  
1996
.
23
Sirchia S. M., Ferguson A. T., Sironi E., Subramanyan S., Orlandi R., Sukumar S., Sacchi N. Evidence of epigenetic changes affecting the chromatin state of the retinoic acid receptor β2 promoter in breast cancer cells.
Oncogene
,
19
:
1556
-1563,  
2000
.
24
Esteller M., Tortola S., Toyota M., Capella G., Peinado M. A., Baylin S. B., Herman J. G. Hypermethylation-associated inactivation of p14ARF is independent of p16INK4a methylation and p53 mutational status.
Cancer Res.
,
60
:
129
-133,  
2000
.
25
Esteller M., Corn P. G., Urena J. M., Gabrielson E., Baylin S. B., Herman J. G. Inactivation of glutathione S-transferase P1 gene by promoter hypermethylation in human neoplasia.
Cancer Res.
,
58
:
4515
-4518,  
1998
.
26
Baylin S. B., Herman J. G. DNA hypermethylation in tumorigenesis: epigenetics joins genetics.
Trends Genet.
,
16
:
168
-174,  
2000
.
27
Esteller M., Corn P. G., Baylin S. B., Herman J. G. A gene hypermethylation profile of human cancer.
Cancer Res.
,
61
:
3225
-3229,  
2001
.
28
Dammann R., Li C., Yoon J-H., Chin P. L., Bates S., Pfeifer G. P. Epigenetic inactivation of a RAS association domain family protein from the lung tumor suppressor locus 3p21.3.
Nat. Genet.
,
25
:
315
-319,  
2000
.
29
Kim S. T., Lim D. S., Canman C. E., Kastan M. B. Substrate specificities and identification of putative substrates of ATM kinase family members.
J. Biol. Chem.
,
274
:
37538
-37543,  
1999
.
30
Dammann R., Yang G., Pfeifer G. P. Hypermethylation of the CpG island of Ras association domain family 1A (RASSF1A), a putative tumor suppressor gene from the 3p21.3 locus, occurs in a large percentage of human breast cancers.
Cancer Res.
,
61
:
3105
-3109,  
2001
.
31
Agathanggelou A., Honorio S., Macartney D. P., Martinez A., Dallol A., Rader J., Fullwood P., Chauhan A., Walker R., Shaw J. A., Hosoe S., Lerman M. I., Minna J. D., Maher E. R., Latif F. Methylation associated inactivation of RASSF1A from region 3p21.3 in lung, breast, and ovarian tumors.
Oncogene
,
20
:
1509
-1518,  
2001
.
32
Burbee D. G., Forgacs E., Zöchbauer-Müller S., Shivakumar L., Fong K., Gao B., Randle D., Kondo M., Virmani A., Bader S., Sekido Y., Latif F., Milchgrub S., Toyooka S., Gazdar A. F., Lerman M. I., Zabarovsky E., White M., Minna J. D. Epigenetic inactivation of RASSF1A in lung and breast cancers and malignant phenotype suppression.
J. Natl. Cancer Inst.
,
93
:
691
-699,  
2001
.
33
Ueki T., Toyota M., Sohn T., Yeo C. J., Issa J-P. J., Hruban R. H., Goggins M. Hypermethylation of multiple genes in pancreatic adenocarcinoma.
Cancer Res.
,
60
:
1835
-1839,  
2000
.
34
Widschwendter M., Berger J., Hermann M., Müller H. M., Amberger A., Zeschnigk M., Widschwendter A., Abendstein B., Zeimet A. G., Daxenbichler G., Marth C. Methylation and silencing of the retinoic acid receptor-β2 gene in breast cancer.
J. Natl. Cancer Inst. (Bethesda)
,
92
:
826
-832,  
2000
.
35
Yang Q., Mori I., Shan L., Nakamura M., Nakamura Y., Utsunomiya H., Yoshimura G., Suzuma T., Tamaki T., Umemura T., Sakurai T., Kakudo K. Biallelic inactivation of retinoic acid receptor β2 gene by epigenetic change in breast cancer.
Am. J. Pathol.
,
158
:
299
-303,  
2001
.
36
Virmani A. K., Rathi A., Zöchbauer-Müller S., Sacchi N., Fukuyama Y., Bryant D., Maitra A., Heda S., Fong K. M., Thunnissen F., Gazdar A. F. Promoter methylation and silencing of the retinoid acid receptor-β gene in lung carcinomas.
J. Natl. Cancer Inst. (Bethesda)
,
92
:
1303
-1307,  
2000
.
37
Sanchez-Cespedes M., Esteller M., Wu L., Nawroz-Danish H., Yoo G. H., Koch W. M., Jen J., Herman J. G., Sidransky D. Gene promoter hypermethylation in tumors and serum of head and neck cancer patients.
Cancer Res.
,
60
:
892
-895,  
2000
.
38
Serrano M., Hannon G. J., Beach D. A new regulatory motif in cell-cycle control causing specific inhibition of cyclin D/CDK4.
Nature (Lond.)
,
366
:
704
-707,  
1993
.
39
Lo K. W., Huang D. P., Lau K. M. p16 gene alternations in nasopharyngeal carcinoma.
Cancer Res.
,
55
:
2039
-2043,  
1995
.
40
Zhang Y., Xiong Y., Yarbrough W. G. ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways.
Cell
,
92
:
725
-734,  
1998
.
41
Hannon G. J., Beach D. p15INK4B is a potential effector of TGF-β-induced cell cycle.
Nature (Lond.)
,
371
:
257
-261,  
1994
.
42
Pegg A. E. Mammalian O6-alkylguanine-DNA alkyltransferase regulation and importance in response to alkylating carcinogenic and therapeutic agents.
Cancer Res.
,
50
:
6119
-6129,  
1990
.
43
Esteller M., Toyota M., Sanchez-Cespedes M., Capella G., Peinado M. A., Watkins D. N., Issa J. P., Sidransky D., Baylin S. B., Herman J. G. Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is associated with G to A mutations in K-ras in colorectal tumorigenesis.
Cancer Res.
,
60
:
2368
-2371,  
2000
.
44
Esteller M., Garcia-Foncillas J., Andion E., Goodman S. N., Hidalgo O. F., Vanaclocha V., Baylin S. B., Herman J. G. Inactivation of the DNA-repair gene MGMT and the clinical response of gliomas to alkylating agents.
N. Engl. J. Med.
,
343
:
1350
-1354,  
2000
.
45
Daniel V. Glutathione S-transferases. Gene structure and regulation of expression.
Crit. Rev. Biochem. Mol. Biol.
,
28
:
173
-207,  
1993
.
46
Esteller M., Sanchez-Cespedes M., Rosell R., Sidransky D., Baylin S. B., Herman J. G. Detection of aberrant promoter hypermethylation of tumor suppressor gene in serum DNA from non-small cell lung cancer patients.
Cancer Res.
,
59
:
67
-70,  
1999
.
47
Palmisano W. A., Divine K. K., Saccomanno G., Gilliland F. D., Baylin S. B., Herman J. G., Belinsky S. A. Predicting lung cancer by detecting aberrant promoter methylation in sputum.
Cancer Res.
,
60
:
5954
-5958,  
2000
.
48
Rosas S. L. B., Koch W., Carvalho M. d. G. d. C., Wu L., Califano J., Westra W., Jen J., Sidransky D. Promoter hypermethylation patterns of p16, O6-methylguanine-DNA-methyltransferase, and death-associated protein kinase in tumors and saliva of head and neck cancer patients.
Cancer Res.
,
61
:
939
-942,  
2001
.
49
Tune C. E., Liavaag P-G., Freeman J. L., van den Brekel M. W. M., Shpitzer T., Kerrebijn J. D. F., Payne D., Irish J. C., Ng R., Cheung R. K., Dosch H-M. Nasopharyngeal brush biopsies and detection of nasopharyngeal cancer in a high-risk population.
J. Natl. Cancer Inst. (Bethesda)
,
91
:
796
-800,  
1999
.