Purpose:

We recently reported that the transcription factor NFATC4, in response to chemotherapy, drives cellular quiescence to increase ovarian cancer chemoresistance. The goal of this work was to better understand the mechanisms of NFATC4-driven ovarian cancer chemoresistance.

Experimental Design:

We used RNA sequencing to identify NFATC4-mediated differential gene expression. CRISPR-Cas9 and FST (follistatin)-neutralizing antibodies were used to assess impact of loss of FST function on cell proliferation and chemoresistance. ELISA was used to quantify FST induction in patient samples and in vitro in response to chemotherapy.

Results:

We found that NFATC4 upregulates FST mRNA and protein expression predominantly in quiescent cells and FST is further upregulated following chemotherapy treatment. FST acts in at least a paracrine manner to induce a p-ATF2–dependent quiescent phenotype and chemoresistance in non-quiescent cells. Consistent with this, CRISPR knockout (KO) of FST in ovarian cancer cells or antibody-mediated neutralization of FST sensitizes ovarian cancer cells to chemotherapy treatment. Similarly, CRISPR KO of FST in tumors increased chemotherapy-mediated tumor eradication in an otherwise chemotherapy-resistant tumor model. Suggesting a role for FST in chemoresistance in patients, FST protein in the abdominal fluid of patients with ovarian cancer significantly increases within 24 hours of chemotherapy exposure. FST levels decline to baseline levels in patients no longer receiving chemotherapy with no evidence of disease. Furthermore, elevated FST expression in patient tumors is correlated with poor progression-free, post–progression-free, and overall survival.

Conclusions:

FST is a novel therapeutic target to improve ovarian cancer response to chemotherapy and potentially reduce recurrence rates.

Translational Relevance

Quiescent cancer cells are resistant to chemotherapy and can drive disease recurrence and mortality. We find that innately quiescent ovarian cancer cells, in response to chemotherapy, secrete follistatin (FST) to induce a chemoresistant quiescent state in neighboring cells. Patient samples confirm a significant induction of FST within 24 hours of chemotherapy administration. Importantly, inhibition of FST sensitizes tumor cells to chemotherapy, and knockout of FST increases cancer cure rates in mice. Combined this work identifies FST as a clinical target to overcome chemotherapy resistance and potentially increases ovarian cancer cure rates.

Ovarian cancer remains one of the deadliest cancers in terms of survival outcomes. This relates in large part to the fact that, whereas approximately 70% of patients obtain a complete clinical remission with a combination surgery and chemotherapy, 70% of these responders will have residual-resistant cancer cells that drive relapse and ultimately the patient's death from ovarian cancer. Consequently, identifying novel, therapeutically actionable drivers of chemoresistance is a critical need for ovarian cancer research.

The ability of cells to enter a reversible non-dividing state, termed quiescence, contributes to chemotherapy resistance (1–3). Quiescent cells have been shown to contribute therapeutic resistance in many settings and tumor types, including breast, liver and pancreatic cancer, glioblastoma, leukemia, and melanoma (4). This is at least in part due to chemotherapeutics primarily targeting rapidly dividing cells. However, quiescent cancer cells are enriched in the pool of cancer stem-like cells (CSC), and other mechanisms of chemotherapy resistance are also possible. Quiescence is linked with tumor dormancy, another driver of disease recurrence (5, 6).

Quiescence plays a significant role in ovarian cancer and chemotherapy resistance (7–9). We recently demonstrated that the transcription factor NFATC4 (also known as NFAT3) is enriched in ovarian CSCs and, in response to chemotherapy, is translocated to the nucleus to induce transcription (3). Transcriptional activation of NFATC4 results in the induction of cellular quiescence and a chemoresistant state. However, the mechanisms of NFATC4-induced quiescence remain unclear. Here, we identified 141 genes upregulated 24, 48, and 96 hours after NFATC4 activation. We validate induction of mRNA expression of 6 genes, including follistatin (FST).

FST is a secreted factor known to play a critical role in ovarian biology (10). Canonically, FST functions by binding to and inactivating extracellular TGF-BMP (bone morphogenetic protein) family members to regulate their signaling (10). More recent work demonstrated that FST has a nuclear localization signal and can function in the nucleolus to (i) inhibit nucleolar RNA synthesis and (ii) restrict cell proliferation in response to glucose deprivation (11). The role of FST in ovarian cancer is poorly studied. Most FST-associated studies evaluate a role for FST in fertility therapy as a potential risk factor for developing ovarian cancer (12). However, indicating a possible role as a regulator of cancer cell proliferation, FST expression in ovarian cancer is decreased with the loss of BRCA1 resulting in an increase in cellular proliferation (13). Suggesting a potential role in therapeutic resistance, Iyer and colleagues (14) found that FST upregulated in a mouse model of CCNE1-amplified ovarian cancer drives immunotherapy resistance. Interestingly, a recent GWAS study linked the FST locus to increased ovarian cancer risks in women of African ancestry (15).

We find that FST is upregulated in quiescent ovarian cancer cells and secreted following both NFATC4 induction, serum withdrawal (a known driver of quiescence), and chemotherapy exposure. FST subsequently drives a quiescent, chemotherapy-resistant phenotype in otherwise non-quiescent cells in a p-ATF2–dependent manner. FST inhibition with neutralizing antibody or FST CRISPR knockout (KO) resulted in increased response to chemotherapy in vitro, and FST-KO significantly increased chemotherapy response and tumor eradication in vivo. Finally, we found that FST levels in the peritoneal fluid taken from patients immediately after chemotherapy treatment increased significantly. Following completion of chemotherapy, peritoneal FST declined to baseline levels. Together, these data suggest a novel mechanism whereby inherently chemotherapy-resistant quiescent cells, in response to chemotherapy, secrete FST to induce therapy resistance in neighboring cancer cells.

Cell culture

SKOV3, CaOV3, and HEY1 lines were purchased from the ATCC (2018). OVSAHO cells were gifted from Dr. Deborah Marsh from the University of Sydney. PT412, provided by Dr. Geeta Mehta, was derived from an abdominal metastasis from a patient with platinum-sensitive high-grade serous ovarian cancer (HGSOC) as previously described (16). The Pt340 cell line was derived from an abdominal metastasis from a patient with mixed high-grade serous and clear cell carcinoma (Supplementary Fig. S1) with ARID1A mutation. Both cell lines were cultured in RPMI10 and were used at passage approximately 12–14. SKOV3 cells were cultured in McCoy's Medium, CAOV3 were in DMEM, and all others were cultured in RPMI1640 media. All media contained 10% FBS 1% Pen/Strep. Cells were cultured at 37°C and 5% CO2. All cell lines were tested bimonthly for presence of Mycoplasma.

Constructs

NFATc4 constructs were generated and validated as previously described (3). A constitutively nuclear NFATC4–YFP fusion (cNFATC4) with the phospho-regulatory domain deleted or an YFP-only control (Control-YFP) were cloned into a pGIPZ lentiviral vector and transduced into the OVSAHO HGSOC cell line. A second, phospho-specific mutant constitutively active NFATC4 (17) was also cloned into the doxycycline-inducible Tet-One expression system (Clontech) to create an inducible and constitutive NFATC4 (IcNFATC4) in the HEY1 and SKOV3 ovarian cancer cell lines. An inducible luciferase (ILuc) construct served as a control.

RNA sequencing

HEY1 and SKOV3 cell lines expressing the IcNFATC4 or ILUC constructs were treated for 24, 48, and 96 hours with 100 ng/mL doxycycline and RNA extracted using the miRNeasy Mini Kit (Qiagen, 217004) according to the manufacturer's guidelines. RNA quality was determined using a Bioanalyzer chip and RNA integrity number >7 was deemed acceptable. Novogene Bioinformatics Technology Co., Ltd., constructed 250–300 bp insert polyA-selected cDNA library and ran the sequencing on the NextSeq platform (Illumina) according to 150 bp paired-ends protocol. Twenty million reads were sequenced per sample. Pre-processing of the sequencing data were performed by Novogene. Briefly, the sequencing reads were checked for quality, adapters were trimmed, and the reads were aligned to the hg19 by Novogene. RNA sequencing (RNA-seq) counts summarized at gene level were used in downstream analyses. Approximately 14,000 genes with an average RNA-seq count >10 were included in subsequent analyses. Differential gene expression was performed by the R/Bioconductor package DESeq2 (https://doi.org/10.1186/s13059-014-0550-8). Gene Ontology analysis was conducted using the R/Bioconductor package clusterProfiler (https://doi.org/10.1016/j.xinn.2021.100141).

Quantitative PCR

RNA was extracted using the RNeasy Mini Kit (Qiagen) and cDNA was made using SuperScript III Reverse Transcription kit (Thermo Fisher Scientific). qPCR was performed using SYBR Green PCR Master Mix (Applied Biosystems) using standard cycling conditions. The primers used for this study are available in Supplementary Material (Supplementary Table S1).

Protein phosphorylation arrays

C-Series phosphorylation arrays were performed according to the manufacturer's recommendations (RayBiotech, Inc. # AAH-TGFB-1–2). Briefly, PT412 cells were treated with or without 200 ng/mL FST for 6 hours before protein was extracted, quantified, and normalized between samples. Protein was incubated on antibody array membranes, followed antibody TGFβ signaling detection cocktail amplification, and detection as per the manufacturer's instructions. Chemiluminescent readings were taken using a ChemiDoc MP imaging system (Bio-Rad Laboratories, Inc.) and densitometry data extracted using ImageJ software. Readings were normalized to the positive loading controls and membrane background signal subtracted.

CellTrace violet

Ovarian cancer cell lines were labeled using CellTrace Violet (CTV; Thermo Fisher Scientific, C34557) following the manufacturer's protocol. Labeled cells were grown for 7 to 10 days before cells were FACS isolated for subsequent experiment; the top 5% of labeled cells were collected as CTV-bright (slowly/non-dividing) whereas the lowest 5% of labeled cells were considered CTV-dim (rapidly dividing).

Transwell assay

Transwell assays used 6.5-mm membrane inserts with a 0.4-μm pore size (Costar Cat#3413). CTV-bright or dim PT412 cells were seeded in RPMI10 in the top/bottom chamber, respectively, and chamber location was reversed for replicate experiments (Supplementary Fig. S4A). Twenty-four hours after seeding, cells were treated with paclitaxel 11 nmol/L for 48 hours and then adherent cells were fixed with 4% formaldehyde, stained with crystal violet, and counted.

Cell counting

Cell counts were performed using the Moxi Z automated counting system (ORLFO Technologies) and the Cassettes Type S. In cases where cell numbers were below the accurate threshold for the Moxi Z, manual hemocytometer counts were performed with trypan blue.

Cell-cycle analysis

Cell-cycle analysis was performed on OVSAHO and CaOV3 cell lines and the primary patent sample PT340 as previously published (18). Briefly, cells were grown at low seeding densities in 0 or 200 ng/mL FST for 48 hours. Cells were fixed in 70% ethanol and, incubated at −20°C for 20 minutes, before being treated with 0.1 μg/mL RNAse A for 1 hour at 37°C and 1 μg/mL propidium iodide (PI) for 20 minutes, and run on the Cytoflex flow cytometer (Beckman–Coulter); at least 10,000 events were recorded. Cell-cycle peaks were analyzed using FlowJo v10.6.2.

Annexin V/PI staining

For apoptosis detection via Annexin V staining, CaOV3 and OVSAHO cells were grown in 0 or 200 ng/mL FST for 72 hours. Cells were stained with the Annexin-V FITC apoptosis kit (BD Biosciences) according to the manufacturer's instructions and at least 10,000 events were analyzed on the Cytoflex flow cytometer (Beckman–Coulter). The percentage of Annexin V+, PI+, Annexin V+/PI+, and Annexin V/PI cells was quantified.

Western blotting

Western blotting was performed as described previously (19). Briefly, OVSAHO and HEY1 cells expressing the cNFATC4/YFP or IcNFATC4/ILUC constructs were grown to 80% confluence with or without Dox treatment for 72 hours. Protein was lysed in RIPA buffer containing Halt Protease Inhibitor Cocktail (Thermo Fisher Scientific), sonicated, and quantified using Pierce BCA Protein Assay Kit. Thirty μg of protein was run on a 4%–12% NuPAGE SDS gel (Thermo Fisher Scientific) and transferred to a polyvinylidene difluoride membrane (Thermo Fisher Scientific). Membranes were incubated overnight with 1:1,000 anti-FST (Abcam, ab64490), 1:1,000 anti-NFATC4 (Santa Cruz Biotechnology, sc-271597), or 1:5,000 anti-GAPDH (Proteintech cat# 60004–1-1 g) antibodies in 5% skim milk. Membranes were washed in TBST, then incubated for 1 hour with 1:10,000 anti-mouse HRP (horseradish peroxidase) or anti-rabbit HRP (Cell Signaling Technology) and rewashed with TBST. Visualization was performed with ECL Plus Western Blotting Substrate (Pierce). Densitometry and quantification were subsequently performed with ImageJ.

GolgiPlug

GolgiPlug experiments were used to evaluate FST protein levels following NFATC4 overexpression due to its tendency to be secreted and hence make it difficult to interpret Western data. HEY1 and OVSAHO cell lines expressing the cNFATC4/YFP or IcNFATC4/ILUC constructs were treated with or without 1:1,000 BD GolgiPlug Protein Transport Inhibitor (BD Biosciences) for 4 hours. Protein was harvested, and Western Blotting performed as described above.

Fucci cell-cycle reporters

HEY1 cells expressing the p27-mVenus and CDT1-mCherry FUCCI cell-cycle reporter constructs (20) were treated with or without 200 ng/mL FST and flow cytometry analysis was performed.

FST ELISA

To investigate FST secretion from cell lines and patients, an FST ELISA was performed. Ascites samples from patients with HGSOC who had or had not received primary chemotherapy were collected. HEY1 cells expressing IcNFATC4/ILUC constructs were treated with Dox for 72 hours, and culture media were collected. Culture media were also collected from CaOV3 and OVSAHO cells treated with or without paclitaxel and cisplatin for 72 hours. Patient ascites samples were diluted 1:2, whereas cell culture media were undiluted. The FST Human ELISA Kit (Thermo Fisher Scientific, #EHFST) was used to quantify FST levels using the manufacturer's instructions and an overnight antibody incubation. The ELISA plate was then run on Infinite M plex, Tecan LTD plate reader and FST concentrations were calculated for each sample using a standard curve.

Patient samples

All patient samples were collected as part of a University of Pittsburgh IRB-approved protocol. Ascites and intraperitoneal (IP) samples from cohort 1 were collected as part of standard-of-care therapy under tissue collection protocol UPCI 07–058. Pre/post-chemotherapy treatment, samples were collected as part of a clinical trial (NCT03734692). All patients had chemonaive or platinum-sensitive HGSOC. Before chemotherapy treatment, 50 mL of saline was injected via intraperitoneal port and after approximately 5 minutes, 30–50 mL of fluid was retrieved. For cohort 2, patients treated with intraperitoneal cisplatin chemotherapy day 1, peritoneal washes were taken (as above) on day 2 before intraperitoneal therapy with rintatolimod (TLR3 agonist) and intravenous therapy with pembrolizumab D3 (21).

Generation of KO cells through CRISPR

The AMAXA 4D system was used to nucleoporate SKOV3 cells with 30 mmol/L FST sgRNA (sgRNA #1 UCUUGUACAGGACCUGGCAG, or sgRNA #2 GUUCGGUCUUGUACAGGACC) and 3.22 mg/mL of Cas9 (Lonza Kit cat#V4XP-3032). For mock transfection water was used instead of sgRNA. SKOV3 cells were nucleoporated with pre-settings following the manufacturer's instruction. The transfected cells were cultured under the standard McCoy's media 5 days to assess survival. FST knockout was confirmed using Western blotting (Fig. 6A). The sgRNA sequences were designed and purchased with Synthego.

In vivo model

Six-week-old female NSG (NOD.Cg-Prkdcscid) mice were acquired from The Jackson Laboratory and allowed to acclimate one week in the animal facility before any intervention was initiated. All experimental procedures were conducted with the guidelines set by The Institute for Laboratory Animal Research of the National Academy of Sciences. For the FST and Ki67 IHC staining experiment, 500,000 OVSAHO cells were xenografted into mice and grown until reaching approximately 1,000 mm3 at which point mice were treated with DMSO or 30 mg/kg paclitaxel. Seventy-two hours after treatment, mice were euthanized and their tumors were paraffin embedded and processed for IHC.

For the FST-KO in vivo experiments, 300,000 control or FST-KO SKOV3 cells were injected intraperitoneally (n = 10 animals/treatment group) in PBS. One week after tumor injection, animals were treated with paclitaxel at a dose of 10 mg/kg once a week for three weeks. Mouse weight was followed once a week. Criteria for euthanasia were as previously published (22), briefly: (i) increase of 1 cm of abdominal perimeter and/or (ii) changes in physiology and behavior (body weight, external pH or physical appearance); (iii) lower response to stimulation (inability to reach food and water, lethargy or decreased mental awareness, labored breathing, or inability to remain upright).

IHC

Fresh tumors were harvested in linear growth phase (∼1,000 mm3) and embedded in formalin. Then, they were processed and embedded in paraffin 5-μm thickness, as in previously described protocols (23). Primary anti-rabbit Ki67 (1:500, Abcam #ab15580) and anti-rabbit FST (1:200, Abcam #ab64490) were incubated for overnight hours at 4°C. Subsequently, slides were incubated with a ready-to-use peroxidase-labeled anti-mouse HRP or anti-rabbit AP (Cell Signaling Technology). Signal was visualized with Forangi Blue/HRP (to label Ki67 in blue) solution according to the manufacturer's instructions and counterstained with the Fast Red/AP (to label FST in red) Substrate Kit (Abcam, ab64254). Ki67 and FST IHC were performed on 6 to 8 independent sections of 3 independent OVSAHO cell–derived tumors (paclitaxel or no-paclitaxel treatment, seven days before collection). Images were captured on an Olympus BX41 fluorescent microscope with a 12 MB digital camera at 16-bit depth/300 dpi. Total stain area/low power field (×100), as defined by pixel area (X:Y 1:1).

Statistical analysis and software

Statistical analysis was conducted using GraphPad Prism (8.0.2) and http://vassarstats.net/. All data were analyzed using two-tailed Student t tests or one-way ANOVA. A minimum of 3 replicate experiments (n ≥ 3) were used for statistical analysis. Data were plotted mean ± SEM. BioRender (Created with BioRender.com) was used to produce schematics.

Data availability statement

The data analyzed in this study were obtained from Gene Expression Omnibus GSE210439. Other data generated in this study are available upon request from the corresponding author.

Identifying factors induced by NFATC4

We have previously shown that in NFATC4 transcriptional activity is activated in ovarian cancer cells in response to chemotherapy to drive a quiescent chemoresistant state (3). To identify NFATC4 transcription targets, we performed RNA-seq on SKOV3 and HEY1 ovarian cell lines with an inducible constitutive NFATC4 expression construct (IcNFATC4) or luciferases control (ILUC; ref. 3) 24, 48, and 96 hours after induction (Supplementary Fig. S2A). As expected, HEY and SKOV3 cells exhibit cell-type–specific gene expression profiles that are similar in ILUC (negative controls) across all time points (Fig. 1A and B; Supplementary Fig. S2B). Upon activation of NFACT4, while maintaining overall cell-type–specific expression profiles, we saw significant changes in gene expression in both cell lines (Fig. 1A and B; Supplementary Fig. S2B and S2C). A total of 141 genes were found to be significantly differentially expressed at all time points in both cell lines upon NFATC4 induction (Fig. 1C).

Figure 1.

RNA-seq of SKOV3 and HEY1 cells overexpressing NFATC4. HEY1 and SKOV3 cells expressing NFATC4, or luciferase control were treated with 100 ng/mL doxycycline for 24, 48, and 96 hours before RNA-seq. A, Principal component analysis (PCA) of HEY1 and SKOV3 RNA-seq datasets. B, Volcano plots of differential gene expression between SKOV3 and HEY1 cell lines expressing NFATC4 compared with the Luciferases control. C, Venn Diagram demonstrating the number of common genes upregulated in each cell line at each time point compared with the luciferase control. D, Gene Ontology analysis of the top upregulated pathways following NFACT4 activation. G-protein couple receptor (GPCR) signaling pathway (SP) structural organization (SO). E, Bubble plot displaying the top 6 upregulated genes (log2 fold change). F, qPCR validation of the NFATC4 and the top five most upregulated mRNAa (RCAN1, CNN1, COL3A1, FST, and ANO1) in the NFATC4 cells versus Luciferases control. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Figure 1.

RNA-seq of SKOV3 and HEY1 cells overexpressing NFATC4. HEY1 and SKOV3 cells expressing NFATC4, or luciferase control were treated with 100 ng/mL doxycycline for 24, 48, and 96 hours before RNA-seq. A, Principal component analysis (PCA) of HEY1 and SKOV3 RNA-seq datasets. B, Volcano plots of differential gene expression between SKOV3 and HEY1 cell lines expressing NFATC4 compared with the Luciferases control. C, Venn Diagram demonstrating the number of common genes upregulated in each cell line at each time point compared with the luciferase control. D, Gene Ontology analysis of the top upregulated pathways following NFACT4 activation. G-protein couple receptor (GPCR) signaling pathway (SP) structural organization (SO). E, Bubble plot displaying the top 6 upregulated genes (log2 fold change). F, qPCR validation of the NFATC4 and the top five most upregulated mRNAa (RCAN1, CNN1, COL3A1, FST, and ANO1) in the NFATC4 cells versus Luciferases control. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Close modal

Gene Ontology analysis identified 20 upregulated pathways (Fig. 1D). Consistent with a role for NFATC4 expression in CSC and in regulating cell fate, changes in developmental and differentiation pathways were linked with NFATC4 expression (Fig. 1D). The Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) analysis of the 141 genes (Supplementary Fig. S2E) identified development, extracellular matrix, and secretion as the top pathways.

Evaluation of specific differentially expressed genes indicated that, as expected, NFATC4 was a significantly upregulated gene in all six conditions (Fig. 1E). RCAN1, a known NFATC4 target gene, was also highly upregulated. The top six most upregulated mRNA across all time points were NFATC4, RCAN1, CNN1, COL3A1, FST, and ANO1 (Fig. 1E). Consistent with our previous work (3), we also identified a decrease in MYC expression in both cell lines at 24 hours (Supplementary Fig. S2D); however, MYC increased expression at 96 hours in SKOV3, suggesting alternate cell-specific downstream signaling. qRT-PCR confirmed mRNA upregulation of RCAN1, CNN1, COL3A1, FST, and ANO1 (Fig. 1F); RCAN1, CNN1, ANO1, and FST were all expressed 24 hours after NFATC4 induction with expression peaked 48 hours after NFATC4 activation in both cell lines. COL3A1 mRNA was similarly induced in SKOV3 cells, but in HEY1 cells, induction was not seen until 48 hours, peaking at 96 hours.

NFATC4 increases FST protein levels and secretion

Given that FST plays a critical role in ovarian development and function (10) and has been found to be elevated in the serum of patients with ovarian cancer (12), we decided to further investigate the function of FST downstream of NFATC4. To confirm that an increase in FST mRNA expression translated to an increase in FST protein levels, we treated HEY1-IcNFATC4 or HEY1-ILUC control cells with doxycycline for 72 hours, in the presence or absence of GolgiPlug (to inhibit protein secretion), and then performed Western blotting. Although FST was not detectable in ILUC control cells, FST was clearly detectable in doxycycline-induced, GolgiPlug-treated NFATC4 cells (Fig. 2A; P < 0.05). To confirm this response in an HGSOC cell line, we transfected OVSAHO cells with a constitutively active cNFATC4 or control-YFP and treated with or without GolgiPlug. OVSAHO cells showed baseline FST protein expression in YFP-transfected control cells; however, expression of cNFATC4 resulted in an approximately 7-fold induction of FST compared with controls (Fig. 2B).

Figure 2.

NFATC4 overexpression, resulting in a significant increase in FST protein levels and secretion. Immunoblotting for NFAT3 and FST protein levels in HEY1 (A) and OVSAHO (B) cells expressing an inducible or transient NFATC4 expression construct, respectively. Cells were treated with GolgiPlug (GP) for 4 hours to retain secreted proteins. C, ELISA of FST secretion from HEY1 cells expressing ILUC or NFATC4 treated with Dox for 72 hours. D,FST mRNA expression in primary ovarian cancer cell lines (PT340 and PT412) sorted on the basis of CellTrace Violet retention. Bright, slowly dividing; Dim, rapidly dividing. E,FST mRNA expression in PT340 and PT412 cells FACS sorted for CD133+/ALDH+ CSC populations and CD133/ALDH bulk cells. F, Flow cytometry histograms of CellTrace Violet retention in PT340 cells treated with various concentrations of cisplatin. G, FST protein levels in PT340 and PT412 cells grown in the presence or absence of serum for 18, 24, or 48 hours. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Figure 2.

NFATC4 overexpression, resulting in a significant increase in FST protein levels and secretion. Immunoblotting for NFAT3 and FST protein levels in HEY1 (A) and OVSAHO (B) cells expressing an inducible or transient NFATC4 expression construct, respectively. Cells were treated with GolgiPlug (GP) for 4 hours to retain secreted proteins. C, ELISA of FST secretion from HEY1 cells expressing ILUC or NFATC4 treated with Dox for 72 hours. D,FST mRNA expression in primary ovarian cancer cell lines (PT340 and PT412) sorted on the basis of CellTrace Violet retention. Bright, slowly dividing; Dim, rapidly dividing. E,FST mRNA expression in PT340 and PT412 cells FACS sorted for CD133+/ALDH+ CSC populations and CD133/ALDH bulk cells. F, Flow cytometry histograms of CellTrace Violet retention in PT340 cells treated with various concentrations of cisplatin. G, FST protein levels in PT340 and PT412 cells grown in the presence or absence of serum for 18, 24, or 48 hours. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Close modal

To confirm secretion of FST following NFATC4 activation, we once again treated HEY1 cells expressing IcNFATC4 or ILUC constructs with doxycycline for 72 hours and then performed an FST ELISA on the conditioned media. Conditioned media from NFATC4 expressing cells had 95 times higher FST levels than conditioned media from the ILUC control cells (Fig. 2C; P < 0.001).

FST is enriched in quiescent cells and acts as a paracrine-signaling factor to suppress cell proliferation

We previously demonstrated that NFATC4, whose expression drives FST expression, is enriched in slowly dividing CSCs (3). To confirm FST is expressed in quiescent HGSOC, we performed vital dye labeling using CTV of two primary patient cell lines, PT340 and PT412. Ten days after labeling, we FACS isolated the slowly/non-dividing (CTV-bright) and rapidly dividing (CTV-dim) cells. Slowly dividing cells had 4.4- and 23-fold higher FST expression in PT412 (P < 0.01) and PT340 (P < 0.01) cells, respectively (Fig. 2D). Consistent with our prior reports that primary human CD133+/ALDH+ HGSOC CSC are more slowly proliferating (24), FST expression is significantly enriched in CD133+/ALDH+ ovarian CSCs, compared with the CD133/ALDH bulk cell population (PT412, P < 0.05; PT340, P < 0.001; Fig. 2E). Furthermore, cisplatin treatment resulted in a dose-dependent enrichment of slowly/non-dividing (bright) quiescent cells, suggesting quiescent cells are chemoresistant (Fig. 2F). As an independent means to evaluate the induction of quiescence on FST expression, we performed serum withdrawal studies; serum withdrawal is one of the first mechanisms reported to induce quiescence (25). Induction of quiescence through serum withdrawal also resulted in a significant increase in FST protein levels (Fig. 2G).

To determine whether FST secretion contributed to NFATC4-driven quiescence, we next treated HEY1, OVSAHO, and CaOV3 ovarian cancer cells with increasing concentrations of recombinant FST for 72 hours and evaluated total cell counts. FST treatment led to a dose-dependent reduction in cell numbers, with an approximately 30% reduction of total cell numbers in all cell lines at the highest FST dose (Fig. 3A). Similarly, FST treatment of the two primary HGSOC patient samples also resulted in a significant decrease in cell number (PT340, P < 0.001; PT412, P < 0.0001; Supplementary Fig. S3A). Confirming the specificity of FST effect, FST-driven reductions in cell growth were reversed with FST-neutralizing antibody (Fig. 3B).

Figure 3.

FST decreases bulk cell proliferation. A, Cell counts of HEY1, CaOV3, and OVSAHO cell lines treated for 72 hours with 0, 10, 100, or 200 ng/mL FST. B, Cell counts of OVSAHO cells treated with indicated concentrations of FST, IgG, and anti–FST-neutralizing antibody. C, Cell viability assay of CaOV3 and OVSAHO cells treated with vehicle or 200 ng/mL FST for 72 hours. D, Cell-cycle analysis of OVSAHO and CaOV3 cells treated with 0 or 200 ng/mL FST for 48 hours. E, HEY1 cells expressing the p27-venus and CDT1-mCherry FUCCI cell-cycle reporter constructs were treated with or without 200 ng/mL FST and flow cytometry analysis was performed; the percentage of p27 and CDT1 double-positive cells was graphed. F, Average fold change in cell counts of PT340 and PT412 (pooled results) CellTrace Violet sorted Bright (slowly dividing) and Dim (rapidly dividing) cell populations treated with vehicle or 200 ng FST. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Figure 3.

FST decreases bulk cell proliferation. A, Cell counts of HEY1, CaOV3, and OVSAHO cell lines treated for 72 hours with 0, 10, 100, or 200 ng/mL FST. B, Cell counts of OVSAHO cells treated with indicated concentrations of FST, IgG, and anti–FST-neutralizing antibody. C, Cell viability assay of CaOV3 and OVSAHO cells treated with vehicle or 200 ng/mL FST for 72 hours. D, Cell-cycle analysis of OVSAHO and CaOV3 cells treated with 0 or 200 ng/mL FST for 48 hours. E, HEY1 cells expressing the p27-venus and CDT1-mCherry FUCCI cell-cycle reporter constructs were treated with or without 200 ng/mL FST and flow cytometry analysis was performed; the percentage of p27 and CDT1 double-positive cells was graphed. F, Average fold change in cell counts of PT340 and PT412 (pooled results) CellTrace Violet sorted Bright (slowly dividing) and Dim (rapidly dividing) cell populations treated with vehicle or 200 ng FST. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001.

Close modal

To confirm the reduction in cell numbers is related to reduced proliferation and not related to increased cell death, we assessed the impact of FST on cell viability. CaOV3 and OVSAHO cells were treated with 200 ng/mL FST for 72 hours, and cell viability was assessed with Annexin V/PI staining. FST did not increase cell death in either cell line (Fig. 3C). Consistent with reduced proliferation, cell-cycle analysis on CaOV3 and OVSAHO treated with FST 48 hours demonstrated an increase in the percentage of cells in G0–G1 (P < 0.001; Fig. 3D). Suggesting that FST may be increasing the number of cells in a quiescent state, FST treatment of HEY1 cells expressing the FUCCI cell-cycle reporters (p27-mVenus/CDT1-mCherry) demonstrated an enrichment in the quiescent p27/CDT1 double-positive population (P < 0.001; Fig. 3E). To determine whether reduced proliferation rates were a result of FST action on proliferating or quiescent cells, we treated isolated CTV-bright and CTV-dim cells with FST (Fig. 3F). Only the rapidly dividing CTV-dim cells decreased cell proliferation, whereas the slowly dividing cells were unaffected. Together these data suggest that FST contributes to NFATC4-driven quiescence, acting in a paracrine manner to reduce cell proliferation of rapidly dividing bulk ovarian cancer cells without affecting cell viability.

FST is upregulated and secreted in response to chemotherapy

To investigate whether FST could be induced in response to chemotherapy and drive chemotherapy resistance, we treated OVSAHO and CaOV3 cells with either cisplatin or paclitaxel and examined FST mRNA and protein expression. Treatment of cells with cisplatin or paclitaxel resulted in a significant, 10–72-fold, increase in FST mRNA (Fig. 4AC). Suggesting that this is at least partially NFAT dependent, treatment with the NFAT-selective peptide inhibitor VIVIT resulted in a significantly abrogated cisplatin-mediated FST induction (Fig. 4B; P < 0.05). Cisplatin and paclitaxel treatment also resulted in a significant increase in FST protein levels as determined by both Western blot (Fig. 4D; P < 0.05), and confirming secretion, ELISA that showed 4–50-fold increases in FST secretion (Fig. 4E; CaOV3/OVSAHO cisplatin P < 0.01; Fig. 4F; CaOV3/OVSAHO paclitaxel P < 0.05). Indicating quiescent cells are a major source of the FST, cisplatin treatment of slowly dividing CTV-bright cells versus proliferating CTV-dim cells, demonstrated that FST secretion is approximately 3-fold higher in the quiescent/bright cells (Fig. 4G).

Figure 4.

Chemotherapy increases FST expression and secretion preferentially in quiescent cancer cells. qPCR of FST expression in CaOV3 and OVSAHO cells treated with the indicated doses of (A) cisplatin or (C) paclitaxel. B, qPCR of FST mRNA expression in CaOV3 cells are treated with cisplatin (2 μg/mL) with or without VIVIT (an NFAT inhibitor). D, Immunoblotting and densitometry of FST protein levels in CaOV3 and OVSAHO cells treated with various doses of cisplatin or paclitaxel. ELISA for FST protein in CaOV3 and OVSAHO cell culture media following treatment with (E) paclitaxel or (F) cisplatin. G, FST ELISA of CellTrace Violet sorted Dim (rapidly dividing) and Bright (slowly dividing) patient cell populations treated ± cisplatin. H, IHC images of HGSOC mouse xenografts treated with or without paclitaxel and stained with both Ki67 (Forangi Blue) and FST (Fast Red). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.001.

Figure 4.

Chemotherapy increases FST expression and secretion preferentially in quiescent cancer cells. qPCR of FST expression in CaOV3 and OVSAHO cells treated with the indicated doses of (A) cisplatin or (C) paclitaxel. B, qPCR of FST mRNA expression in CaOV3 cells are treated with cisplatin (2 μg/mL) with or without VIVIT (an NFAT inhibitor). D, Immunoblotting and densitometry of FST protein levels in CaOV3 and OVSAHO cells treated with various doses of cisplatin or paclitaxel. ELISA for FST protein in CaOV3 and OVSAHO cell culture media following treatment with (E) paclitaxel or (F) cisplatin. G, FST ELISA of CellTrace Violet sorted Dim (rapidly dividing) and Bright (slowly dividing) patient cell populations treated ± cisplatin. H, IHC images of HGSOC mouse xenografts treated with or without paclitaxel and stained with both Ki67 (Forangi Blue) and FST (Fast Red). *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.001.

Close modal

To confirm FST induction by chemotherapy in quiescent cells in vivo, we treated established OVSAHO xenografts with paclitaxel chemotherapy and then resected tumors after therapy. IHC of the xenografts demonstrated untreated control tumors had high levels of Ki67 staining and low FST. In contrast, paclitaxel-treated xenografts demonstrated elevated levels of FST with a reduction in Ki67 staining (Fig. 4H). Quantification indicates a >3-fold increase in FST+ cell bodies in paclitaxel-treated tumors (Supplementary Fig. S3B). Furthermore, FST-expressing cells were generally Ki67 negative/low. Together, these data show that chemotherapy results in an increase in FST expression and secretion in quiescent cells in vitro and in vivo.

FST increases ovarian cancer chemotherapy resistance via ATF2 signaling

We next assessed whether FST promoted chemotherapy resistance. CaOV3 and OVSAHO cells co-treated with paclitaxel or cisplatin and 200 ng/mL FST demonstrated a significant chemotherapy resistance in the presence of FST (Fig. 5A). Cells treated with paclitaxel in the presence of FST demonstrated a 1.5 (CaOV3, P < 0.01) and 2.5 (OVSAHO, P < 0.05)-fold increase in cell viability compared with paclitaxel alone. Meanwhile, cells treated with cisplatin in the presence of FST demonstrated 1.9 (CaOV3, P < 0.01) and 2.2 (OVSAHO, P < 0.01)-fold increase in cell viability compared with cisplatin alone.

Figure 5.

FST promotes chemoresistance and reduces apoptosis through the activation of ATF2. A, Cell counts of CaOV3 and OVSAHO cell lines co-treated with cisplatin with and without 200 ng/mL FST for 72 hours. B, Cell counts of CaOV3 and OVSAHO cell lines co-treated with cisplatin and 4 μg/mL IgG or FST-neutralizing antibody (FST-Nab). C, AnnexinV/PI apoptosis assay of OVSAHO cells treated with cisplatin, with and without IgG or FST-Nab. D, Fold change in cell number of CellTrace Violet sorted Dim (rapidly dividing) and Bright (slowly dividing) cells treated with FST ± cisplatin. E and F, Normalized CTV-dim cell number from Transwell co-cultures (CTV-dim with CTV-dim (Dim:Dim) or CTV-dim with CTV-bright (Dim:Bright) Pt412 cells; (E) treated with or without paclitaxel and (F) with paclitaxel and either IgG or FST-NAb. Data expressed as fold change in cell number. G and H, TGFβ Protein Phosphorylation Array and densitometry of cell lysates from PT412 cells treated with 200 ng/mL FST. I, ATF2 mRNA expression in siRNA knockdown cells versus scrambled control (pooled PT340 n = 2, PT412 n = 2). J, Cell counts of PT340 cells treated with cisplatin and ATF2 siRNA or scrambled siRNA control. K, Viable cell number of PT412 cells treated with scrambled siRNA or knocked down with two individual ATF2 siRNAs and treated with cisplatin ± FST. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Figure 5.

FST promotes chemoresistance and reduces apoptosis through the activation of ATF2. A, Cell counts of CaOV3 and OVSAHO cell lines co-treated with cisplatin with and without 200 ng/mL FST for 72 hours. B, Cell counts of CaOV3 and OVSAHO cell lines co-treated with cisplatin and 4 μg/mL IgG or FST-neutralizing antibody (FST-Nab). C, AnnexinV/PI apoptosis assay of OVSAHO cells treated with cisplatin, with and without IgG or FST-Nab. D, Fold change in cell number of CellTrace Violet sorted Dim (rapidly dividing) and Bright (slowly dividing) cells treated with FST ± cisplatin. E and F, Normalized CTV-dim cell number from Transwell co-cultures (CTV-dim with CTV-dim (Dim:Dim) or CTV-dim with CTV-bright (Dim:Bright) Pt412 cells; (E) treated with or without paclitaxel and (F) with paclitaxel and either IgG or FST-NAb. Data expressed as fold change in cell number. G and H, TGFβ Protein Phosphorylation Array and densitometry of cell lysates from PT412 cells treated with 200 ng/mL FST. I, ATF2 mRNA expression in siRNA knockdown cells versus scrambled control (pooled PT340 n = 2, PT412 n = 2). J, Cell counts of PT340 cells treated with cisplatin and ATF2 siRNA or scrambled siRNA control. K, Viable cell number of PT412 cells treated with scrambled siRNA or knocked down with two individual ATF2 siRNAs and treated with cisplatin ± FST. **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Close modal

We next used FST-neutralizing antibody (FST-NAb, R&D systems, Cat #AF669) to assess whether neutralization of endogenous FST secreted in response to chemotherapy could enhance chemotherapy sensitivity. A titration assay indicated that 4 μg/mL of FST-NAb could neutralize >80% of the inhibitory effects of FST on cell growth (Supplementary Fig. S3C). Using this dose, OVSAHO and CaOV3 cells were treated with cisplatin alone or in combination with an IgG control antibody or the anti-FST for 72 hours. Anti-FST significantly increased cell sensitivity to cisplatin in both CaOV3 and OVSAHO (P < 0.01; Fig. 5B). AnnexinV/PI apoptosis analysis of cell viability confirmed an approximately 6-fold increased cisplatin-induced apoptotic cell death in the presence of anti-FST (Fig. 5C). To determine whether FST-induced chemoresistance was acting primarily on the quiescent or proliferating cells, we isolated fast growing CTV-dim and quiescent CTV-bright cells and treated them with FST ± cisplatin. Dim cells were significantly more resistant to cisplatin in the presence FST compared with bright/quiescent cells (Fig. 5D; P < 0.01).

To demonstrate that quiescent cells could act in a paracrine manner to promote chemotherapy resistance, we tested chemotherapy response of CTV-dim and CTV-bright cells in co-culture using a Transwell assay. We co-cultured (i) CTV-dim cells with CTV-bright cells or (ii) CTV-dim cells with CTV-dim cells (as a control), then treated with paclitaxel (Supplementary Fig. S4A). Compared with CTV-dim cells cultured with CTV-dim cells, CTV-dim cells cultured in the presence of CTV-bright cells were significantly more resistant to paclitaxel (Fig. 5E; P < 0.05). To determine whether this was driven by FST, we repeated the experiment in the presence of FST-Nab or IgG control. As expected, IgG control–treated CTV-dim cells were more resistant to paclitaxel when co-cultured with CTV-bright (vs. CTV-dim) cells (Fig. 5F; P < 0.05). However, FST-Nab treatment resulted in similar survival in both the CTV-dim:CTV-dim and CTV-dim:CTV-bright culture conditions (Fig. 5F). These data indicate that FST produced by quiescent cells can act in a paracrine manner to restrict the growth of nearby proliferating cells and increase their chemoresistance.

To determine what downstream signaling pathways may be regulating the FST-driven chemoresistance, we conducted a TGFβ Protein Phosphorylation Array on PT412 cells treated with or without 200 ng of recombinant FST. FST-treated cells had a significant enrichment in p-SMAD family members and p-ATF2 (activating transcription factor-2; Fig. 5G and H). ATF2 has been reported to regulate chemotherapy and radiotherapy resistance in a range of malignancies, including breast, melanoma, and head and neck squamous cell carcinoma (26–28). Consequently, we knocked down ATF2 (Fig. 5I; Supplementary Fig. S4B) and assessed cell response to cisplatin. ATF2 knockdown cells are significantly more sensitive to cisplatin treatment (Fig. 5J; P < 0.05). Furthermore, when ATF2 siRNA knockdown cells were treated with FST and cisplatin, FST did not promote chemotherapy resistance when ATF2 was knocked down (Fig. 5I; siRNA #1 P < 0.05, siRNA #2; Supplementary Fig. S4B). Consistent with previous findings, co-treatment of siRNA scrambled cells with FST and cisplatin resulted in enhanced chemotherapy resistance compared with cisplatin alone (Fig. 5K; P < 0.01; Supplementary Fig. S4C; P < 0.05); however, the protective effects of FST on cisplatin-treated cells were lost when ATF2 was knocked down (Fig. 5K; ATF2 siRNA P = ns; Supplementary Fig. S4C; ATF2 siRNA P = ns).

Loss of FST activity increases ovarian cancer chemotherapy resistance in vitro and in vivo

To confirm the impact of FST on chemotherapy response, we used CRISPR-Cas9 to delete FST with two independent sgRNA in platinum-resistant SKOV3 cells. SKOV3 cells were chosen on the basis of their platinum and taxane-resistant status and ease of nucleofection. Western blotting for FST demonstrated reduced FST expression with sgRNA #1 and complete loss of expression with sgRNA #2 (Fig. 6A; Supplementary Fig. S5A; P < 0.001). Given that sgRNA #2 effectively eliminated FST expression, this cell pool was selected for all subsequent experiments. Compared with wild-type cells, paclitaxel treatment of FST-KO cells resulted in a significant increase in apoptotic cells and decrease in viable cell number (Fig. 6BD). To assess whether FST KO makes tumors more sensitive to paclitaxel, we injected wild-type or FST-KO SKOV3 cells into the intraperitoneal cavity of NSG mice. Tumor cells were allowed to engraft for three days and then mice were treated with paclitaxel, intraperitoneally (Supplementary Fig. S5B). Mice injected with FST-KO cells demonstrated a significant improvement in survival (Fig. 6E; P < 0.0001). By day 68, all mice injected with wild-type cells had succumbed to metastatic disease (10/10), whereas 90% of the FST-KO tumor–bearing mice were viable (9/10); the FST-KO group was monitored for a total of 120 days. At day 120, 70% of FST KO mice had succumbed to metastatic disease (7/10); 30% of animals remained alive and showed no signs of disease. These animals were subsequently electively euthanized. Upon necropsy one animal had evidence of limited disease while the remaining 20% had no evidence of cancer. To confirm differences in mouse survival were due to FST-induced chemoresistance rather than knockout of FST impacting basal cell growth, mice were xenografted with FST-KO or mock SKOV3 cells and tumor growth was recorded over 38 days. No significant difference in tumor growth was observed between mice xenografted with FST-KO or mock SKOV3 cells in the absences of paclitaxel (Fig. 6F).

Figure 6.

FST promotes chemoresistance and reduces apoptosis in vivo. A, Western blotting for FST in SKOV3 cells expressing CRISPR-Cas9 and FST gRNA #1 or gRNA #2. B and C, AnnexinV/PI apoptosis assay and total apoptotic cell number for wild-type (WT) and SKOV3 FST-KO cells treated with or without 4 nmol/L paclitaxel. D, Cell counts of SKOV3 FST-KO cells treated with or without 4 nmol/L paclitaxel. E, Survival plots of NSG mice (N = 10) injected with 150,000 FST-KO SKOV3 or control cells into the intraperitoneal cavity. Mice received 3 doses of 10 mg/kg doses of intraperitoneal paclitaxel on days 7, 14, and 21. F, Tumor volumes of xenografted SKOV3 FST-KO or Mock cells over 38 days (N = 3). **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Figure 6.

FST promotes chemoresistance and reduces apoptosis in vivo. A, Western blotting for FST in SKOV3 cells expressing CRISPR-Cas9 and FST gRNA #1 or gRNA #2. B and C, AnnexinV/PI apoptosis assay and total apoptotic cell number for wild-type (WT) and SKOV3 FST-KO cells treated with or without 4 nmol/L paclitaxel. D, Cell counts of SKOV3 FST-KO cells treated with or without 4 nmol/L paclitaxel. E, Survival plots of NSG mice (N = 10) injected with 150,000 FST-KO SKOV3 or control cells into the intraperitoneal cavity. Mice received 3 doses of 10 mg/kg doses of intraperitoneal paclitaxel on days 7, 14, and 21. F, Tumor volumes of xenografted SKOV3 FST-KO or Mock cells over 38 days (N = 3). **, P < 0.01; ***, P < 0.001; ****, P < 0.0001; ns, not significant.

Close modal

Together, these data demonstrate that tumor cells secrete FST in response to chemotherapy and that FST contributes to chemotherapy resistance. Furthermore, blocking this FST response sensitizes cells to chemotherapy both in vitro and in vivo.

FST is secreted in response to chemotherapy in patients with ovarian cancer and correlates with poor survival outcomes

To investigate whether FST is induced in response to chemotherapy in patients, we evaluated FST protein levels in ascites collected at the time of primary debulking surgery from patients with chemotherapy-naive HGSOC (n = 16) and compared with FST levels in ascites samples collected from patients with recurrent disease who had previously received chemotherapy (n = 17; Fig. 7A). We saw a positive trend of higher FST levels in treated patients. FST concentrations from ascites ranged from 4 to 320 ng/mL; the average FST concentration from ascites of patients of chemo-naive disease was 58 ng/mL, whereas the average level in patients with recurrent disease was 82 ng/mL (P = 0.17). Unfortunately, due to limited clinical records, we were unable to control for the timing of ascites drainage relative to time of therapy (immediately after vs. weeks to months after).

Figure 7.

FST is enriched in the ascites and peritoneum of patient with HGSOC following treatment with primary chemotherapy and correlates with worse patient outcomes. A, Ascites FST levels (quantified by ELISA) in patients with HGSOC during primary debulking surgery (n = 16), compared with ascites from patients who had received carboplatin/paclitaxel treatment regimens (n = 17). B, Schematic of the experiment procedure for real-time collection of serial IP washes from patients with HGSOC (N = 5), following IP cisplatin and intravenous paclitaxel treatments. C, FST levels in serial IP washes following cisplatin and paclitaxel treatment time course (Cycles 2 and 5). D, FST levels in serial IP washes following paired pre- and post-chemotherapy cisplatin and paclitaxel treatments (Cycles 1 and 2). E, Kaplan–Meier survival curves for progression-free survival (n = 614), overall survival (n = 655), and after progression survival (n = 382) of patients with HGSOC with high versus low FST expression. F, Diagram of the ovarian cancer chemotherapy induces FST signaling pathway. Chemotherapy treatment of ovarian cancer cells normally results in apoptosis. However, quiescent cancer cells release FST in response to chemotherapy activating p-ATF2, which induces a chemoresistance state protecting the bulk cancer cells from apoptosi. **, P < 0.01. (B, Created with BioRender.com.)

Figure 7.

FST is enriched in the ascites and peritoneum of patient with HGSOC following treatment with primary chemotherapy and correlates with worse patient outcomes. A, Ascites FST levels (quantified by ELISA) in patients with HGSOC during primary debulking surgery (n = 16), compared with ascites from patients who had received carboplatin/paclitaxel treatment regimens (n = 17). B, Schematic of the experiment procedure for real-time collection of serial IP washes from patients with HGSOC (N = 5), following IP cisplatin and intravenous paclitaxel treatments. C, FST levels in serial IP washes following cisplatin and paclitaxel treatment time course (Cycles 2 and 5). D, FST levels in serial IP washes following paired pre- and post-chemotherapy cisplatin and paclitaxel treatments (Cycles 1 and 2). E, Kaplan–Meier survival curves for progression-free survival (n = 614), overall survival (n = 655), and after progression survival (n = 382) of patients with HGSOC with high versus low FST expression. F, Diagram of the ovarian cancer chemotherapy induces FST signaling pathway. Chemotherapy treatment of ovarian cancer cells normally results in apoptosis. However, quiescent cancer cells release FST in response to chemotherapy activating p-ATF2, which induces a chemoresistance state protecting the bulk cancer cells from apoptosi. **, P < 0.01. (B, Created with BioRender.com.)

Close modal

The lack of statistical significance in the ascites study above could be related to limited numbers or, given FST expression is induced by chemotherapy, due to lack to proximity to chemotherapy administration. To circumvent this limitation, we used samples from chemo-naive patients with HGSOC (n = 5) treated with intraperitoneal cisplatin chemotherapy. Peritoneal washings were collected from patients via an intraperitoneal catheter before treatment initiation, before cycles 2 and 5 of chemotherapy, and 3 months after the completion of adjuvant therapy (Fig. 7B). Initial patient FST concentrations before treatment averaged 9 μg/mL; however, by cycle two of treatment, FST concentration had increased to an average of 20 μg/mL and by cycle 5 it had increased to an average of 54 μg/mL (Fig. 7C). When patients had completed chemotherapy and appeared to have no evidence of disease, peritoneal washings were obtained at the time of catheter removal. FST concentrations in peritoneal washings at this time dropped to 7 μg/mL, suggesting that this increase in FST following treatment is an acute response. To confirm the temporal relationship of FST induction, we evaluated FST levels in peritoneal washes taken from patients before and the day after receiving IP cisplatin chemotherapy, as part of a chemoimmune therapy trial (21), at both cycles 1 and 2. FST significantly increased following chemotherapy cycle 1, before reducing post-chemotherapy, then rising again following cycle 2 of chemotherapy (Fig. 7D).

To further evaluate the clinical impact of FST, we interrogated the impact of FST expression on patient outcome using the ovarian cancer TCGA dataset. Supporting clinical importance, consistent with a role in chemotherapy resistance, patients with HGSOC with high FST expression demonstrated significantly worse progression-free (P < 0.0001, n = 614), overall (P < 0.001, n = 655), and after progression survival (P < 0.05, n = 382; Fig. 7E). Combined, these data support that FST is induced in response to chemotherapy in patients and may be a driver of therapeutic resistance.

In this study, we have identified a novel mechanism of chemotherapy resistance whereby quiescent cells in response to chemotherapy increase FST secretion, activating p-ATF2 and reducing apoptosis, proliferation, and cell cycle, while increasing chemoresistance (Fig. 7G). Targeting this chemoresistance mechanism by knocking out FST or inhibiting FST activity using an anti-FST antibody, results in an increase in sensitivity to chemotherapy and a decrease in recurrence (Fig. 7F).

FST and proliferation

FST is a 31–44 kDa-glycosylated protein, expressed in many human tissues, in particular the ovary, ear, and larynx (29). The major function of FST is to bind and inhibit follicle-stimulating hormone and other members of the TGFβ superfamily of proteins, which include activins, inhibins, BMPs, and myostatin. Consequently, FST plays a key role in attenuating cellular response to these proliferation, differentiation, and apoptosis signals. Here, we report that FST, in response to chemotherapy, is secreted primarily by quiescent cancer cells. FST then likely acts in at least a paracrine manner to induce chemotherapy resistance in bulk cells. Current studies cannot rule out an autocrine effect; however, future studies with FST-KO cell lines can be used to further dissect autocrine versus paracrine signaling.

Our data demonstrating FST that inhibits cell cycle and proliferation are consistent with studies in ovarian sex cord–stromal tumors (30) and epithelial ovarian cancer cell lines (31). Although previous work has suggested that FST inhibition of proliferation could result from attenuation of activin (31), our data in the low activin cell line CaOV3 suggested that other mechanisms may exist. Furthermore, FST has been reported to promote proliferation in endothelial cells (32) and prostate cancer cell lines (33), thus suggesting tissue-specific effects and alternative pathways.

FST as a stress response protein.

FST mRNA and protein expressions increase in response to a number of cellular stresses, including reactive oxygen species (34), ionizing radiation (35) ischemic reperfusion injury (36), and energy deprivation (11, 37). We similarly find serum withdrawal and chemotherapy exposure increase FST secretion from ovarian cancer cells. Combined this suggests that FST may be part of a universal stress response mechanism. The regulation of FST following stress seems to be varied, with studies suggesting that it is regulated both transcriptionally and post-translationally. In our data, the early expression of FST following NFATC4 induction suggests that this is likely a direct NFATC4 effect, although more work is required to confirm this relationship.

FSTs and cancer and therapeutic resistance

FST and the FST-like protein family have been linked with carcinogenesis (29). Given that FST regulates TGFβ signaling, and TGFβ is known for its dualistic role in cancer, it is not surprising that there are differing roles of FST in cancer. A potentially tumor-suppressive FST is reported to reduce lung cancer metastasis in immune-suppressed mice (38). However, it is possible that the reduction in metastasis could be related to the antiproliferative effect we and others observe. FST is also reported to play a role in tumor angiogenesis, which would be consistent with a role of FST as a stress response gene, triggering angiogenesis to reverse adverse environmental conditions (39).

Our finding that FST promotes ovarian cancer chemotherapy resistance and reduces apoptosis was corroborated in multiple cell lines, primary patient samples, and in a xenograft model. This is analogous to studies in breast and colorectal cancers, indicating a therapeutic resistance role for the FST family members FSTL1 and FSTL3, respectively (40, 41). However, FST's effects on apoptosis seem to be tissue specific, with studies in lung (34) and HeLa (11) cells demonstrating protection from apoptosis, whereas a study in endometrial stromal cells demonstrated the opposite (42).

This study suggests that FST-induced chemotherapy resistance is mediated in part via ATF2 phosphorylation. Indeed expression of FST has been linked to activation of the p38 MAPK/ERK pathways and subsequent phosphorylation of ATF2 (43). ATF2 has been linked with chemotherapy resistance in non–small cell lung (44), head and neck (27), and laryngeal cancers (45). Similarly, the pATF2 also promotes radiation resistance in melanoma (28). The exact mechanism/s whereby ATF2 protects against apoptosis and promotes chemoresistance remain to be determined.

In addition to increases in pATF2 with FST exposure, we also observed modest increases in pSMAD1, 2, and 4. This is in line with a study linking pATF2 and activated SMAD2 and SMAD1/5, driving quiescence and dormancy in breast cancer cells (46). As FST typically functions as a negative regulator of other TGF/BMP superfamily ligands, such as activins and inhibins, the increase in pSMADs at first appears counterintuitive. However, it is possible that FST could inhibit an inhibitor resulting in positive signaling. Alternatively, activation of SMADs may be a time-dependent feedback response. Further studies will be necessary to determine the role of FST signaling.

FST was also recently linked with resistance to immune checkpoint inhibitor therapy in ovarian cancer (14). This study also identified IL33 and S100a4 as high-priority candidate genes significantly overexpressed in their therapy-resistant ovarian cancer model. This is intriguing, considering we also observed a significant increase in IL33 following NFATC4 induction. Together, these data link NFATC4 to both immunotherapy and chemotherapy resistance.

Finally, our data demonstrating FST expression increased in patients with HGSOC following primary chemotherapy are correlated with poor progression-free and overall survival, and are consistent with an early study by Ren and colleagues (12) that reported FST to be elevated in patients with ovarian cancer, where it correlated with poor prognosis.

Overall, this study has substantial implications for the treatment of ovarian cancer. Despite considerable progress with targeted therapy, chemotherapy remains the most effective means to treat ovarian cancer. The ability to improve response to chemotherapy offers the possibility to increase cure rates. Our results indicate that FST plays a significant role in driving chemotherapy resistance. As FST is a secreted factor, it represents an ideal target for antibody-mediated neutralization. Our studies support the development of a human FST-neutralizing antibody for translation into clinical trials.

R.J. Buckanovich reports grants from NIH during the conduct of the study; reports a patent for human anti-FST pending; and is a co-founder of Tradewinds Bioscience. In addition, R.J. Buckanovich reports receiving consulting fees from Abound Bio for unrelated works; receiving a study drug from Genentech for an unrelated clinical trial; support from Novartis for a clinical trial; and receiving a contract with Sophrosyne to evaluate a novel ALDH inhibitor—unrelated to this work. No disclosures were reported by the other authors.

A.J. Cole: Conceptualization, data curation, formal analysis, supervision, investigation, writing–original draft. S. Panesso-Gómez: Data curation, formal analysis, investigation, methodology, writing–original draft. J.S. Shah: Formal analysis, methodology. T. Ebai: Data curation, formal analysis, investigation. Q. Jiang: Data curation, investigation. E. Gumusoglu-Acar: Investigation. M.G. Bello: Investigation, methodology. A. Vlad: Resources. F. Modugno: Resources. R.P. Edwards: Resources. R.J. Buckanovich: Conceptualization, resources, formal analysis, supervision, funding acquisition.

The funding for this work was provided by Ann and Sol Schreiber Mentored Investigator Award (599997) from the Ovarian Cancer Research Alliance (OCRA), DOD Award #W81XWH-15–1-0083, and NIH R01 award 1R01CA203810.

The publication costs of this article were defrayed in part by the payment of publication fees. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

1.
Brown
JA
,
Yonekubo
Y
,
Hanson
N
,
Sastre-Perona
A
,
Basin
A
,
Rytlewski
JA
, et al
.
TGFβ-induced quiescence mediates chemoresistance of tumor-propagating cells in squamous cell carcinoma
.
Cell Stem Cell
2017
;
21
:
650
64
.
2.
Chen
K
,
Zhang
C
,
Ling
S
,
Wei
R
,
Wang
J
,
Xu
X
.
The metabolic flexibility of quiescent CSC: implications for chemotherapy resistance
.
Cell Death Dis
2021
;
12
:
1
12
.
3.
Cole
AJ
,
Iyengar
M
,
Panesso-Gomez
S
,
O'Hayer
P
,
Chan
D
,
Delgoffe
GM
, et al
.
NFATC4 promotes quiescence and chemotherapy resistance in ovarian cancer
.
JCI Insight
2020
;
5
:
e131486
.
4.
Cole
AJ
,
Fayomi
AP
,
Anyaeche
VI
,
Bai
S
,
Buckanovich
RJ
.
An evolving paradigm of cancer stem cell hierarchies: therapeutic implications
.
Theranostics
2020
;
10
:
3083
98
.
5.
Aguirre-Ghiso
JA
.
Translating the science of cancer dormancy to the clinic
.
Cancer Res
2021
;
81
:
4673
5
.
6.
Risson
E
,
Nobre
AR
,
Maguer-Satta
V
,
Aguirre-Ghiso
JA
.
The current paradigm and challenges ahead for the dormancy of disseminated tumor cells
.
Nat Cancer
2020
;
1
:
672
80
.
7.
Shepherd
TG
,
Dick
FA
.
Principles of dormancy evident in high-grade serous ovarian cancer
.
Cell Div
2022
;
17
:
2
.
8.
Gao
MQ
,
Choi
YP
,
Kang
S
,
Youn
JH
,
Cho
NH
.
CD24+ cells from hierarchically organized ovarian cancer are enriched in cancer stem cells
.
Oncogene
2010
;
29
:
2672
80
.
9.
Bildik
G
,
Liang
X
,
Sutton
MN
,
Bast
RC
Jr
,
Lu
Z
.
DIRAS3: an imprinted tumor suppressor gene that regulates RAS and PI3K-driven cancer growth, motility, autophagy, and tumor dormancy
.
Mol Cancer Ther
2022
;
21
:
25
37
.
10.
Lin
SY
,
Morrison
JR
,
Phillips
DJ
,
de Kretser
DM
.
Regulation of ovarian function by the TGF-beta superfamily and follistatin
.
Reproduction
2003
;
126
:
133
48
.
11.
Gao
X
,
Wei
S
,
Lai
K
,
Sheng
J
,
Su
J
,
Zhu
J
, et al
.
Nucleolar follistatin promotes cancer cell survival under glucose-deprived conditions through inhibiting cellular rRNA synthesis
.
J Biol Chem
2010
;
285
:
36857
64
.
12.
Ren
P
,
Chen
FF
,
Liu
HY
,
Cui
XL
,
Sun
Y
,
Guan
JL
, et al
.
High serum levels of follistatin in patients with ovarian cancer
.
J Int Med Res
2012
;
40
:
877
86
.
13.
Karve
TM
,
Preet
A
,
Sneed
R
,
Salamanca
C
,
Li
X
,
Xu
J
, et al
.
BRCA1 regulates follistatin function in ovarian cancer and human ovarian surface epithelial cells
.
PLoS ONE
2012
;
7
:
e37697
.
14.
Iyer
S
,
Zhang
S
,
Yucel
S
,
Horn
H
,
Smith
SG
,
Reinhardt
F
, et al
.
Genetically defined syngeneic mouse models of ovarian cancer as tools for the discovery of combination immunotherapy
.
Cancer Discov
2021
;
11
:
384
407
.
15.
Manichaikul
A
,
Peres
LC
,
Wang
XQ
,
Barnard
ME
,
Chyn
D
,
Sheng
X
, et al
.
Identification of novel epithelial ovarian cancer loci in women of African ancestry
.
Int J Cancer
2020
;
146
:
2987
98
.
16.
Rashidi
MRW
,
Mehta
P
,
Bregenzer
M
,
Raghavan
S
,
Fleck
EM
,
Horst
EN
, et al
.
Engineered 3D model of cancer stem cell enrichment and chemoresistance
.
Neoplasia
2019
;
21
:
822
36
.
17.
Graef
IA
,
Mermelstein
PG
,
Stankunas
K
,
Neilson
JR
,
Deisseroth
K
,
Tsien
RW
, et al
.
L-type calcium channels and GSK-3 regulate the activity of NF-ATc4 in hippocampal neurons
.
Nature
1999
;
401
:
703
8
.
18.
Iyengar
M
,
O'Hayer
P
,
Cole
A
,
Sebastian
T
,
Yang
K
,
Coffman
L
, et al
.
CDK4/6 inhibition as maintenance and combination therapy for high grade serous ovarian cancer
.
Oncotarget
2018
;
9
:
15658
.
19.
Chefetz
I
,
Grimley
E
,
Yang
K
,
Hong
L
,
Vinogradova
EV
,
Suciu
R
, et al
.
A Pan-ALDH1A inhibitor induces necroptosis in ovarian cancer stem-like cells
.
Cell Rep
2019
;
26
:
3061
75
.
20.
Oki
T
,
Nishimura
K
,
Kitaura
J
,
Togami
K
,
Maehara
A
,
Izawa
K
, et al
.
A novel cell-cycle–indicator, mVenus-p27K−, identifies quiescent cells and visualizes G0–G1 transition
.
Sci Rep
2014
;
4
:
1
10
.
21.
Orr
B
,
Mahdi
H
,
Fang
Y
,
Strange
M
,
Uygun
I
,
Rana
M
, et al
.
Phase I trial combining chemokine-targeting with loco-regional chemoimmunotherapy for recurrent, platinum-sensitive ovarian cancer shows induction of CXCR3 ligands and markers of type 1 immunity
.
Clin Cancer Res
2022
;
28
:
2038
49
.
22.
Bai
S
,
Ingram
P
,
Chen
Y-C
,
Deng
N
,
Pearson
A
,
Niknafs
YS
, et al
.
EGFL6 regulates the asymmetric division, maintenance, and metastasis of ALDH+ ovarian cancer cells
.
Cancer Res
2016
;
76
:
6396
409
.
23.
Silva
IA
,
Bai
S
,
McLean
K
,
Yang
K
,
Griffith
K
,
Thomas
D
, et al
.
Aldehyde dehydrogenase in combination with CD133 defines angiogenic ovarian cancer stem cells that portend poor patient survival
.
Cancer Res
2011
;
71
:
3991
4001
.
24.
Choi
YJ
,
Ingram
PN
,
Yang
K
,
Coffman
L
,
Iyengar
M
,
Bai
S
, et al
.
Identifying an ovarian cancer cell hierarchy regulated by bone morphogenetic protein 2
.
Proc Natl Acad Sci U S A
2015
;
112
:
E6882
8
.
25.
White
EZ
,
Pennant
NM
,
Carter
JR
,
Hawsawi
O
,
Odero-Marah
V
,
Hinton
CV
.
Serum deprivation initiates adaptation and survival to oxidative stress in prostate cancer cells
.
Sci Rep
2020
;
10
:
1
18
.
26.
Giannoudis
A
,
Malki
MI
,
Rudraraju
B
,
Mohhamed
H
,
Menon
S
,
Liloglou
T
, et al
.
Activating transcription factor-2 (ATF2) is a key determinant of resistance to endocrine treatment in an in vitro model of breast cancer
.
Breast Cancer Res
2020
;
22
:
1
17
.
27.
Duffey
D
,
Dolgilevich
S
,
Razzouk
S
,
Li
L
,
Green
R
,
Gorti
GK
.
Activating transcription factor-2 in survival mechanisms in head and neck carcinoma cells
.
Head Neck
2011
;
33
:
1586
99
.
28.
Ronai
Z
,
Yang
Y-M
Fuchs
SY
,
Adler
V
,
Sardana
M
,
Herlyn
M
.
ATF2 confers radiation resistance to human melanoma cells
.
Oncogene
1998
;
16
:
523
31
.
29.
Shi
L
,
Resaul
J
,
Owen
S
,
Ye
L
,
Jiang
WG
.
Clinical and therapeutic implications of follistatin in solid tumours
.
Cancer Genomics Proteomics
2016
;
13
:
425
35
.
30.
Shikone
T
,
Matzuk
MM
,
Perlas
E
,
Finegold
MJ
,
Lewis
KA
,
Vale
W
, et al
.
Characterization of gonadal sex cord-stromal tumor cell lines from inhibin-alpha and p53-deficient mice: the role of activin as an autocrine growth factor
.
Mol Endocrinol
1994
;
8
:
983
95
.
31.
Di Simone
N
,
Crowley
WF
Jr
,
Wang
QF
,
Sluss
PM
,
Schneyer
AL
.
Characterization of inhibin/activin subunit, follistatin, and activin type II receptors in human ovarian cancer cell lines: a potential role in autocrine growth regulation
.
Endocrinology
1996
;
137
:
486
94
.
32.
Kozian
DH
,
Ziche
M
,
Augustin
HG
.
The activin-binding protein follistatin regulates autocrine endothelial cell activity and induces angiogenesis
.
Lab Invest
1997
;
76
:
267
76
.
33.
van Schaik
RH
,
Wierikx
CD
,
Timmerman
MA
,
Oomen
MH
,
van Weerden
WM
,
van der Kwast
TH
, et al
.
Variations in activin receptor, inhibin/activin subunit and follistatin mRNAs in human prostate tumour tissues
.
Br J Cancer
2000
;
82
:
112
7
.
34.
Lin
C
,
Zhao
X
,
Sun
D
,
Zhang
L
,
Fang
W
,
Zhu
T
, et al
.
Transcriptional activation of follistatin by Nrf2 protects pulmonary epithelial cells against silica nanoparticle-induced oxidative stress
.
Sci Rep
2016
;
6
:
21133
.
35.
Forrester
HB
,
Ivashkevich
A
,
McKay
MJ
,
Leong
T
,
de Kretser
DM
,
Sprung
CN
.
Follistatin is induced by ionizing radiation and potentially predictive of radiosensitivity in radiation-induced fibrosis patient derived fibroblasts
.
PLoS ONE
2013
;
8
:
e77119
.
36.
Chen
Y
,
Rothnie
C
,
Spring
D
,
Verrier
E
,
Venardos
K
,
Kaye
D
, et al
.
Regulation and actions of activin A and follistatin in myocardial ischaemia-reperfusion injury
.
Cytokine
2014
;
69
:
255
62
.
37.
Gao
X
,
Dong
H
,
Lin
C
,
Sheng
J
,
Zhang
F
,
Su
J
, et al
.
Reduction of AUF1-mediated follistatin mRNA decay during glucose starvation protects cells from apoptosis
.
Nucleic Acids Res
2014
;
42
:
10720
30
.
38.
Chiou
J
,
Chang
YC
,
Tsai
HF
,
Lin
YF
,
Huang
MS
,
Yang
CJ
, et al
.
Follistatin-like protein 1 inhibits lung cancer metastasis by preventing proteolytic activation of osteopontin
.
Cancer Res
2019
;
79
:
6113
25
.
39.
Blank
S
,
Deck
C
,
Dreikhausen
L
,
Weichert
W
,
Giese
N
,
Falk
C
, et al
.
Angiogenic and growth factors in gastric cancer
.
J Surg Res
2015
;
194
:
420
9
.
40.
Li
Y
,
Tian
M
,
Liu
W
,
Wang
D
,
Zhou
Z
,
Pei
Q
, et al
.
Follistatin-like 3 enhances invasion and metastasis via beta-catenin–mediated EMT and aerobic glycolysis in colorectal cancer
.
Front Cell Dev Biol
2021
;
9
:
660159
.
41.
Cheng
S
,
Huang
Y
,
Lou
C
,
He
Y
,
Zhang
Y
,
Zhang
Q
.
FSTL1 enhances chemoresistance and maintains stemness in breast cancer cells via integrin beta3/Wnt signaling under miR-137 regulation
.
Cancer Biol Ther
2019
;
20
:
328
37
.
42.
Coutinho
LM
,
Vieira
EL
,
Dela Cruz
C
,
Casalechi
M
,
Teixeira
AL
,
Del Puerto
HL
, et al
.
Apoptosis modulation by activin A and follistatin in human endometrial stromal cells
.
Gynecol Endocrinol
2016
;
32
:
161
5
.
43.
Singh
R
,
Braga
M
,
Reddy
ST
,
Lee
S-J
,
Parveen
M
,
Grijalva
V
, et al
.
Follistatin targets distinct pathways to promote brown adipocyte characteristics in brown and white adipose tissues
.
Endocrinology
2017
;
158
:
1217
30
.
44.
Lo Iacono M,
Monica
V
,
Vavalà
T
,
Gisabella
M
,
Saviozzi
S
,
Bracco
E
, et al
.
ATF2 contributes to cisplatin resistance in non–small cell lung cancer and celastrol induces cisplatin resensitization through inhibition of JNK/ATF2 pathway
.
Int J Cancer
2015
;
136
:
2598
609
.
45.
Tian
L
,
Zhang
J
,
Ren
X
,
Liu
X
,
Gao
W
,
Zhang
C
, et al
.
Overexpression of miR-26b decreases the cisplatin-resistance in laryngeal cancer by targeting ATF2
.
Oncotarget
2017
;
8
:
79023
.
46.
Nobre
AR
,
Risson
E
,
Singh
DK
,
Di Martino
JS
,
Cheung
JF
,
Wang
J
, et al
.
Bone marrow NG2(+)/Nestin(+) mesenchymal stem cells drive DTC dormancy via TGFβ2
.
Nat Cancer
2021
;
2
:
327
39
.

Supplementary data