Purpose:

AL amyloidosis (AL) treatments are generally based on those employed for multiple myeloma. Anti–B-cell maturation antigen (BCMA) chimeric antigen receptor T (CART)-cell therapy, already approved for multiple myeloma, might be too toxic for patients with AL.

Experimental Design:

Here we describe the ex vivo applicability of a novel in-house, academic anti-BCMA CAR construct on AL primary cells, as well as the safety and efficacy in 4 patients with relapsed/refractory (RR) primary AL, treated in a phase I clinical trial (NCT04720313).

Results:

Three had MAYO stage IIIa cardiac involvement at enrollment. The treatment proved relatively safe, with a short and manageable grade 3 cytokine release syndrome evident in 2 patients and no neurotoxicity in any. Cardiac decompensations, observed in 2 patients, were also short and manageable. The overall hematologic response and complete response rates were observed in all patients with an organ response evident in all four. Within a median follow-up period of 5.2 (2.5–9.5) months, all 4 patients maintained their responses.

Conclusions:

BCMA-CART cells provide a first proof-of-concept that this therapy is safe enough and highly efficacious for the treatment of patients with advanced, RR AL.

Translational Relevance

Anti–B-cell maturation antigen (BCMA) chimeric antigen receptor T (CART)-cell therapy, already approved for multiple myeloma, has not been used in patients with AL amyloidosis (AL) and might be too toxic to this frail population. BCMA levels were previously reported low in AL plasma cells rendering this therapy also questionable.

Here, we describe the ex vivo applicability of a novel in-house, academic anti-BCMA CAR construct on AL primary cells, as well as the manageable safety and profound and high efficacy, both in terms of hematologic response and organ response, in 4 patients with relapsed/refractory (RR) primary AL with active and severe refractory disease.

We show here, for the first time, that BCMA-CART–cell therapy provides a proof-of-concept that this therapy is indeed efficacious and safe enough for the treatment of patients with advanced, RR AL.

Primary light chain amyloidosis (AL) is a rare monoclonal plasma cell (PC) disorder characterized by the systemic deposition of misfolded immunoglobulin light chain (LC) protein product, as insoluble fibrils in multiple organs. These are produced by clonal malignant PCs which occasionally over-proliferate (1–4). Cardiac involvement is common (60%–70% of patients) and confers the gravest prognosis. Therapy of AL is currently limited to the use of anti–multiple myeloma agents, aimed at the elimination of the PC clone (1, 5, 6), yet are associated with considerable toxicity. Many patients with AL develop multi-organ dysfunction, hence are more susceptible to treatment-related toxicities. In addition, being a rare disease, large controlled clinical trials of primary AL are difficult to conduct (7). Therefore, it is important to keep in mind the vulnerability of patients with AL while evaluating novel therapeutic strategies (6, 8). While the mechanical effects of amyloid fibril deposition cause organ dysfunction, it is evident that simply the reduction of the circulating amyloidogenic free light chains (FLC) concentration improves symptoms and is of key importance (9), correlating with better survival and organ responses (10, 11). Recently, the Andromeda phase III first-line trial combined daratumumab to the standard of care CyBorD regimen (cyclophosphamide, bortezomib, and dexamethasone), showing the crucial relevance of achieving a complete remission (CR), and especially a deep response with a difference between involved and uninvolved FLC (dFLC) of <10, resulting in sustained and extremely favorable prognosis with high organ responses (12). The achievement of minimal residual disease (MRD) negativity was additionally correlated with high probability of organ response and a very low probability of hematologic relapse (10), making this endpoint a desirable goal of treatment. However, the ability to induce MRD negativity in patients with advanced disease is difficult and rare. Thus, for these progressing patients, an alternative effective therapy is urgently needed.

B-cell maturation antigen (BCMA) is highly and specifically expressed on PCs (13). Excellent responses achieved by targeted BCMA chimeric antigen receptor T (CART)-cell therapy in multiple myeloma highlights this treatment strategy as a great promise for patients with advanced, relapsed/refractory (RR) multiple myeloma (13–17). This technology allows not only the possibility of achieving a response in heavily pretreated patients, but also a deep response to the MRD level in many patients. This makes CART-cell therapy an attractive possibility for patients with AL. However, significant adverse events (AE), especially cytokine release syndrome (CRS) and neurologic complications such as immune effector-cells neurotoxicities (ICAN), limit this approach, rendering it suitable for the more resilient patients, but very challenging for the frail. Such are patients with AL, who have been invariably excluded from participation in these challenging clinical trials (17–19). Moreover, AL-PCs showed significantly attenuated expression of BCMA, as compared with multiple myeloma–PCs (20), implying that other targets, such as CS1, may be preferred for designing future AL-directed CART-cell therapy (21, 22).

Recently, the successful use of BCMA-CART was reported in a case of a patient with multiple myeloma with concomitant AL renal involvement (23). On the basis of the results of our academic BCMA-CART (24), we systematically show the data obtained ex vivo with our academic designed BCMA-CART (i.e., HBI0101; ref. 24) applied successfully to AL-PCs, and subsequent clinical results in 4 patients with RR AL, multi-organ involvement and advanced cardiac disease. This study represents a proof-of-concept that BCMA-CART–cell therapy is feasible for patients with advanced AL.

The full version of the Materials and Methods is available in Supplementary Materials and Methods, and is presented here in brief.

BCMA-CAR (HBI0101) construct design

HBI0101 construct was reported as H8BB in our previous publication (24). HBI0101 construct consists of a heavy chain connected to an LC both derived from the C11D5.3 antibody (25) by a linker; CD8α-derived hinge and transmembrane domains; co-stimulatory 4–1BB and CD3ζ domains (Supplementary Fig. S1a). The construct was inserted into MSGV1 retroviral vector (a kind gift from Dr. Steven Rosenberg, NCI; ref. 26).

Leucocyte isolation and HBI0101 cell production for ex vivo study

Peripheral blood mononuclear cells from AL and/or multiple myeloma patients’ blood were isolated and CD3-activated peripheral blood mononuclear cells were used for further production.

Blood was collected from patients with AL or/and multiple myeloma (0253–20-HMO) and processed on a Ficoll gradient (Lymphocyte Separation Medium, Lonza) to isolate peripheral blood mononuclear cells (PBMC). PBMCs were suspended at a concentration of 1×106 cells per mL in T-cell medium (TCM), containing AIM-V (Gibco) supplemented with 5% human serum (Valley), 1% Glutamax (Gibco). IL2 (300 IU/mL; Proleukin, Novartis) and anti-CD3 monoclonal antibody OKT-3 (50 ng/mL; Miltenyi Biotech) were added to the TCM for 2 days of culture. Tissue culture non-treated 24-well plates were coated with 10 μg/mL RectroNectin (R/N; Takara) in PBS (Lonza) overnight at 4°C, followed by 30 minutes blocking with 2.5% human albumin in PBS, then washed. Retroviral supernatant was thawed, diluted 1:20 with TCM, added to wells, and centrifuged at 2,000 g for 2 hours at 32°C. The supernatant was then aspirated and 0.5×106 CD3-activated PBMCs/mL were seeded into each well in TCM with 300 IU/mL IL2, centrifuged for 10 minutes at 1,000 g, and incubated at 37°C overnight. Activated but non-transduced (NT) cells were generated and used as T-cell controls. Transduction efficacy was determined at days 6 and 10 of the culture via flow cytometry, by labeling BCMA CAR+ T cells with the human recombinant BCMA protein (Active; ACRO).

Bone marrow immunophenotyping

Bone marrow (BM) aspirates were collected from patients with multiple myeloma and/or AL who consented to the institutional biospecimen collection protocol of the Ethical Committee of Hadassah Medical Center (0253–20-HMO). BM samples were labeled with anti-CD38 (A07778), anti-CD138 (B37788; Beckman Coulter), and anti-BCMA (19F2; BioLegend); lysed with IOTest 3 Lysing Solution x1 (Beckman Coulter); washed; and acquired by using the 10-color Navios flow cytometer (Beckman Coulter). All flow cytometry analyses were performed using KALUZA software.

In vitro PCs elimination

BM-derived mononuclear cells (BM-MNC) from primary BM samples, isolated by ficoll density gradient centrifugation, were cocultured 1:1 CART:BM-MNC cells (105 cells each) overnight at 37°C. Cells were labeled as above and assessed by flow cytometry.

In vitro CD138+ PCs cytotoxicity

BM-MNCs were enriched in CD138+ PCs using the EasySep human CD138 Positive Selection Kit II (STEMCELL Technologies). BM-MNCs, CD138+, or CD138- fraction of BM-MNCs were cocultured either with HBI0101 or NT effector cells in TCM at a 1:1 E:T ratio for 2 hours (for caspase-3 killing assay) or overnight (for cytokines release assay and 4–1BB activation assay). Cellular fraction was labeled extracellularly with hBCMA recombinant protein, α-CD3, and α-CD137 for T-cell activation assay, or with α-BCMA, α-CD3, and α-CD138, fixed, permeabilized and intracellularly labeled with cleaved caspase-3 for cytotoxicity assay. Stained cells were analyzed by flow cytometer. Cell supernatants were collected and the secretion of IFNγ and TNFα was quantified by ELISA (R&D) according to the manufacturer's instructions.

CD138+ PCs apoptosis

The cellular fraction of the in vitro PC culture cell suspension (described above) was labeled extracellularly with anti-BCMA (BioLegend), anti-CD3 (Beckman Coulter), and anti-CD138 (Beckman Coulter) at 4°C for 20 minutes. Cells were then washed twice in PBS+2% FBS, fixed and permeabilized with Fix/Perm solution (BD), and then intracellularly stained with anti-active caspase-3 antibody (BD Pharmingen). The percent of cleaved caspase-3 in CD3-BCMA+ gated cells was determined using flow cytometry.

Non-PCs viability by 7AAD staining

BM-MNCs were cocultured either with HBI0101 or NT cells at a E:T ratio of 1:1 for 1 hour at 37°C in AIM-V (Gibco) supplemented with 5% human AB serum (Access Biological LLC) and 1% Glutamax (Gibco). Following incubation, cells were washed with PBS and stained with anti-CD38 and anti-CD138 (Beckman Coulter) for 20 minutes. 7-AAD (Tonbo Bioscience) was added 5 minutes prior to samples acquisition (10-color Navios flow cytometer). Samples were gated on CD38-CD138- “AND NOT” CART. Samples were analyzed using Kaluza 2.1 software.

4–1BB activation assay

HBI0101-transduced or NT T cells were cocultured either with BM-MNCs, or with the CD138-positive or CD138-negative fractions of BM-MNCs (1:1 E:T ratio), in a U-bottom 96-well plate. Following an overnight incubation at 37°C, cells were labeled with human BCMA recombinant protein (ACRO), anti-CD3 (Beckman Coulter), and anti-CD137 (4–1BB; BioLegend), and then analyzed by flow cytometry. To assess the percentage of 4–1BB+ CAR+ cells, samples were gated on live CD3+CAR+ cells, while NT cells samples were gated on live CD3+ cells.

BCMA-CART cells clinical grade production and administration

The production of HBI0101 cells was carried out using the same protocol as described above for the production of CART cells for ex vivo applications. Modifications as to the source of the starting material, the use of clinical grade medium and reagents, and production under GMP conditions, were made to generate CART cells suitable for the clinic. Leukocytes were collected at day 10 by leukapheresis, using the Sprectra Optia apheresis system, and then transferred to HMC local production facility. Clinical grade retroviral supernatant used for T-cell transduction was generated from PG13 master cell bank at the Indiana University Vector Production Facility, under GMP regulation. After transduction with 1/25 or 1/50 retroviral supernatant, cells were seeded into GRex100 devices filled with TCM and supplemented with IL2 (300 IU/mL) for seven days of expansion. Medium and IL2 replacement was performed every 2 to 3 days. At the day of patient's infusion, cells were washed 3 times with saline with 1% human albumin, and then formulated into the final drug product (DP) at the concentration of 15×106 CART cells/mL in saline with 2.5% human albumin. DP infusion volume varied according to cell doses.

HBI0101 CART in vivo detection and insert copy-number determination

Blood was collected from patients with AL, prior to and following HBI0101 cells infusion, at designated times. Genomic DNA was extracted and purified, using the Qiagen QIAamp DNA Blood Mini Kit, according to the manufacturer's instruction. CAR copy number (CPN) was determined by quantitative real-time PCR on the StepOne instrument (Applied Biosystems) using the Taqman-based primers as follows: MSGV1 primers (forward: CGGCAGCCTACCAAGAACA; reverse: TGTGTCGCCGACTCGGTAA; probe: CGGTGGTACCTCACC), and the TaqMan Fast advance Master Mix (Applied Biosystems). Standard curves of MSGV1 plasmid (ranging from 107–10° copies) was generated by serial dilution of the MSGV1 plasmid. The number of circulating CART in 1 mL of blood was then calculated by extrapolating the number of retroviral copies inserted into each CART cell.

For the determination of vector CPN, DNA was extracted from 20×106 expanded HBI0101-T cells at day 2 to CART-cell infusion (QIAamp DNA Blood Mini Kit). Quantification of the MSGV1-based HBI0101 vector CPN was performed using the Applied Biosystems StepOne real-time PCR system. The PCR reaction mix contained 1X Taqman Fast Advance Master Mix (Applied Biosystems), Taqman-based primer mix for MSGV1 insert or albumin amplification, Taqman-labeled probes, and sterile nuclease free water. MSGV1 primers/probe as follows: forward: CGGCAGCCTACCAAGAACA; reverse: TGTGTCGCCGACTCGGTAA; probe: CGGTGGTACCTCACC; albumin primers/probe as follows: forward: GAGTCACCAAATGCTGCACAGA; reverse: GAACGTATGTTTCATCG; probe: ACAGGCGACCATGCT. Unknown samples, no template controls and standards were run in triplicate. Average MSGV1-HBI0101 vector CPN per transduced cell (CPN/Td) was calculated by normalizing to the endogenous number of diploid albumin copies, and further adjusted to the percent of transduction.

Study design and patients’ evaluation

At the beginning of 2021, a phase I clinical trial for the treatment of multiple myeloma was initiated and registered at ClinicalTrials.gov (NCT04720313). This study aimed at evaluating HBI0101 safety and efficacy in patients with multiple myeloma and additional PC dyscrasias, including AL. Patients enrolled had to be refractory to at least three lines of treatment including a proteasome inhibitor, an immuno-modulator, and an anti-CD38 antibody, and to have no other available registered therapy. At study entry, all patients had a progressive disease. The phase I first part of the trial consisted of the administration of HBI0101-transduced T cells, at escalating cell doses of 150×106, 450 × 106, and 800 × 106 CAR+ cells. The patients reported herein, each participated in a different safety cohort. The complete study protocol, detailed in the Supplementary Appendix, and further outlined in Supplementary Fig. S1b, was authorized by the Hadassah Medical Center institutional review board (IRB) and by the Israeli Ministry of Health central ethics committee. A written informed consent from each of the patients was obtained, and the study was conducted and approved in accordance with the ethical guidelines of the Declaration of Helsinki, under the auspices of the Hadassah IRB. One patient was treated on a compassionate basis after obtaining informed consent and authorization of the IRB due to a concomitant active malignancy (myelodysplastic syndrome). This patient was treated with a dose of 450 × 106 cells as at the time of treatment the safety of cohort III (800 × 106 cells) was not yet assessed. AEs were graded according to NCI Common Terminology Criteria for Adverse Events (CTCAE), version 4.03. CRS was graded according to the published criteria (27).

BCMA-CART cells clinical grade production and administration

The production protocol of HBI0101 cells is well described in the Supplementary Materials and Methods section.

Patients’ lymphodepletion was achieved by the administration of fludarabine 25 mg/m2 and cyclophosphamide 250 mg/m2 on days 5 to 3 before DP infusion.

HBI0101 CART in vivo detection

CAR CPN was determined by quantitative real-time PCR using Taqman-based primers as described in the Supplementary Materials and Methods section.

Serum dFLC and serum BCMA quantification

Levels of involved and uninvolved FLCs (Siemens FLC assay) were determined in the serum of the patients with treated AL at the indicated time points. Serum samples for serum BCMA (sBCMA) were diluted 1:1,000 and were analyzed by sBCMA ELISA kit (R&D Systems). The ELISA plates were analyzed using a plate reader set to 450 nm (Biotek Industries) with Gen5 3.05 software. Values represent the mean of duplicate samples of each specimen.

Statistical analysis

Data were compiled using Excel software and all statistical analyses were performed using GraphPad Prism (v9.2.0) software. Appropriate statistical methods were used to calculate significance, as described in figure legends. Briefly, the following methods were used throughout this study: two-way ANOVA and paired or unpaired t test.

Data availability

The data generated in this study are available upon request from the corresponding author.

BCMA expression in AL- versus multiple myeloma–PCs

As a preclinical evaluation of HBI0101-based CART for the treatment of multiple myeloma and amyloidosis, we assessed the percent of BCMA+ cells in the BM of patients with multiple myeloma and AL, and measured the expression levels of BCMA on AL and multiple myeloma–PCs by flow cytometry (Fig. 1A). While the BM samples of patients with AL and multiple myeloma displayed similar percentage of BCMA+ cells, Fig. 1 (bottom) indicates that the mean fluorescence intensity (MFI) of BCMA on AL-PCs was significantly lower (average MFI = 1.9 in patients with AL, n = 18 vs. MFI = 3.8 in patients with multiple myeloma, n = 39; P < 0.05). However, based on our preclinical data (24) showing that multiple myeloma–PCs with an average MFI of BCMA expression of approximately 2.1 were eradicated following incubation with BCMA-CART cells, and in line with the recent publication on BCMA-targeting in patient with AL (23), we anticipated that this level would be sufficient for PC recognition by BCMA-CART cells and may represent a potential target for the treatment of AL.

Figure 1.

A, BCMA expression on AL- and multiple myeloma–PCs and preclinical evaluation. BCMA expression levels in patients with AL (n = 18) and multiple myeloma (n = 39). BCMA % of expression (top) and MFI (bottom) were determined by flow cytometry. Samples were gated on CD38++CD138++ cells. B, Elimination of BM-derived primary PCs (gated on CD38++CD138++) of AL donors following overnight co-incubation (1:1 E:T ratio) with autologous HBI0101 CART cells, in comparison with NT cells. C, HBI0101 CART activation following overnight co-incubation with BM-derived primary PCs of AL1 and AL2, as indicated by the percent of CD137+ (4–1BB+) cells (gated on CAR+ cells). Coculture with autologous NT cells serves as control. n = 2, P < 0.05. Middle and right panels: Cytokines secretion by HBI0101 CART or NT cells following co-incubating with BM-MNCs (P < 0.05). D, Increased apoptosis of multiple myeloma- and AL3- CD138+ magnetically enriched cells following co-incubation with autologous HBI0101 CART cells for 2 hours, comparing with autologous NT control cells. Cocultures of CD138- cell fraction with autologous CART or NT cells, serve as control. Apoptosis was assessed by determination of the intracellular level of cleaved caspase-3 in CD3-BCMA+ PCs by flow cytometry. Of note, the percent of CD138+ cells prior to magnetic isolation were 1.50% in the patient with multiple myeloma and 2.50% in the patient with AL, and significantly increased following enrichment (50.9% and 86.5%, respectively; see Supplementary Fig. S3).

Figure 1.

A, BCMA expression on AL- and multiple myeloma–PCs and preclinical evaluation. BCMA expression levels in patients with AL (n = 18) and multiple myeloma (n = 39). BCMA % of expression (top) and MFI (bottom) were determined by flow cytometry. Samples were gated on CD38++CD138++ cells. B, Elimination of BM-derived primary PCs (gated on CD38++CD138++) of AL donors following overnight co-incubation (1:1 E:T ratio) with autologous HBI0101 CART cells, in comparison with NT cells. C, HBI0101 CART activation following overnight co-incubation with BM-derived primary PCs of AL1 and AL2, as indicated by the percent of CD137+ (4–1BB+) cells (gated on CAR+ cells). Coculture with autologous NT cells serves as control. n = 2, P < 0.05. Middle and right panels: Cytokines secretion by HBI0101 CART or NT cells following co-incubating with BM-MNCs (P < 0.05). D, Increased apoptosis of multiple myeloma- and AL3- CD138+ magnetically enriched cells following co-incubation with autologous HBI0101 CART cells for 2 hours, comparing with autologous NT control cells. Cocultures of CD138- cell fraction with autologous CART or NT cells, serve as control. Apoptosis was assessed by determination of the intracellular level of cleaved caspase-3 in CD3-BCMA+ PCs by flow cytometry. Of note, the percent of CD138+ cells prior to magnetic isolation were 1.50% in the patient with multiple myeloma and 2.50% in the patient with AL, and significantly increased following enrichment (50.9% and 86.5%, respectively; see Supplementary Fig. S3).

Close modal

Evaluation of HBI0101 efficacy against primary AL-PCs ex vivo

We have previously reported the efficacy of the HBI0101 CART against multiple myeloma–PCs ex vivo (24). Here, we investigated whether HBI0101-based CART will be efficient in the eradication of AL- primary PCs as well. Following an overnight coculture with HBI0101, we observed an almost complete eradication of AL-PCs by HBI0101 (Fig. 1B), an effect that was already evident after 1 hour of coculture (Supplementary Fig. S2). In contrast, AL-PCs were not affected by the presence of NT control cells, suggesting that HBI0101 cells were able to recognize AL-PCs and exert specific BCMA-directed antitumoral function. In this regard, non-tumor BM-MNCs were not affected by the presence of HBI0101 as indicated by 7AAD staining (Supplementary Fig. S2). In addition, following incubation with AL BM-MNCs, HBI0101 cells underwent significant activation evidenced by the upregulation of the 4–1BB marker and increased secreted levels of the pro-inflammatory cytokines IFNγ and TNFα (Fig. 1C), in comparison with NT cells (P < 0.05). We therefore concluded that HBI0101-mediated anti-BCMA functions are restricted to CD38++CD138++ cells, while sparing the other BM cell populations.

To further substantiate the observation that PC elimination by HBI0101 cells is apoptosis-mediated, we analyzed the intracellular level of cleaved caspase-3. Figure 1D confirms that, following incubation with HBI0101 cells, but not with NT cells, there is a marked increase in the apoptosis of AL or multiple myeloma magnetically enriched CD138+ BM-PCs (Supplementary Fig. S3). Moreover, Supplementary Fig. S4 further suggests that HBI0101 cell activation and proinflammatory cytokine secretion upon stimulation with AL or multiple myeloma CD138+ cells are specifically mediated via BCMA-CAR, because NT cells showed significantly lower levels of 4–1BB (left) and barely detectable levels of IFNγ and TNFα (middle and right), regardless of whether NT cells were incubated with CD138+ (Supplementary Fig. S4) or with the CD138–cellular fraction. Data attesting for the specificity of HBI0101 against BCMA-expressing myeloma cells has been reported (24), and is provided in Supplementary Fig. S5, as well. Altogether, these data support the proof-of-concept for the potential efficacy of HBI0101 CART-based therapy for the treatment of AL.

HBI0101 CART cell production and treatment of patients with AL

Encouraged by our ex vivo results, and a view toward the clinical evaluation of HBI0101 in patients with AL, we generated BCMA-CART cells from Patients' 1–4 leukapheresis procedures. Following a 10-day production, all 4 patients were infused with fresh BCMA-CART cells. Although CART manufacturing was initiated from diverse apheresis sources, the process was shown robust with final DPs meeting release criteria (see Supplementary Table S1). All four clinical batches shared similar expansion pattern in culture (days 7 until day 0) and DPs' characteristics (Supplementary Fig. S6). Supplementary Figure S6c–S6d depicts the exhaustion and differentiation statuses, respectively, of the DPs at the day of release (day 0).

Patients with AL treated with HBI0101

The phase I clinical trial consisted of three escalating cell doses, as described in the clinical protocol (Appendix 1). Three patients were treated within this clinical trial, and the fourth was treated on a compassionate basis. Patients' baseline characteristics, history, and previous treatments are summarized in Table 1. All patients were refractory to their last treatment line, 3 were penta-refractory, and 2 were anti-BCMA belantamab mefadotin refractory. All patients had a progressive disease at enrollment. None received any bridging therapy. The full patient description is detailed in the Supplementary Data 1.

Table 1.

Patients' characteristics at enrollment.

Patient 1Patient 2Patient 3Patient 4
Age 64 58 82 63 
Gender Male Female Male Male 
Concomitant multiple myeloma Yes No No No 
Involved FLC (mg/L) 155 183 87 560 
dFLC (mg/L) 143 177 50 550 
BM-PCs (%) 15 15 
FISH cytogenetics T11:14 T14:16 1Q+ 14Q- NOS T11:14 
Organ involvement Cardiac Renal Autonomic Cardiac Renal Hepatic Renal GI Cardiac Hepatic Lung Soft tissue Autonomic 
NYHA stage III IV III 
ProBNP (pg/mL) 7,500 2,008 119 2,773 
Trop T (ng/L) 60 40 78 
Creatinine (mmol\L) 80 72 110 100 
Albuminuria (g/24 h) 0.3 0.3 2.4 0.1 
ALKP (u/L) 45 218 84 140 
MAYO stage IIIa IIIa IIIa 
ECOG PS 
Prior lines of therapy 10 and MDS 
Best response/which line VGPR/3rd VGPR/2nd CR/1st CR/1st and 4th 
Previous ASCT Yes Yes No Yes (as salvage) 
Triple-drug refractory Yes Yes Yes Yes 
Penta-drug refractory Yes Yes No Yes 
Belantamab refractory No Yes No Yes 
Last line refractory Yes Yes Yes Yes 
Years since diagnosis 10.5 15 4.5 
Patient 1Patient 2Patient 3Patient 4
Age 64 58 82 63 
Gender Male Female Male Male 
Concomitant multiple myeloma Yes No No No 
Involved FLC (mg/L) 155 183 87 560 
dFLC (mg/L) 143 177 50 550 
BM-PCs (%) 15 15 
FISH cytogenetics T11:14 T14:16 1Q+ 14Q- NOS T11:14 
Organ involvement Cardiac Renal Autonomic Cardiac Renal Hepatic Renal GI Cardiac Hepatic Lung Soft tissue Autonomic 
NYHA stage III IV III 
ProBNP (pg/mL) 7,500 2,008 119 2,773 
Trop T (ng/L) 60 40 78 
Creatinine (mmol\L) 80 72 110 100 
Albuminuria (g/24 h) 0.3 0.3 2.4 0.1 
ALKP (u/L) 45 218 84 140 
MAYO stage IIIa IIIa IIIa 
ECOG PS 
Prior lines of therapy 10 and MDS 
Best response/which line VGPR/3rd VGPR/2nd CR/1st CR/1st and 4th 
Previous ASCT Yes Yes No Yes (as salvage) 
Triple-drug refractory Yes Yes Yes Yes 
Penta-drug refractory Yes Yes No Yes 
Belantamab refractory No Yes No Yes 
Last line refractory Yes Yes Yes Yes 
Years since diagnosis 10.5 15 4.5 

Abbreviations: ALKP, alkaline phosphatase; BM-PC, bone marrow plasma cell content; BNP, brain natriuretic peptide; ECOG PS, Eastern Cooperative Oncology Group performance status; FISH, fluorescence in situ hybridization; FLC, free light chain; NYHA, New York Heart Association; Top T, Troponin T (high sensitivity).

Patient 1

A 61-year-old male with concomitant multiple myeloma and AL with cardiac, renal, and autonomic involvement, previously treated with eight prior lines of therapy. At the timing of CART, clinical NYHA 3 was apparent, and MAYO stage IIIa disease, with a proBNP of 7,500 pg/mL. In April 2021 the patient was enrolled to the first safety cohort of the trial and infused with 150 × 106 HBI0101 cells. The patient did not experience CRS (Table 2) or exacerbation of his heart failure and remained stable until discharge. No further AEs or organ decompensation were noted following HBI0101 therapy. The patient remained hypogammaglobulinemic and after 8.5 months presented with a grade 3 pseudomonas pneumonia requiring hospitalization, later resolved with antibiotic treatment.

Table 2.

Adverse events and CART-related toxicity.

Patient 1Patient 2Patient 3Patient 4
CAR+ cells infused (x106150 450 800 450 
Adverse events of interest 
 CRS No Yes Yes Yes 
 CRS grade  
 Time to onset (days)  
 CRS duration (days)  
 Tocilizumab use (number of doses) 
 Steroids use No No Yes No 
 Vasopressor use No No Yes No 
 High-flow oxygen use No No Yes Yes 
 ICANs No No No No 
Hematologic AEs (grades) 
 Neutropenia 
 Anemia 
 Thrombocytopenia 4a 
 Duration of hematologic AEb (days) Ongoing >31 
 AL organ deterioration No Yes No Yes 
 CHF exacerbation No Yes No Yes 
 Acute renal failure No No No No 
 Hepatic dysfunction No Yes - grade 3 No No 
Non-hematologic other AEs (grades) 
 Fatigue 
 GI 
 Rash 
 Febrile neutropenia 
 Infections 
 Hypogammaglobulinemia Yes Yes Yes Yes 
 Post CART infections during follow-up Yes - at day 248 pneumonia grade 3 Yes - at day 33 osteomyelitis grade 3 No No 
Patient 1Patient 2Patient 3Patient 4
CAR+ cells infused (x106150 450 800 450 
Adverse events of interest 
 CRS No Yes Yes Yes 
 CRS grade  
 Time to onset (days)  
 CRS duration (days)  
 Tocilizumab use (number of doses) 
 Steroids use No No Yes No 
 Vasopressor use No No Yes No 
 High-flow oxygen use No No Yes Yes 
 ICANs No No No No 
Hematologic AEs (grades) 
 Neutropenia 
 Anemia 
 Thrombocytopenia 4a 
 Duration of hematologic AEb (days) Ongoing >31 
 AL organ deterioration No Yes No Yes 
 CHF exacerbation No Yes No Yes 
 Acute renal failure No No No No 
 Hepatic dysfunction No Yes - grade 3 No No 
Non-hematologic other AEs (grades) 
 Fatigue 
 GI 
 Rash 
 Febrile neutropenia 
 Infections 
 Hypogammaglobulinemia Yes Yes Yes Yes 
 Post CART infections during follow-up Yes - at day 248 pneumonia grade 3 Yes - at day 33 osteomyelitis grade 3 No No 

Abbreviations: CHF, congestive heart failure; GI, gastrointestinal.

aStarted with grade 4 due to MDS.

bDuration to resolution to grade 2 or better.

Patient 2

A 59-year-old female diagnosed with AL, with cardiac, renal, and hepatic involvement in 2017. In July 2021, after six prior treatment lines, the patient was enrolled to the second safety cohort, and infused with 450 × 106 CART cells. At the time of CART infusion, the patient suffered from NYHA stage IV heart failure, deteriorating liver function tests, elevated alkaline phosphatase levels, with severe anasarca before the infusion that was stabilized with supportive therapy. After infusion, the patient experienced 2 days of grade 2 CRS (Table 2), which required a single dose of tocilizumab. Heart failure exacerbation was evident prior and throughout the length of hospitalization, requiring high doses of diuretics, and the patient remained stable until discharge. Following discharge, at day 45, the patient developed liver de-compensation and ascites. There was no evidence of hepatic or portal venous occlusion. Decompensation gradually resolved, and a hepatic organ response was noted with alkaline phosphatase reduction and eventual resolution of the ascites. At the same time, the patient developed fever, which proved to be secondary to osteomyelitis of the spine, which eventually resolved, requiring prolonged antibiotic treatment.

Patient 3

An 82-year-old male diagnosed with AL FLC K amyloidosis in 2006 with renal (3 gr of albuminuria) and gastrointestinal involvements with no cardiac involvement. After six lines of therapy, in November 2021, the patient was enrolled to the third safety cohort and infused with 800 × 106 HBI0101 cells. The patient experienced a grade 3 CRS which required 3 doses of tocilizumab (Table 2). No renal failure was noted, and he remained stable until discharge, although a grade 3 infection was documented.

Patient 4

The last patient was treated on a compassionate basis because of a myelodysplastic syndrome and low blood counts. A 61-year-old male diagnosed in 2017 with FLC L cardiac, autonomic, soft tissue, and renal AL. The last assessment prior to CART infusion showed clinical NYHA stage III, MAYO stage IIIa disease with a proBNP of 2,773 pg/mL. After obtaining an informed consent (the patient fully aware of the CART treatment risks for both diseases) and the authorization of the ethics committee in December 2021, the patient was infused with 450 × 106 HBI0101 cells. The patient experienced a short grade 3 CRS (Table 2) which required a single dose of tocilizumab. At the time of CRS, a heart failure exacerbation was noted, but this responded to the tocilizumab and supportive care. No renal failure was noted, and after 24 hours, Patient 4 remained stable until discharge. Before treatment, the patient's blood counts presented with grade 1 neutropenia, grade 2 anemia, and grade 4 thrombocytopenia. These worsened to grade 4 neutropenia, grade 3 anemia, and grade 4 thrombocytopenia following HBI0101 infusion. While the neutropenia and anemia recovered to grade 2, grade 4 thrombocytopenia continued. A repeated biopsy of BM after 30 days of treatment showed severe hypocellularity, which implicates CART toxicity more than a worsening of the MDS.

None of the patients had developed ICANs or any new treatment-related AEs either, although one early infection (osteomyelitis) at month 2 and one late pneumonia at month 8 post CART-cell therapy were observed. All AEs were short and manageable. All patients showed pan-hypogammaglobulinemia and received intravenous Ig (IVIG) supplementations. It should be emphasized that, although an initial cardiac deterioration was noted during and after the CART for Patients 2 (before and after infusion) and 4, it was clinically manageable. Currently, at a median follow-up of 5.2 months (2.5–9.5), all patients were alive. The detailed AEs and CART-related toxicity is summarized in Table 2.

Patient outcome

All 4 patients achieved a hematologic CR with a dFLC of 0 to 8 mg/L (Table 3 and Fig. 2A). Moreover, uninvolved FLC values were also reduced to below the normal range in comparison with the corresponding values prior to CART treatment (Fig. 2B). The decrease of both involved and uninvolved FLC 30 days post HBI0101 infusion, reflects the robust effect of HBI0101 on both malignant and normal PCs. Approximately 30 days post HBI0101 treatment, BM MRD assessment at 10−5 negativity was achieved for Patients 1, 3, and 4. While Patient 2 was unavailable for MRD testing at that time, MRD assessed at day 180 post CART infusion showed MRD negativity. The time to best response ranged from 17 to 57 days. Respectively, no patient yet progressed, and the duration of response is ongoing for all patients, albeit the various HBI0101 infusion doses. Although patients' follow-up was short, organ responses were already apparent in all 4 patients. All cardiac patients showed significant reduction of proBNP levels and clinical improvement of their NYHA status (Table 3). Although Patient 2 initially experienced de-compensation of hepatic function ongoing for 3 months and cardiac dysfunction, she had recovered over time, and displayed both hepatic and cardiac organ response at 6 months as manifested by NYHA clinical stage improvement, and resolution of ascites. In fact, all cardiac patients NYHA clinical stage improved and Patient 3 with renal involvement had improvement of peripheral edema in parallel to the reduction of albuminuria. Although quality of life (QoL) questionnaires were not performed in this trial, it is evident that clinical amelioration of symptoms was evident, and correlated with a subjective QoL improvement. All 4 patients developed pan-hypogammaglobulinemia following CART infusion (Fig. 2C) and received IVIG supplementation. Figure 2D shows the expression level of BCMA on AL patients' BM PCs prior to HBI0101 infusion, while Fig. 2E and F shows the decrease in the percent of BM-PCs at 30 days post HBI0101 infusion. In addition, PET-CT scan of Patient 1 with concomitant multiple myeloma 30 days post HBI0101 infusion, shows a marked decrease in size and intensity at most tumor sites in comparison with the lesions which were detected by PET-CT before CART infusion (Fig. 2G). The detailed efficacy results are summarized in Table 3.

Table 3.

Efficacy results.

Patient 1Patient 2Patient 3Patient 4
CAR+ cells infused (x106150 450 800 450 
     
Best hematologic response CR CR CR CR 
iFLC at best response (mg/L) 0.6 0.9 
dFLC at best response (mg/L) 1.4 
MRD (10−5) negativity at Day 30 Yes  Yes Yes 
Day 180 Yes Yes   
Time to best confirmed response (days) 27 57 17 17 
Follow-up (months) 9.5 6.5 3.5 2.5 
DOR 8.5 4.4 
Organ response Yes Yes Yes Yes 
Delta response (% reduction) proBNP (pg/ml)/albuminuria (g/d) −4,800 (−64%) NA −1,295 (−64%) NA NA −1.03 (−67%) −1,872 (−68%) NA 
NYHA change III to II IV to II NA III to II 
Additional organ responses Alk Phos (u/l) NA Hepatic: 280 to 150 NA NA 
Patient 1Patient 2Patient 3Patient 4
CAR+ cells infused (x106150 450 800 450 
     
Best hematologic response CR CR CR CR 
iFLC at best response (mg/L) 0.6 0.9 
dFLC at best response (mg/L) 1.4 
MRD (10−5) negativity at Day 30 Yes  Yes Yes 
Day 180 Yes Yes   
Time to best confirmed response (days) 27 57 17 17 
Follow-up (months) 9.5 6.5 3.5 2.5 
DOR 8.5 4.4 
Organ response Yes Yes Yes Yes 
Delta response (% reduction) proBNP (pg/ml)/albuminuria (g/d) −4,800 (−64%) NA −1,295 (−64%) NA NA −1.03 (−67%) −1,872 (−68%) NA 
NYHA change III to II IV to II NA III to II 
Additional organ responses Alk Phos (u/l) NA Hepatic: 280 to 150 NA NA 

Abbreviations: Alk Phos, alkaline phosphatase; BNP, brain natriuretic peptide; dFLC, delta free light chain; DOR, duration of response; iFLC, involved free light chain; NYHA, New York Heart Association.

Figure 2.

Clinical outcome of HBI0101 CART-based therapy in the treatment of AL. A, Difference between involved (iFLC) and uninvolved FLC (dFLC) of 4 patients with AL was assessed at baseline and post HBI0101 CART infusion. B, Uninvolved FLC of 4 patients with AL was assessed at baseline and post HBI0101 CART infusion at day 30. Normal range for Kappa light chain: 6.7–22.4 mg/L, and Lambda light chain: 8.3–27 mg/L. C, Immunoglobulin levels prior to and following HBI0101 CART infusion were monitored over time. The mark ↓ mentions intravenous Ig (IVIG) intake by Patients 1 and 4 at day 26 post CART infusion. D, BCMA median expression in AL patients' BM-derived PCs (gated on CD38++CD138++ cells) prior to HBI0101 CART infusion was assessed by flow cytometry. Red dots represent PCs (gated on CD38++CD138++ cells), while grey dots represent non-PCs population. E, Demonstrating efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ AL primary PCs. BM samples prior to and one month following HBI0101 CART infusion were assessed for the presence of PCs by flow cytometry by gating on CD38++CD138++ cells. F, Dot plot representation of Patient 4′s flow cytometry data depicted in E. G, PET-CT scans from before and after HBI0101 CART treatment.

Figure 2.

Clinical outcome of HBI0101 CART-based therapy in the treatment of AL. A, Difference between involved (iFLC) and uninvolved FLC (dFLC) of 4 patients with AL was assessed at baseline and post HBI0101 CART infusion. B, Uninvolved FLC of 4 patients with AL was assessed at baseline and post HBI0101 CART infusion at day 30. Normal range for Kappa light chain: 6.7–22.4 mg/L, and Lambda light chain: 8.3–27 mg/L. C, Immunoglobulin levels prior to and following HBI0101 CART infusion were monitored over time. The mark ↓ mentions intravenous Ig (IVIG) intake by Patients 1 and 4 at day 26 post CART infusion. D, BCMA median expression in AL patients' BM-derived PCs (gated on CD38++CD138++ cells) prior to HBI0101 CART infusion was assessed by flow cytometry. Red dots represent PCs (gated on CD38++CD138++ cells), while grey dots represent non-PCs population. E, Demonstrating efficacy of HBI0101 CART-based therapy in eliminating CD38++CD138++ AL primary PCs. BM samples prior to and one month following HBI0101 CART infusion were assessed for the presence of PCs by flow cytometry by gating on CD38++CD138++ cells. F, Dot plot representation of Patient 4′s flow cytometry data depicted in E. G, PET-CT scans from before and after HBI0101 CART treatment.

Close modal

HBI0101 CART in vivo kinetics

HBI0101 cell in vivo expansion was noted in all 4 infused patients (Fig. 3A). The median time of detectable CAR by qPCR in the peripheral blood was 24±10 days post CART infusion, and T cells were still detectable in all 4 patients at day 27±10. The peak in the rate of CART cell growth in peripheral blood was observed between days 6 to 10 post CART infusion (Fig. 3B). Despite receiving low and intermediate doses of CART cells (150 × 106 and 450 × 106), Patients 1 and 4 showed maximal CART cells expansion in vivo (Fig. 3A). In contrast, Patients 2 and 3 who were infused with intermediate and high doses of CART cells (450 × 106 and 800 × 106, respectively), showed lower in vivo expansion (Fig. 3A). In line with this observation, higher numbers of CART cells were detected in the BM of Patients 1 and 4 one month following CART cells infusion, while CART cells were barely detected in Patients 2 and 3 (Fig. 3C). In addition, analyzing the kinetics of the dFLC levels in the serum of all 4 patients with AL prior to, and following CART-cell infusion, we observed a significant decline during the first month of treatment. This decrease in dFLC levels was concomitant with CART expansion in the peripheral blood (Fig. 3D). A similar trend was observed measuring the levels of sBCMA, an additional biomarker for multiple myeloma and AL monitoring (refs. 15, 17, 19; Supplementary Fig. S7). Overall, these data indicate that dFLC and sBCMA serum level reductions correlate with the successful HBI0101 in vivo expansion.

Figure 3.

HBI0101 in vivo kinetic. A, The number of HBI0101 CART per 1 mL blood was determined by quantification of CAR transgene levels by qRT-PCR method following CART infusion at the indicated times, and further adjusted to the percent of transduction at the day of CART infusion. The limit of quantitation (LOQ) was 102 CART/mL blood. B, HBI0101 cells in vivo expansion rates. Black lines represent the median; upper and lower bars represent the maximal and minimal values, respectively. C, HBI0101 CART/mL in AL patients’ BM fluid, 1 month after CART infusion (determined as detailed in A). D, Difference between involved and uninvolved FLC (dFLC) levels prior to and following CART infusion (right y-axis; filled circles) is compared with CART cell expansion indicated by the CART/mL (left y-axis; empty circles).

Figure 3.

HBI0101 in vivo kinetic. A, The number of HBI0101 CART per 1 mL blood was determined by quantification of CAR transgene levels by qRT-PCR method following CART infusion at the indicated times, and further adjusted to the percent of transduction at the day of CART infusion. The limit of quantitation (LOQ) was 102 CART/mL blood. B, HBI0101 cells in vivo expansion rates. Black lines represent the median; upper and lower bars represent the maximal and minimal values, respectively. C, HBI0101 CART/mL in AL patients’ BM fluid, 1 month after CART infusion (determined as detailed in A). D, Difference between involved and uninvolved FLC (dFLC) levels prior to and following CART infusion (right y-axis; filled circles) is compared with CART cell expansion indicated by the CART/mL (left y-axis; empty circles).

Close modal

Because AL is a disease originating in malignant PCs, most available treatments are adopted from multiple myeloma–directed therapies. Yet, due to the wide clinical spectrum of organ failure in AL, the same regimens may be extremely toxic to these patients (1–4), and multiple myeloma–oriented clinical trials usually exclude patients with AL. Being a rare yet heterogenic disease, large controlled clinical trials focusing on AL are difficult to conduct (1, 5–7). Anti–BCMA-CART–cell therapy holds great promise in multiple myeloma, showing a potential not only for deep, but also durable responses (13–16, 17–19). However, CART-cell therapy is associated with a high risk of AEs, mostly of CRS and ICANs, and consequently excludes patients with AL due to their frailty. In addition, it has been reported that intrinsic divergence between AL- and multiple myeloma–PCs, including both phenotypic and intracellular genetic changes, could affect the response of AL-PCs to multiple myeloma–derived therapies (28). For instance, BCMA has consistently been shown to be expressed at low levels on AL-PCs, suggesting that BCMA-directed therapy may not be appropriate for the AL subset of patients (20–22). Herein, we showed that although BCMA expression intensity detected on AL-PCs was significantly lower than observed in multiple myeloma-PCs, a marked efficacy in AL-PCs' clearance was observed when cocultured with the engineered BCMA-CART cells in vitro.

We have developed an in-house CART-cell therapy using a novel academic-assembled anti-BCMA construct, and present here the results from the phase I clinical trial, aimed at evaluating BCMA-CART safety and efficacy in patients with multiple myeloma, where patients with AL were intentionally not excluded from the protocol. Previous studies in AL have shown that patients responding to conventional therapy, such as autologous stem cell transplantation (ASCT)-treated patients with AL achieving CR, fare better than corresponding ASCT-treated patients with multiple myeloma (29), implying that achievement of deep responses may be even more important for patients with AL. In addition, the achievement of MRD negativity was additionally correlated with high probability of organ responses (10), making this endpoint desirable. MRD was highly achieved and seen in multiple myeloma CART clinical trials (17, 19). Indeed, this observation was our lead hypothesis to investigate first ex vivo and then the clinical relevance of BCMA-CART–cell therapy in the treatment of AL. In this respect, the current report is aimed to provide an initial demonstration of the safety and high efficacy of this strategy and supports its further implementation for the treatment of patients with AL.

Herein, we report, for the first time, the preliminary safety and efficacy of CART treatment in patients with AL. Three patients presented with stage IIIa cardiac involvement, proBNP ranging from 2,000 to 7,500 pg/mL, and NYHA II-III clinical heart failure at the time of treatment. In addition, when enrolled into our HBI0101 clinical study, all patients had no available therapy. Three patients developed short and manageable CRS (grade 3 in 2 patients), requiring limited doses of tocilizumab, to which they responded well, and no cases of ICANs were observed. These CRS reported are not unexpected and were manageable. Moreover, requirement of only one tocilizumab dose is favoring the relatively low hazard and controllable state of the CRS. Two of 3 cardiac patients had de-compensation of their diastolic heart failure, which was managed with standard supportive care. One patient had decompensation of hepatic cirrhosis, which stabilized after 4 months with concomitant organ response. Safety outcomes were comparable with the multiple myeloma patient cohort (data not shown), but excluding the prolonged grade 3 and 4 cytopenia observed in the multiple myeloma cohort attributed to the underlying proliferative disease involving the BM, which were not seen here. All patients developed hypogammaglobulinemia and received IVIG supplementation following HBI0101 CART-cell therapy. Three of them developed grade 3 infections, mostly close to CART infusion (within 60 days). Yet, a late grade 3 bacterial pneumonia was recorded in 1 patient 8 months following CART infusion, while being in remission and despite IVIG supplementation. A better supportive care for patients with AL with infection should be an area for potential improvement. Indeed, patients with multiple myeloma and AL have an increased risk for infection before CART-cell therapy, and infections are a major cause of both morbidity and mortality. The experience so far suggests that patients with multiple myeloma remain extremely vulnerable to infection after infusion of CART cells (13). Algorithms to guide infection management specifically in patients receiving CART cells, such as IVIG supplementation, are currently being developed.

All 4 patients reported here had clinically active, relapsing and progressive disease following six to 10 lines of treatment, and were all resistant to their last line of therapy, including 2 patients resistant to anti-BCMA antibodies. Patients with AL die as a result of the toxicity of amyloidogenic LCs (28). Lessons learned from the clinic reveal that reducing the concentration of the circulating amyloidogenic FLCs improved cardiac function and, thereby, prolonged survival and organ responses (6, 10, 11, 28). Patients with AL with undetectable MRD have a very high probability of organ response and a very low probability of hematologic relapse (10). Our BCMA-CART, consistent with other reports on BCMA-CART in patients with multiple myeloma (13, 14, 17, 19), has induced remarkable responses in these 4 heavily pretreated patients with AL, achieving a fast and efficient CR, the noteworthy 0 to 8 mg/dL dFLC levels, and flow cytometry 10−5 MRD negativity in all four. Notably, none of these patients have achieved a prior CR (if ever at all) for years before CART treatment. The deep responses seen was also correlating with the clinical improvement of involved organ–related symptoms and subsequent organ responses observed in all 4 patients. These responses were translated into clinical amelioration of symptoms, as exemplified by NYHA clinical stage reduction, and correlated with a subjective QoL improvement. Although the follow-up duration reported here is short, with a median duration of 5.2 months (2.5–9.5), hematologic responses are ongoing. We thus hypothesize that unlike in multiple myeloma, where the clinical picture is dominated by the hyper-proliferative multiple myeloma clone, in AL, severe organ dysfunction is usually caused by a small PC clone producing the amyloidogenic LC (28, 30).

Robustness of our results is also confirmed by the decline observed in serum dFLC and sBCMA levels following CART-cell infusion in all 4 patients. Indeed, we show here an inverse correlation between serum dFLC and sBCMA levels and HBI0101 CART-cell expansion in the peripheral blood. While sBCMA levels may have controversial significance in the context of BCMA-targeted therapies, because CART cells may act as decoy for sBCMA and thus interfere with sBCMA evaluation; given the dFLC decline and subsequent BM-PC disappearance, we speculate that the significant decrease in both dFLC and sBCMA levels is indicative of the substantial hematologic responses seen in all patients. There was no correlation between the infused HBI0101 cell doses and their peak numbers in patients’ blood, indicating that even low doses of HBI0101 cells are sufficient to achieve the desired response. Interestingly, Patients 1 and 4, displaying the highest HBI0101 cell number in the blood, had high tumor burdens before treatment as represented in Fig. 2F and G, respectively. This observation may indicate that HBI0101 proliferation in vivo correlates with tumor load prior to treatment

Our in-house novel academic anti–BCMA-CART system is, to the best of our knowledge, the first proof-of-concept that this strategy is indeed efficacious and safe for the treatment of patients with advanced, RR AL. In this respect, the fast, deep, and prolonged responses sought-for-features observed for our patients, render CART-cell therapy to be a potential clinical tool to improve survival and organ survival in patients with advanced AL. Our clinical trial is ongoing, and hopefully other future CART clinical trials and real-world data will include patients with AL too, to further confirm the safety and efficacy of using BCMA-CART for the treatment of AL.

S. Kfir-Erenfeld reports a patent for 63/308,277 pending. N. Asherie reports a patent for 63/308,277 pending. C.J. Cohen reports a patent for "Anti-BCMA CAR to target multiple myeloma, compositions and method thereof" pending. P. Stepensky reports a patent for “Anti-BCMA CAR to target multiple myeloma, compositions and method thereof” pending. No disclosures were reported by the other authors.

S. Kfir-Erenfeld: Conceptualization, data curation, formal analysis, supervision, validation, investigation, writing–original draft, writing–review and editing. N. Asherie: Conceptualization, data curation, formal analysis, supervision, validation, investigation, visualization, methodology, writing–original draft, writing–review and editing. S. Grisariu: Conceptualization, supervision, validation, investigation, visualization, writing–original draft, writing–review and editing. B. Avni: Validation, investigation, writing–review and editing. E. Zimran: Validation, investigation, writing–review and editing. M. Assayag: Validation, investigation. T.D. Sharon: Validation, investigation. M. Pick: Investigation, writing–review and editing. E. Lebel: Investigation, writing–review and editing. A. Shaulov: Investigation, writing–review and editing. Y.C. Cohen: Supervision, writing–review and editing. I. Avivi: Supervision, writing–review and editing. C.J. Cohen: Conceptualization, supervision, funding acquisition, writing–review and editing. P. Stepensky: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, validation, investigation, visualization, methodology, writing–original draft, project administration, writing–review and editing. M.E. Gatt: Conceptualization, supervision, investigation, methodology, writing–original draft, writing–review and editing.

This work is supported by generous support from Steinfeld and Cuniff family, the estate of Allan Habelson, and by the Amyloidosis Patient Association of Israel. C.J. Cohen is supported by the Adelis Foundation and the Israel Science Foundation (646/20).

We would like to thank our patients and their families for the trust and giving us the ability to perform this study. We would like to thank our departmental nursing and administrative staff for their assistance. We would also like to thank Prof. Zeev Rotstein, former general director of Hadassah Medical Centre for his support of this study.

S. Kfir-Erenfeld and N. Asherie designed and performed the ex vivo experiments, protocol writing, CART production and evaluation, and manuscript preparation. S. Grisariu and B. Avni performed protocol writing, CART treatment, and manuscript preparation. E. Zimran, E. Lebel, and A. Shaulov performed CART treatment and evaluation and manuscript preparation. M. Assayag and T.D. Sharon performed CART production and evaluation. M. Pick performed CART evaluation and manuscript preparation. Y.C. Cohen and I. Avivi performed CART evaluation and manuscript writing. C.J. Cohen designed HBI0101 CAR construct, and supervised the preclinical multiple myeloma study and manuscript preparation. P. Stepensky designed and supervised the study, protocol writing, CART treatment and evaluation, and manuscript preparation. M.E. Gatt performed protocol writing, CART treatment and evaluation, and manuscript preparation.

The publication costs of this article were defrayed in part by the payment of publication fees. Therefore, and solely to indicate this fact, this article is hereby marked “advertisement” in accordance with 18 USC section 1734.

Note: Supplementary data for this article are available at Clinical Cancer Research Online (http://clincancerres.aacrjournals.org/).

1.
Gatt
ME
,
Palladini
G
.
Light chain amyloidosis 2012: a new era
.
Br J Haematol
2013
;
160
:
582
98
.
2.
Gatt
ME
.
Light chain amyloidosis 2014
.
Int J Hematol Disorder
2014
;
1
:
21
9
.
3.
Palladini
G
,
Merlini
G
.
What is new in diagnosis and management of light chain amyloidosis?
Blood
2016
;
128
:
159
68
.
4.
McCausland
KL
,
White
MK
,
Guthrie
SD
,
Quock
T
,
Finkel
M
,
Lousada
I
, et al
.
Light chain (AL) amyloidosis: the journey to diagnosis
.
Patient
2018
;
11
:
207
16
.
5.
Merlini
G
,
Seldin
DC
,
Gertz
MA
.
Amyloidosis: pathogenesis and new therapeutic options
.
J Clin Oncol
2011
;
29
:
1924
33
.
6.
Palladini
G
,
Milani
P
,
Merlini
G
.
Management of AL amyloidosis in 2020
.
Hematology Am Soc Hematol Educ Program
2020
;
2020
:
363
71
.
7.
Comenzo
RL
,
Reece
D
,
Palladini
G
,
Seldin
D
,
Sanchorawala
V
,
Landau
H
, et al
.
Consensus guidelines for the conduct and reporting of clinical trials in systemic light-chain amyloidosis
.
Leukemia
2012
;
26
:
2317
25
.
8.
Warsame
R
,
Kumar
SK
,
Gertz
MA
,
Lacy
MQ
,
Buadi
FK
,
Hayman
SR
, et al
.
Hematology patient reported symptom screen to assess quality of life for AL amyloidosis
.
Am J Hematol
2017
;
92
:
435
40
.
9.
Palladini
G
,
Lavatelli
F
,
Russo
P
,
Perlini
S
,
Perfetti
V
,
Bosoni
T
, et al
.
Circulating amyloidogenic free light chains and serum N-terminal natriuretic peptide type B decrease simultaneously in association with improvement of survival in AL
.
Blood
2006
;
107
:
3854
8
.
10.
Palladini
G
,
Paiva
B
,
Wechalekar
A
,
Massa
M
,
Milani
P
,
Lasa
M
, et al
.
Minimal residual disease negativity by next-generation flow cytometry is associated with improved organ response in AL amyloidosis
.
Blood Cancer J
2021
;
11
:
34
.
11.
Shen
KN
,
Miao
HL
,
Zhang
CL
,
Feng
J
,
Zhang
L
,
Cao
XX
, et al
.
Posttreatment dFLC less than 10 mg/L predicts superior organ response and longer time to next treatment in newly diagnosed light-chain amyloidosis patients treated with bortezomib
.
Leuk Lymphoma
2021
;
62
:
874
82
.
12.
Kastritis
E
,
Palladini
G
,
Minnema
MC
,
Wechalekar
AD
,
Jaccard
A
,
Lee
HC
, et al
.
Daratumumab-based treatment for immunoglobulin light-chain amyloidosis
.
N Engl J Med
2021
;
385
:
46
58
.
13.
Mikkilineni
L
,
Kochenderfer
JN
.
CART-cell therapies for patients with multiple myeloma
.
Nat Rev Clin Oncol
2021
;
18
:
71
84
.
14.
Sidana
S
,
Shah
N
.
CAR T-cell therapy: Is it prime time in myeloma?
Hematology Am Soc Hematol Educ Program
2019
;
2019
:
260
5
.
15.
Ali
SA
,
Shi
V
,
Maric
I
,
Wang
M
,
Stroncek
DF
,
Rose
JJ
, et al
.
T cells expressing an anti–B-cell maturation antigen chimeric antigen receptor cause remissions of multiple myeloma
.
Blood
2016
;
128
:
1688
700
.
16.
Brudno
JN
,
Maric
I
,
Hartman
SD
,
Rose
JJ
,
Wang
M
,
Lam
N
, et al
.
T cells genetically modified to express an anti-B-cell maturation antigen chimeric antigen receptor cause remissions of poor-prognosis relapsed multiple myeloma
.
J Clin Oncol
2018
;
36
:
2267
80
.
17.
Munshi
NC
,
Anderson
LD
Jr.
,
Shah
N
,
Madduri
D
,
Berdeja
J
,
Lonial
S
, et al
.
Idecabtagene vicleucel in relapsed and refractory multiple myeloma
.
N Engl J Med
;
384
:
705
16
.
18.
Berdeja
JG
,
Madduri
D
,
Usmani
SZ
,
Jakubowiak
A
,
Agha
M
,
Cohen
AD
, et al
.
Ciltacabtagene autoleucel, a B-cell maturation antigen-directed chimeric antigen receptor T-cell therapy in patients with relapsed or refractory multiple myeloma (CARTITUDE-1): a phase Ib/II open-label study
.
Lancet
2021
;
398
:
314
24
.
19.
Raje
N
,
Berdeja
J
,
Lin
Y
,
Siegel
D
,
Jagannath
S
,
Madduri
D
, et al
.
Anti-BCMA CAR T-cell therapy bb2121 in relapsed or refractory multiple myeloma
.
N Engl J Med
2019
;
380
:
1726
37
.
20.
Bal
S
,
Sigler
A
,
Chan
A
,
Chung
DJ
,
Dogan
A
,
Giralt
SA
, et al
.
First description of B-cell maturation antigen expression in light chain amyloidosis
.
Blood
2019
;
134
:
5452
.
21.
Godara
A
,
Zhou
P
,
Kugelmass
A
,
Ma
X
,
Rosenthal
B
,
Toskic
D
, et al
.
Presence of soluble and cell-surface B-cell maturation antigen in systemic light-chain amyloidosis and its modulation by gamma-secretase inhibition
.
Am J Hematol
2020
;
95
:
E110
E3
.
22.
Rosenzweig
M
,
Urak
R
,
Walter
M
,
Lim
L
,
Sanchez
JF
,
Krishnan
A
, et al
.
Preclinical data support leveraging CS1 chimeric antigen receptor T-cell therapy for systemic light chain amyloidosis
.
Cytotherapy
2017
;
19
:
861
6
.
23.
Oliver-Caldes
A
,
Jimenez
R
,
Espanol-Rego
M
,
Cibeira
MT
,
Ortiz-Maldonado
V
,
Quintana
LF
, et al
.
First report of CART treatment in AL amyloidosis and relapsed/refractory multiple myeloma
.
J Immunother Cancer
2021
;
9
:
e003783
.
24.
Harush
O
,
Asherie
N
,
Kfir-Erenfeld
S
,
Adler
G
,
Barliya
T
,
Assayag
M
, et al
.
Preclinical evaluation and structural optimization of anti-BCMA CAR to target multiple myeloma
.
Haematologica
2022
.
25.
Carpenter
RO
,
Evbuomwan
MO
,
Pittaluga
S
,
Rose
JJ
,
Raffeld
M
,
Yang
S
, et al
.
B-cell maturation antigen is a promising target for adoptive T-cell therapy of multiple myeloma
.
Clin Cancer Res
;
19
:
2048
60
.
26.
Morgan
RA
,
Dudley
ME
,
Wunderlich
JR
,
Hughes
MS
,
Yang
JC
,
Sherry
RM
, et al
.
Cancer regression in patients after transfer of genetically engineered lymphocytes
.
Science
2006
;
314
:
126
9
.
27.
Lee
DW
,
Santomasso
BD
,
Locke
FL
,
Ghobadi
A
,
Turtle
CJ
,
Brudno
JN
, et al
.
ASTCT consensus grading for cytokine release syndrome and neurologic toxicity associated with immune effector cells
.
Biol Blood Marrow Transplant
2019
;
25
:
625
38
.
28.
Gatt
ME
,
Pick
M
.
Learning from patients: the interplay between clinical and laboratory research in AL amyloidosis
.
Hemato
2022
;
3
:
3
16
.
29.
Dispenzieri
A
,
Seenithamby
K
,
Lacy
MQ
,
Kumar
SK
,
Buadi
FK
,
Hayman
SR
, et al
.
Patients with immunoglobulin light chain amyloidosis undergoing autologous stem cell transplantation have superior outcomes compared with patients with multiple myeloma: a retrospective review from a tertiary referral center
.
Bone Marrow Transplant
2013
;
48
:
1302
7
.
30.
Merlini
G
,
Stone
M
.
Dangerous small B-cell clones
.
Blood
2006
;
108
:
2520
30
.