Purpose:

Extracellular matrix (ECM) component hyaluronan (HA) facilitates malignant phenotypes of glioblastoma (GBM), however, whether HA impacts response to GBM immunotherapies is not known. Herein, we investigated whether degradation of HA enhances oncolytic virus immunotherapy for GBM.

Experimental Design:

Presence of HA was examined in patient and murine GBM. Hyaluronidase-expressing oncolytic adenovirus, ICOVIR17, and its parental virus, ICOVIR15, without transgene, were tested to determine if they increased animal survival and modulated the immune tumor microenvironment (TME) in orthotopic GBM. HA regulation of NF-κB signaling was examined in virus-infected murine macrophages. We combined ICOVIR17 with PD-1 checkpoint blockade and assessed efficacy and determined mechanistic contributions of tumor-infiltrating myeloid and T cells.

Results:

Treatment of murine orthotopic GBM with ICOVIR17 increased tumor-infiltrating CD8+ T cells and macrophages, and upregulated PD-L1 on GBM cells and macrophages, leading to prolonged animal survival, compared with control virus ICOVIR15. High molecular weight HA inhibits adenovirus-induced NF-κB signaling in macrophages in vitro, linking HA degradation to macrophage activation. Combining ICOVIR17 with anti-PD-1 antibody further extended the survival of GBM-bearing mice, achieving long-term remission in some animals. Mechanistically, CD4+ T cells, CD8+ T cells, and macrophages all contributed to the combination therapy that induced tumor-associated proinflammatory macrophages and tumor-specific T-cell cytotoxicity locally and systemically.

Conclusions:

Our studies are the first to show that immune modulatory ICOVIR17 has a dual role of mediating degradation of HA within GBM ECM and subsequently modifying the immune landscape of the TME, and offers a mechanistic combination immunotherapy with PD-L1/PD-1 blockade that remodels innate and adaptive immune cells.

Translational Relevance

Cancer immunotherapy has been a success in certain cancer types, such as melanoma and non–small cell lung cancer, but has so far proven ineffective against the malignant brain tumor, glioblastoma (GBM). Glycosaminoglycan hyaluronan present in tumor extracellular matrix promotes malignant phenotypes of GBM, but how hyaluronan impacts GBM immunotherapy is unknown. Our studies are the first to show that immune modulatory ICOVIR17 has a dual role of mediating degradation of hyaluronan within GBM and subsequently modifying the immune landscape of the TME, and propose a mechanistic combination immunotherapy with immune checkpoint blockade that remodels both innate and adaptive immune cells. We anticipate that our findings will have a major contribution toward developing novel immune-based therapies for patients with GBM and could define a new treatment paradigm for other solid tumors.

Cancer is increasingly being viewed as an ecosystem, in which neoplastic cells, a variety of nonneoplastic cells, and extracellular matrix (ECM) interact with each other to sustain and promote tumor growth (1, 2). Glioblastoma (GBM), the most malignant primary brain tumor in adults, represents one of the cancers in which complex cross-talk between both cellular and noncellular components in the tumor microenvironment (TME) plays a major role in shaping the treatment refractory nature of the tumors. Tumor-associated macrophages (TAM) dominate the immune cells that infiltrate GBM, and contribute to the characteristic tumor supportive, immunosuppressive TME of GBM that is largely depleted of functional effector T cells (3–5). Lack of durable efficacy of the current multimodal standard of care for GBM, that is, surgical resection followed by irradiation and chemotherapy (6), could be due, in part, to its inability to interfere with key interactions that occur in the GBM TME to resist therapy and sustain tumor progression.

ECM is now known to actively contribute to tumor maintenance by interacting with tumor cells, as well as cellular components in the TME (7–10). Tumor ECM comprises of proteins (e.g., collagen, fibronectin, and laminin) and nonproteins, such as hyaluronan (HA), also known as hyaluronic acid or hyaluronate (11). The glycosaminoglycan HA is a major constituent of ECM that normally exists in a high molecular weight (HMW) form (>1,000 kDa). HA regulates proliferation and invasion of tumor cells by binding its cognate cell surface receptors, CD44 and RHAMM, and affects the activity of chemotherapy (7, 12). Accumulation of HA is closely related to tumor aggressiveness and poor outcome in various malignancies, such as breast (13), colorectal (14), gastric (15), prostate (16), pancreatic (17), and ovarian cancers (18). In GBM, HA is reported to be associated with tumor growth, invasion, and resistance to treatment (7). The relationship between HA and the immune system has been extensively studied in inflammatory conditions, such as autoimmune diseases and chronic arthritis (19–24). HA regulates the function of macrophages via binding CD44, RHAMM, and TLR2/4 (25, 26). In cancer, HMW HA has been shown to inhibit M1 polarization or induce M2 polarization in macrophages (25, 27–30). However, the role of HA in GBM immune surveillance and immunotherapy has not been explored.

Oncolytic virus is an attractive modality for not only killing cancer cells, but also modifying TME. The field of oncolytic virus gained momentum with FDA approval of talimogene laherparepvec for advanced melanoma (31), and a variety of genetically modified viruses is under active clinical development. The fundamental mechanism-of-action of oncolytic virus cancer therapy is that oncolytic virus replication–mediated cell death of neoplastic cells releases tumor antigens and triggers immune and inflammatory responses, leading to the induction of antitumor cellular immune responses (32–37). In addition, oncolytic virus can be armed with therapeutic genes of interest to increase anticancer potency (32). Genetically engineered oncolytic adenovirus is one of the most studied and promising oncolytic viruses (38, 39), and multiple clinical trials are currently ongoing for patients with GBM to investigate the safety and efficacy of oncolytic adenovirus, Delta-24-RGD (DNX-2401; NCT03714334, NCT03178032, NCT01956734, and NCT02798406; ref. 40). A phase I study of DNX-2401 in recurrent malignant glioma reported an encouraging sign of benefit, as 20% of patients survived >3 years from treatment (41). ICOVIR17 is an oncolytic adenovirus with the same modifications as DNX-2401, that is, a 24 bp deletion in the Rb-binding domain of E1A for tumor selective replication and an RGD modification in the fiber for widening tropism, but with two additional modifications: insertion of E2F binding sites in the E1A promoter and the SPAM1 gene encoding PH20 hyaluronidase after the fiber, controlled by the major late promoter (42). Preclinically, we previously demonstrated that treatment of orthotopic GBM xenografts with ICOVIR17 mediated the degradation of HA in GBM ECM, resulting in increased virus spread within GBM and superior antitumor efficacy compared with its parental virus ICOVIR15 without the transgene (42, 43). While this work revealed the function of GBM HA as a physical barrier to effective virus dispersal and tumor killing, whether HA impacts immune responses elicited by oncolytic adenovirus therapy of brain tumors remain unknown because the mice used in the studies were immunodeficient.

The major goal of this study was to address our hypothesis that degradation of HA would enhance oncolytic adenovirus immunotherapy of GBM by overcoming the immunosuppressive functions of GBM ECM. We selected the murine GBM 005 as a suitable in vivo model because this GBM model recapitulates the critical hallmarks of human disease, including GBM stem cell (GSC) properties and immunosuppressive TME in an immunocompetent setting (44–46). Characterization of immunologic changes in GBM revealed that HA degradation by ICOVIR17 induced distinct immune activation in situ, which contributed to its therapeutic effect. This TME modification provided a mechanistic rationale to combine ICOVIR17 with immune checkpoint blockade to yield durable responses in aggressive GBM.

Viruses

Oncolytic adenoviruses, ICOVIR15 and 17, were generated by R. Alemany's group and described previously (42, 47). Viruses were amplified in A549 cells and purified using CsCl ultracentrifuge. Virus preparation and titration were performed following (48).

Cell lines

Mouse glioma cell lines

Mouse 005 GSCs (GFP+), a gift from Dr. Inder Verma (Salk Institute, San Diego, CA), were established from GBM generated with lentiviral transduction of H-Ras and activated Akt in Cre-GFAP/p53+/− mice of a somewhat mixed (C57BL/6 and some FVB/N) background (45). They were cultured as spheres in Neurobasal Medium (Invitrogen) supplemented with l-Glutamine (3 mmol/L; Mediatech), B27 supplement (Invitrogen), N2 supplement (Invitrogen), Heparin (5 μg/mL; Sigma), EGF (20 ng/mL; R&D systems), and FGF2 (20 ng/mL; PeproTech). Spheres were passaged using Accutase (Innovative Cell Technologies). Mouse CT-2A, obtained from Dr. Thomas Seyfried (Boston College, Boston, MA; ref. 49), and GL261 glioma cells, obtained from NCI (Bethesda, MD), were cultured in DMEM supplemented with 10% heat-inactivated FCS, and passaged using 0.05% Trypsin/0.53 mmol/L EDTA (Gibco).

Human glioma cell lines

Human primary GBM neurosphere lines (MGG4 and MGG8) were established as described previously (50) and cultured in EF media composed of neurobasal medium supplemented with 3 mmol/L l-glutamine, 1% B27 supplement, 0.5% N2 supplement, 2 μg/mL heparin, 20 ng/mL recombinant human EGF, 20 ng/mL recombinant human FGF2, and 0.5% penicillin G/streptomycin sulfate/amphotericin B complex (Mediatech). Neurospheres were passaged using TrypLE (Gibco).

Cancer cell lines

Human lung carcinoma cell line, A549, was obtained from the ATCC and grown in DMEM with 10% calf serum. Mouse melanoma B16.F10 cell line was provided by Dr. David Fisher [Massachusetts General Hospital (MGH), Boston, MA]. L929 cells were provided by Dr. Junying Yuan laboratory (Harvard Medical School, Boston, MA). 005-GFP-Fluc was generated by transduction of 005 cells with a lentivirus expressing GFP and firefly luciferase (Fluc). To generate B16.F10-mCherry-Fluc, B16.F10 cells were infected with an mCherry-Fluc lentivirus, and mCherry-positive cells were sorted by a FACSAriaII flow cytometer. B16.F10-GFP was generated using a GFP-puromycin lentivirus and transduced cells were selected with puromycin. All cells were regularly confirmed to be Mycoplasma free (LookOut Mycoplasma Kit; Sigma).

In vivo mouse studies

Female C57BL/6 mice (ages 7–9 weeks) were obtained from Charles River Laboratories. 005 GSCs (1.0 × 105 cells/mouse) were implanted stereotactically into the right striatum of the brain as described previously (44, 50). For survival study, mice were monitored for health status and sacrificed when neurologic deficits and weight loss became significant.

Tissue processing

Brains were harvested at indicated timepoints and fixed in 10% formalin, embedded in paraffin, and sectioned at 7-μm thickness. For frozen sections, mice were perfused with cold 4% paraformaldehyde directly into the heart, and brains were fixed in 4% paraformaldehyde overnight, replaced with 30% glucose, and 7-μm thick cryo-sections were prepared.

Hematoxylin and eosin staining

Sections were deparaffinized in xylene (twice, 10 minutes each), followed by gradual rehydration using 100%, 90%, and 70% ethanol and PBS (5 minutes each). Slides were dipped in hematoxylin (Gill3, Millipore Sigma, 105174) for 20 seconds, then 0.1% HCl for 2 seconds, washed in tap water for 5 minutes, dipped into Eosin Y (1% alcoholic, Thermo Fisher Scientific, 7231) for 20 seconds, and followed by dehydration using 95% ethanol (twice, 5 minutes each) and 100% ethanol (twice, 5 minutes each). After treatment with xylene twice for 10 minutes each, they were mounted in xylene-based media (Cytoseal XYL, Thermo Fisher Scientific, 8312-16E).

Immunohistochemistry (IHC)

Sections were deparaffinized in xylenes (twice, 10 minutes each), followed by gradual rehydration using 100%, 90%, and 70% ethanol (5 minutes each). After a 5-minute PBS wash, sections were heated in 10 mmol/L sodium citrate buffer (pH 6.0) for 15 minutes with microwave for antigen retrieval, washed with PBS twice, and incubated with 3% H2O2 for 5 minutes to block the endogenous peroxidase or incubated with BLOXALL (Vector, SP-6000) for 10 minutes to block the endogenous alkaline phosphatase. After PBS washes three times, sections were incubated with blocking buffer (2.5% Normal Horse Serum, Vector Laboratories, S-2012) for 60 minutes at room temperature and with properly diluted primary antibodies overnight at 4°C. Next day, they were washed with PBS three times, and incubated with horseradish peroxidase (HRP)- or AP-conjugated Ig for 30 minutes at room temperature. After a PBS wash, sections were incubated with DAB Substrate (Dako, K3468), followed by hematoxylin counter staining and mounting. CD34 immunofluorescence was done on paraformaldehyde-fixed frozen sections of 005 tumors.

Histochemical staining of hyaluronan (HA staining)

Sections were deparaffinized in xylenes and dehydrated in the serial dilutions of ethanol, and the endogenous peroxidase activity was blocked by 3% H2O2. Sections were incubated with 2.5% Normal Horse Serum (Vector Laboratories, S-2012) for 60 minutes at room temperature for blocking, and with 5 μg/mL of a Biotinylated HA-binding Protein (Calbiochem, 385911, HABP-b) overnight at 4°C. The specificity of HA staining was tested by pretreating an adjacent section with 20 U/mL of Bovine Testes Hyaluronidase (Sigma, H3506) at 37°C for 1 hour, prior to the addition of the HABP-b. The next day, sections were washed in PBS and treated with Avidin–Biotin–Peroxidase Kit (VECTASTAIN Elite ABC HRP Kit, Vector Laboratories, PK-6100) for 30 minutes at room temperature. After washes, sections were developed with DAB (Dako, K3468) and counterstained with hematoxylin. Quantification of HA staining was performed using Photoshop (Adobe) and ImageJ (NIH).

Double staining of HA and immune cells

For double IHC and HA staining, IHC for immune cell markers (CD3, CD4, CD8, or CD68) was performed first with DAB as described above, followed by three PBS washes and incubation with blocking buffer (2.5% normal horse serum) for 60 minutes at room temperature. The slides were then incubated with HABP-b. The subsequent HA staining procedures were followed using VECTASTAIN ABC-AP Kit (Vector Laboratories, AK-5000) and ImmPACT Red AP Substrate (Vector Laboratories, SK-5105).

Cell viability assay

Dissociated cells were seeded into 96-well plates, serially diluted viruses were added, and cells were cultured for 3 or 7 days. To measure cell viability, 20 μL of CellTiter-Glo Luminescent Cell Viability Reagent (Promega, G7570) was added into each well, and plates were shaken in the dark for 5 minutes. Luminescence values were measured by a microplate reader with the Gen5 Software (BioTek). Experiments were performed in triplicate.

RT-PCR

Total RNA was isolated from cells using TRizol Reagent (Invitrogen) and cDNA was synthesized by reverse transcriptase reaction with High Capacity cDNA RT Kit (Applied Biosystems, 4368814). Real-time PCR was conducted using SYBR Select Master Mix (Applied Biosystems, 4472908) in a StepOnePlus Real-time PCR System (Applied Biosystems). PCR primer sequences used are as follows: PH20 (HSPAM) forward: AAACTGTTGCTCTGGGTGCT and reverse: TTTTGGCTGCTAGTGTGACG; GAPDH forward: CAATGACCCCTTCATTGACC and reverse: GACAAGCTTCCCGTTCTCAG); and mouse beta-actin forward: GATCTGGCACCACACCTTCT and reverse: GGGGTGTTGAAGGTCTCAAA.

Bone marrow–derived macrophages (BMDM)

Femurs and tibias were collected from 7- to 8-week-old C57BL/6 mice. Bone marrows were harvested by flashing R10 media (RPMI1640 containing 10% heat-inactivated FCS) using a 24-G needle and a 5-mL syringe. Bone marrow cells were run through a 70-μm strainer, centrifuged, resuspended in BMDM media (DMEM containing 20% heat-inactivated FCS, 30% L929 cells supernatant, and 1% penicillin/streptomycin), and seeded at 5 × 106 cells in a 10-cm dish. Media were changed fresh on days 1, 3, and 6, and cells were split or frozen when they became 80%–90% confluent (at around day 7). BMDMs were used from day 6–14 cultures for experiments.

NF-κB signaling activation in BMDM

BMDMs were seeded on coverslips at 50,000 cells per well (24-well plate) and incubated with 2,000 μg/mL of low molecular weight (LMW) HA or HMW HA (R&D systems, GLR-001 and 002) for 24 hours at 37°C. Lipopolysaccharide (LPS; 100 pg/mL, Sigma-Aldrich, L4391) or ICOVIR15 (multiplicity of infection, 50) was added and incubated for 1 or 6 hours at 37°C, respectively. Control samples were incubated without HA or stimulators. BMDMs were washed with PBS and fixed with 4% paraformaldehyde, permeabilized with 0.1% Triton X, and blocked with 10% normal goat serum, then incubated with anti-p65 antibody, followed by incubation with Alexa Fluor 488–conjugated secondary antibody. Nuclei were stained with DAPI. Five to eight pictures (magnification, 20×) were randomly captured under a fluorescence microscope and used for counting cells with and without nuclear translocation of p65 (>100 cells/group).

Gene expression analysis (NanoString)

C57BL/6 mice were implanted with 005 GSCs (1.0 × 105 cells/mouse), and treated with intratumoral injection of ICOVIR17 (1.6 × 107 PFU/mouse) or PBS on days 13 and 18. Anti-mouse PD-1 antibody (BioXCell, BE0146, clone RMP1-14, 12.5 mg/kg) or isotype rat IgG control (Sigma, l4131, 12.5 mg/kg) was injected intraperitoneally on days 14, 17, and 19 (four groups, n = 3/group). On day 20, mice were euthanized and tumors were collected. Total RNA was extracted from tumor tissues using RNeasy Mini Kit (Qiagen, 74104) following the manufacturer's protocol, and kept at −80°C until analysis. Gene expression analysis was performed by using the NanoString Mouse PanCancer Immune Panel (115000142) and Mouse Myeloid Innate Immunity Panel (115000181). Total RNA (110 ng/mouse) was hybridized with reporter codeset and capture probeset following the protocol provided by NanoString Technologies. Hybridized samples were prepared using the automated nCounter prep station and analyzed by Set up Digital Analyzer (nCounter Max Analysis System). Data were processed using nSolver analysis software and the nCounter digital analysis module. The housekeeping genes' expressions were used for the normalization of the gene expression analysis.

Immune cell depletion studies

C57BL/6 mice (N = 6/group) were implanted with 005 cells in the right hemisphere on day 0 and treated with 1.6 × 107 PFU of ICOVIR17 or PBS on days 9 and 15 and anti-mouse PD-1 antibody (12.5 mg/kg) or isotype rat IgG (12.5 mg/kg) on days 10, 13, 16, and 19. For depletion of immune cell populations, mice were administered intraperitoneal injections of anti-mouse CD8a (BioXCell, BE0061, clone 2.43; 10 mg/kg) and anti-mouse CD4 (BioXCell, BE0003-1, clone GK1.5; 10 mg/kg) on days 5, 8, 11, 14, 21, and 27. Clodronate liposomes (Clodrosome from Encapsula NanoSciences, CLD8901) were given on days 8, 11, 14, and 17 at 50 mg/kg for the first injection, followed by 25 mg/kg. Mock group received isotype control rat IgG and empty liposomes (Encapsome from Encapsula NanoSciences, CLD8910).

Multicolor flow cytometry

Mice were implanted with 005 GSCs (1.0 × 105 cells/mouse) and treated with intratumoral injection of ICOVIR17 (day 9, 1.6 × 107 PFU/mouse and day 14, 1.0 × 107 PFU/mouse) or PBS on days 9 and 14. Anti-mouse PD-1 antibody or isotype rat IgG (as control; 12.5 mg/kg) was injected intraperitoneally on days 10, 13, 16, and 19. Mice were euthanized on day 21. Tumor tissues or spleens were harvested from mice and mashed through a 100-μm strainer. For splenocytes, red blood cells were lysed using Mouse RBC Lysis Buffer (Boston BioProducts, IBB-198). Live/dead cell discrimination was performed using Zombie UV Fixable Viability Kit (BioLegend, 423108). Cells were incubated with FcR Blocking Reagent (Miltenyi Biotec, 130-092-575), followed by cell surface staining with fluorochrome-conjugated anti-mouse antibodies. Staining of intracellular FOXP3 was done after fixation and permeabilization by FOXP3 Fix/Perm Buffer Set (BioLegend, 421403), while other intracellular staining was done using BD Cytofix/Cytoperm Fixation/Permeabilization Kit (BD, 554714). Samples were run in an LSR II Flow Cytometer (BD) and data were analyzed using FlowJo Software (v.10.1, Tree Star).

Antibodies used are listed in Supplementary Table S1.

T-cell isolation and cytotoxicity assay

Tumor infiltrated lymphocytes

C57BL/6 mice were implanted with 005 GSCs (1.0 × 105 cells/mouse) and treated with intratumoral injection of ICOVIR17 (1.6 × 107 PFU/mouse) or PBS on days 13 and 18. Anti-mouse PD-1 antibody or isotype rat IgG (both 12.5 mg/kg) was injected intraperitoneally on days 14, 17, 20, and 23 (control group, n = 4 and combination group, n = 3). On day 25, mice were euthanized and right hemisphere quadrants containing tumor were collected, and tumors in the same group were pooled. Samples were dissociated with p1000 pipetting and passed through a 100-μm strainer. After washes with PBS, cells were resuspended in cold PBS, and debris were removed using Debris Removal Solution (Miltenyi Biotec, 130-109-398). To isolate CD4/8-positive cells, cells were resuspended in microbeads isolation buffer (PBS containing 0.5% FCS and 2 mmol/L EDTA) and incubated with mouse CD4/CD8 (TIL) MicroBeads (Miltenyi Biotec, 130-116-480) at 4°C for 15 minutes. After a wash with isolation buffer, magnetic isolation was performed with MiniMACS Separator (Miltenyi Biotec, 130-042-102) and MS Columns (Miltenyi Biotec, 130-042-201). Serial dilutions of CD4/CD8 cells were seeded to a 96-well plate preseeded with 005-Fluc and B16.F10-Fluc cells at effector to target (E:T) ratios of 2:1, 10:1, and 50:1, and incubated at 37°C and 5% CO2 for 24 hours. Cell viability of Fluc-expressing tumor cells was measured with a microplate reader after adding 10 μL of d-luciferin (20 mmol/L) to each well.

Splenocytes

Mice were implanted with 005 GSCs (1.0 × 105 cells/mouse), and treated with intratumoral injection of ICOVIR17 (1.6 × 107 PFU/mouse) or PBS on days 9 and 14. Anti-mouse PD-1 antibody or isotype rat IgG (both 12.5 mg/kg) was injected intraperitoneally on days 10, 13, 16, and 19. On day 21, spleens were collected, passed through a 70-μm strainer, and incubated with mouse RBC lysis Buffer (Boston BioProducts, IBB-198) to remove erythrocytes. Splenocytes were cultured in RPMI with 10% FCS and IL2 (100 U/mL) for 48 hours at 37°C and 5% CO2, and seeded in 96-well plates preseeded with 005-Fluc or B16.F10-Fluc cells for different E:T ratios. After 24-hour coculture, cell viability of tumor cells was measured by luciferase assay.

Intracellular multicolor flow cytometry of splenocytes

Mice were treated as for tumor-infiltrating T cells (TIL) above. Spleens were collected on day 25. Splenocytes were incubated with 100 U/mL of IL2 for 48 hours and seeded in 6-well plates with 005 or B16.F10-GFP cells at the E:T ratio of 16:1. After 24-hour coculture, cells were stained with fluorophore-conjugated antibodies (surface, CD4 and CD8 and intracellular, granzyme B and IFNγ), and subjected to multicolor flow cytometry. Brefeldin A (GolgiPlug from BD Biosciences) was added to cultures 5 hours before harvesting of cells to block protein secretion.

Statistical analysis

All statistical analyses were performed using Prism 8 Software (GraphPad, v8.0.2). Survival data were analyzed by Kaplan–Meier survival curves, and comparisons were performed by log-rank test followed by correction for multiple comparisons with the Bonferroni method. Cell viability data, flow cytometric data, and IHC counts were compared using an unpaired Student t test (two-tailed). P values of less than 0.05 were considered significant.

Study approval

All mouse procedures were approved by the Institutional Animal Care and Use Committee at MGH (Boston, MA). Excess glioma tissue at neurosurgery at MGH, which would have been otherwise discarded, was collected in a coded manner in accordance with Declaration of Helsinki, and approved by the Institutional Review Board at MGH.

Hyaluronan is abundant in the ECM of GBM with low immune cell infiltration

We first used clinical specimens to examine the presence of HA in human brain and GBM. IHC showed that HA was present in human brain tissue (Fig. 1A), as reported previously (51, 52). In patient GBM specimens, HA was abundantly present with heterogeneous distribution (Fig. 1B and C). Using double staining of HA and T-cell marker CD3, we observed that T lymphocytes infiltrating GBM were often present in areas where HA content was negative to low, as opposed to high HA areas typically lacking CD3+ cells (Fig. 1D), suggesting the ability of HA to modify their distribution.

Figure 1.

Hyaluronan (HA) is abundant in the ECM of GBM. Hyaluronic acid staining in human normal brain (A) and GBM samples (B). Bovine hyaluronidase was applied before HA staining for negative control samples. Scale bar, 500 μm. C, ImageJ quantification of HA area (%) using four microscopic fields per tumor shown in A and B. Data are presented as mean ± SD. ***, P < 0.005; ****, P < 0.0001 with unpaired t test (two-tailed) compared with human brain. D, Double staining of HA (red) and CD3 (brown) in human GBM. Lower magnification microscopic field containing both HA-high and HA-low areas (left). Scale bar, 200 μm. Higher magnification images showing HA-low and HA-high areas (right). Scale bar, 100 μm. E–I, Characterization of murine 005 GBM in C57BL/6 mice. E, A brain coronal section with a magnified view at the tumor border showing hematoxylin and eosin staining (H&E), GFP-labeled 005 cells, and HA staining. B, brain; T, tumor. Scale bar, 100 μm. F, IHC and immunofluorescence for marker gene expression. Scale bar, 100 μm. G, Double staining of immune cell markers (CD4, CD8, and CD68 in brown) and HA (in red) in murine GBM 005. Nuclear counterstaining with hematoxylin. H, Quantification of immune cells based on the images shown in G. Data are presented as mean ± SD. *, P < 0.05; **, P < 0.01 with unpaired t test (two-tailed). I, NanoString gene expression analysis of orthotopic murine GBM models (005 and GL261). Gene expression relative to that of murine melanoma (D4M3A) is presented. Scale on the right is log2 fold change.

Figure 1.

Hyaluronan (HA) is abundant in the ECM of GBM. Hyaluronic acid staining in human normal brain (A) and GBM samples (B). Bovine hyaluronidase was applied before HA staining for negative control samples. Scale bar, 500 μm. C, ImageJ quantification of HA area (%) using four microscopic fields per tumor shown in A and B. Data are presented as mean ± SD. ***, P < 0.005; ****, P < 0.0001 with unpaired t test (two-tailed) compared with human brain. D, Double staining of HA (red) and CD3 (brown) in human GBM. Lower magnification microscopic field containing both HA-high and HA-low areas (left). Scale bar, 200 μm. Higher magnification images showing HA-low and HA-high areas (right). Scale bar, 100 μm. E–I, Characterization of murine 005 GBM in C57BL/6 mice. E, A brain coronal section with a magnified view at the tumor border showing hematoxylin and eosin staining (H&E), GFP-labeled 005 cells, and HA staining. B, brain; T, tumor. Scale bar, 100 μm. F, IHC and immunofluorescence for marker gene expression. Scale bar, 100 μm. G, Double staining of immune cell markers (CD4, CD8, and CD68 in brown) and HA (in red) in murine GBM 005. Nuclear counterstaining with hematoxylin. H, Quantification of immune cells based on the images shown in G. Data are presented as mean ± SD. *, P < 0.05; **, P < 0.01 with unpaired t test (two-tailed). I, NanoString gene expression analysis of orthotopic murine GBM models (005 and GL261). Gene expression relative to that of murine melanoma (D4M3A) is presented. Scale on the right is log2 fold change.

Close modal

We, therefore, set out to study the potential impact of HA and its degradation on oncolytic virus immunotherapy for GBM. We previously showed that 005 cells have the properties of GSCs and generate a GBM model in C57BL/6 mice that is suitable for the development of oncolytic virus immunotherapy (44, 46). 005 cells stably expressing GFP form hypercellular GBM in the brain that contains rich HA heterogeneously present within the tumor (Fig. 1E). Further phenotypic characterization of the tumor revealed a high Ki-67 proliferation index (45%), and high levels of stem/progenitor cell markers, Sox2, olig2, and nestin, characterizing neoplastic cells (Fig. 1F). A substantive fraction of scattered PD-L1+ cells and CD34+ vascularity was noted within the tumor (Fig. 1F). Dual staining of HA and immune cell markers demonstrated preferential presence of CD4+ and CD8+ T cells and CD68+ macrophages in areas containing no to low HA (Fig. 1G and H), as was observed in clinical GBM. We next used NanoString transcriptomic analysis to define the immunologic landscape of intracerebral 005 GBM in vivo. When a murine immunocompetent melanoma model was used as a reference (53), 005, as well as the commonly used GL261 GBM model (54) were noted for higher expression of T-cell immune checkpoints (e.g., Lag3 and Pdcd1), adenosine signaling (Entpd1 encoding CD39), and the M2-polarized macrophage marker, Arg1, indicative of the immunosuppressive status of the TME in these GBM models (Fig. 1I). Because CD44 is one of the major cell surface receptors for HA, we examined the expression of CD44 on tumor-infiltrating immune cells. Immune cells infiltrating 005 GBM, including T cells, macrophages, and microglia, as well as 005 GBM cells, were all highly positive for CD44 (Supplementary Fig. S1). Thus, HA is abundantly present in the ECM of human GBM and mouse 005 GBM, and may influence the distribution of intratumoral immune cells.

Hyaluronidase-expressing oncolytic adenovirus, ICOVIR17, has anti-GBM activity

We tested the oncolytic properties of genetically engineered oncolytic adenoviruses, ICOVIR15 and ICOVIR17, in human and murine GBM cells (42, 43, 47). Both ICOVIR15 and ICOVIR17 drive expression of E1A-delta24 from a promoter consisting of four palindromic E2F binding sites and an Sp-1 binding site, conferring potency and cancer selectivity, and have a RGD modification in the fiber; ICOVIR17 additionally expresses human hyaluronidase PH20. In vitro, both viruses were comparable in killing human and murine GBM cells in a dose-dependent manner, with a greater potency for human cells versus mouse cells (Supplementary Fig. S2A and S2B), in line with prior reports showing murine cells are less permissive to human adenovirus type 5 than human cells (55). ICOVIR17 replicated and spread much better in human cancer cells, compared with murine 005 cells, in vitro (Supplementary Fig. S2C and S2D). However, expression of the transgene hyaluronidase (SPAM1) was found to be robust after ICOVIR17 infection of 005 cells (Supplementary Fig. S2E).

We next evaluated the antitumor effects of ICOVIR15 and ICOVIR17 in the orthotopic 005 GBM model in C57BL/6 mice. Because of the low susceptibility of 005 cells to the viruses, we used two injections of high titer viruses directly into the tumor (Fig. 2A). Treatment was initiated on day 11, when rapidly growing tumor was established. ICOVIR15 did not improve animal survival [median survival time (MST), 23.5 vs. 22.5 days for PBS as control; P = 0.408; Fig. 2B]. Treatment with ICOVIR17 significantly increased survival to MST 28 days compared with control (P = 0.037), while that did not reach statistical significance when compared with ICOVIR15 (P = 0.072; Fig. 2B). IHC analysis showed that injections of ICOVIR15 and ICOVIR17 mediated strong expression of the virus gene E1A within the tumors, and that ICOVIR17, but not ICOVIR15, significantly decreased the levels of HA at the site where E1A was present, consistent with hyaluronidase-mediated degradation of HA (Fig. 2C–E). Next, we asked whether the observed antitumor activity of ICOVIR17 was due to its preferential spread within tumor tissue driven by HA degradation, as was seen with human GBM xenografts (43). However, we found no difference in intratumoral spread of the viruses as injections of ICOVIR15 and ICOVIR17 resulted in similarly wide-spread distribution of E1A within the tumors (Supplementary Fig. S3).

Figure 2.

Intratumoral injections of ICOVIR17 degraded HA, prolonged survival, increased tumor-infiltrating immune cells, and upregulated PD-L1 in mice bearing orthotopic 005 GBM. A, Treatment schema of the survival experiment. C57BL/6 mice were implanted with 005 cells into the brain (1.2 × 105 cells/mouse) on day 0. On days 11 and 17, PBS or virus (ICOVIR15 or ICOVIR17) was injected intratumorally (i.t.; 1.6 × 107 PFU/mouse). B, Kaplan–Meier survival analysis of 005-bearing mice treated with PBS (control), ICOVIR15, or ICOVIR17. Arrows indicate treatments. *, P < 0.05 (log-rank analysis) comparing control and ICOVIR17. C, Double staining of hyaluronic acid (HA, red) and E1A (adenovirus early gene, brown) at 5 days after single-virus injection. Scale bar, 200 μm. D, HA staining (HA, brown). Scale bar, 200 μm. E, Quantification of HA area. *, P < 0.05; ***, P < 0.005 with unpaired t test (two-tailed). IHC of immune markers, CD3 (F), CD4 (G), CD8 (H), CD68 (I), iNOS (J), PD-L1 (K), and Ki-67 (L), in 005 GBM treated with PBS (control), ICOVIR15, or ICOVIR17. Scale bar, 100 μm. Insets: higher magnification images to show details of staining. Quantification is shown below for each marker. Number of positive cells from randomly chosen six fields per tumor section per mouse were counted, and the mean ± SD of all fields across the mice (N = 4/group) are presented. C, control group; 15, ICOVIR15-treated group; 17, ICOVIR17-treated group. Data were analyzed by unpaired t test (two-tailed; *, P < 0.05; **, P < 0.01; ****, P < 0.0001).

Figure 2.

Intratumoral injections of ICOVIR17 degraded HA, prolonged survival, increased tumor-infiltrating immune cells, and upregulated PD-L1 in mice bearing orthotopic 005 GBM. A, Treatment schema of the survival experiment. C57BL/6 mice were implanted with 005 cells into the brain (1.2 × 105 cells/mouse) on day 0. On days 11 and 17, PBS or virus (ICOVIR15 or ICOVIR17) was injected intratumorally (i.t.; 1.6 × 107 PFU/mouse). B, Kaplan–Meier survival analysis of 005-bearing mice treated with PBS (control), ICOVIR15, or ICOVIR17. Arrows indicate treatments. *, P < 0.05 (log-rank analysis) comparing control and ICOVIR17. C, Double staining of hyaluronic acid (HA, red) and E1A (adenovirus early gene, brown) at 5 days after single-virus injection. Scale bar, 200 μm. D, HA staining (HA, brown). Scale bar, 200 μm. E, Quantification of HA area. *, P < 0.05; ***, P < 0.005 with unpaired t test (two-tailed). IHC of immune markers, CD3 (F), CD4 (G), CD8 (H), CD68 (I), iNOS (J), PD-L1 (K), and Ki-67 (L), in 005 GBM treated with PBS (control), ICOVIR15, or ICOVIR17. Scale bar, 100 μm. Insets: higher magnification images to show details of staining. Quantification is shown below for each marker. Number of positive cells from randomly chosen six fields per tumor section per mouse were counted, and the mean ± SD of all fields across the mice (N = 4/group) are presented. C, control group; 15, ICOVIR15-treated group; 17, ICOVIR17-treated group. Data were analyzed by unpaired t test (two-tailed; *, P < 0.05; **, P < 0.01; ****, P < 0.0001).

Close modal

ICOVIR17 increases tumor-infiltrating immune cells and upregulates PD-L1

We hypothesized that ICOVIR17-mediated alteration of immune TME might underlie the efficacy of its monotherapy. IHC analysis of immune markers revealed a significant increase in the numbers of tumor-infiltrating CD3 and CD8 cells, but not CD4 cells, in ICOVIR17-treated 005 GBM tumors compared with PBS control- and ICOVIR15-treated tumors (Fig. 2F–H). Tumor-infiltrating macrophages marked by CD68- and inducible nitric oxide synthase (iNOS)-positive cells representing M1-polarized TAMs were increased by ICOVIR15, which was further increased by ICOVIR17 (Fig. 2I and J). Similarly, ICOVIR15 mediated an increase in cells immuno-positive for the immune checkpoint protein, PD-L1, which was furthered by ICOVIR17 (Fig. 2K). There was no change in the index of proliferation marker, Ki-67, between the groups (Fig. 2L). After treatment with ICOVIR17, CD68+ TAMs accumulated in areas lacking HA as opposed to areas that retained HA, while CD4+ and CD8+ cells were distributed similarly (Supplementary Fig. S4). Thus, ICOVIR17-mediated degradation of HA drastically altered the immune TME in this GBM model.

HMW HA inhibits virus-induced NF-κB signaling in macrophages

Transcriptomic analysis using the NanoString cancer immunology panel revealed that most of known LMW HA-induced genes (56) were upregulated in ICOVIR17-treated tumors (Fig. 3A). Many of these LMW HA-induced genes were driven by the NF-κB signaling pathway, and transcript levels of NF-κB target genes, listed at https://www.bu.edu/nf-kb/gene-resources/target-genes/ (Supplementary Table S2), were, in general, also increased in tumors after ICOVIR17 injections (Fig. 3B). LMW HA (50–250 kDa), but not HMW HA (>900 kDa), has been shown to act as a TLR2/4 agonist, activating NF-κB signaling pathway and triggering activation of inflammatory genes (57). These findings led us to hypothesize that virus-induced degradation of tumor HA might impact molecular signaling pathways in immune cells.

Figure 3.

HMW HA and LMW HA differentially impact adenovirus-induced NF-κB activation in BMDMs. A and B, NanoString transcriptome analysis of 005 GBM in the brain after treatment with PBS (cont) or ICOVIR17. A, LMW HA–induced genes. B, NF-κB target genes. N = 3 individual mice per group. C, Experimental design. BMDM, bone marrow–derived macrophage from mouse. p65 immunofluorescence in BMDMs after stimulation with ICOVIR15 (D and F) or LPS (E) in the presence or absence of LMW HA and HMW HA. Insets in D show representative cells without and with nuclear p65 immunopositivity. Arrows and arrowheads indicate examples of cells without and with nuclear p65 translocation, respectively. E and F, The fraction of cells having p65 in the nuclei. Student t test (two-tailed); **, P < 0.001; ***, P < 0.0005. G, Intracellular flow cytometry for TNF and iNOS in BMDMs. BMDMs were cultured with LMW HA or HMW HA for 24 hours, followed by ICOVIR15 infection. Staining was done 6 hours after infection. H, Quantification of G. TNF (left) and iNOS (right) in BMDMs after stimulation with ICOVIR15 in the presence or absence of LMW HA and HMW HA. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data are presented mean ± SD in E, F, and H.

Figure 3.

HMW HA and LMW HA differentially impact adenovirus-induced NF-κB activation in BMDMs. A and B, NanoString transcriptome analysis of 005 GBM in the brain after treatment with PBS (cont) or ICOVIR17. A, LMW HA–induced genes. B, NF-κB target genes. N = 3 individual mice per group. C, Experimental design. BMDM, bone marrow–derived macrophage from mouse. p65 immunofluorescence in BMDMs after stimulation with ICOVIR15 (D and F) or LPS (E) in the presence or absence of LMW HA and HMW HA. Insets in D show representative cells without and with nuclear p65 immunopositivity. Arrows and arrowheads indicate examples of cells without and with nuclear p65 translocation, respectively. E and F, The fraction of cells having p65 in the nuclei. Student t test (two-tailed); **, P < 0.001; ***, P < 0.0005. G, Intracellular flow cytometry for TNF and iNOS in BMDMs. BMDMs were cultured with LMW HA or HMW HA for 24 hours, followed by ICOVIR15 infection. Staining was done 6 hours after infection. H, Quantification of G. TNF (left) and iNOS (right) in BMDMs after stimulation with ICOVIR15 in the presence or absence of LMW HA and HMW HA. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Data are presented mean ± SD in E, F, and H.

Close modal

Because ICOVIR17 treatment of 005 GBM elicited a robust accumulation of TAMs, we tested whether the size of HA affected virus-induced activation of macrophages (Fig. 3C). In vitro, both LPS and ICOVIR15 potently activated NF-κB signaling pathway in BMDM as marked by nuclear translocation of p65 (Fig. 3D–F). The presence of HMW HA, but not LMW HA, in BMDM culture inhibited this response (Fig. 3C–E). Intracellular flow cytometry analysis showed virus-induced upregulation of BMDM producing TNF, a canonical cytokine induced by NF-κB signaling activation (Fig. 3G and H). Again, HMW HA, but not LMW HA, suppressed this response significantly (Fig. 3G and H). ICOVIR15 induced iNOS in BMDMs, which was not significantly inhibited by either LMW HA or HMW HA (Fig. 3G and H). These data reveal that adenovirus-induced activation of NF-κB signaling in macrophages is impacted by the size of extracellular HA interacting with the cells.

Combining ICOVIR17 and anti-PD-1 immune checkpoint inhibitor increases survival of GBM-bearing mice

Because ICOVIR17-mediated HA degradation and oncolytic virus therapy triggered cellular immune responses and increased PD-L1 levels in treated GBM, combining ICOVIR17 with blockade of the PD-L1–PD-1 immune checkpoint axis was a rational therapeutic strategy (Fig. 4A). We thus administered anti-PD-1 antibody systemically, subsequent to intratumoral delivery of ICOVIR17. Combination therapy doubled the MST of control animals (43.5 vs. 22 days), which was significantly better than ICOVIR17 alone (32.5 days) and anti-PD-1 alone (31.5 days), and induced a durable response and long-term cures in a fraction of the treated animals (Fig. 4B). On the other hand, combination treatment with ICOVIR15 and anti-PD-1 did not significantly increase the survival of GBM-bearing mice as compared with control or ICOVIR15 alone, despite extension of survival in a small fraction of responding animals (Supplementary Fig. S5).

Figure 4.

Efficacy of combination therapy of ICOVIR17 and anti-PD-1 requires CD4+ and CD8+ T cells and macrophages. A, Treatment schema for the survival study of combination therapy of ICOVIR17 and anti-PD-1 antibody. B, Kaplan–Meier survival curves. Statistical significance was assessed between indicated groups. C, NanoString RNA analysis reveals differential expression of chemokines between ICOVIR17 alone group versus combination group (comb). N = 3 mice per group. D and E,In vivo depletion of immune subsets. D, Experimental schema. E, Flow cytometric analysis of splenocytes confirming successful depletion of respective target cells in the spleen. F and G,In vivo depletion of immune subsets. F, Treatment schema for the survival study of combination therapy of ICOVIR17 and anti-PD-1 antibody with and without depletion of specific immune cell subsets. G, Kaplan–Meier survival curves. Combo, combination therapy of ICOVIR17 and anti-PD-1 antibody. In B and G, P values are from log-rank test. Statistically significant differences in comparisons after the correction for multiple comparisons (Bonferroni method) are underlined. i.p., intraperitoneal; i.t. intratumoral.

Figure 4.

Efficacy of combination therapy of ICOVIR17 and anti-PD-1 requires CD4+ and CD8+ T cells and macrophages. A, Treatment schema for the survival study of combination therapy of ICOVIR17 and anti-PD-1 antibody. B, Kaplan–Meier survival curves. Statistical significance was assessed between indicated groups. C, NanoString RNA analysis reveals differential expression of chemokines between ICOVIR17 alone group versus combination group (comb). N = 3 mice per group. D and E,In vivo depletion of immune subsets. D, Experimental schema. E, Flow cytometric analysis of splenocytes confirming successful depletion of respective target cells in the spleen. F and G,In vivo depletion of immune subsets. F, Treatment schema for the survival study of combination therapy of ICOVIR17 and anti-PD-1 antibody with and without depletion of specific immune cell subsets. G, Kaplan–Meier survival curves. Combo, combination therapy of ICOVIR17 and anti-PD-1 antibody. In B and G, P values are from log-rank test. Statistically significant differences in comparisons after the correction for multiple comparisons (Bonferroni method) are underlined. i.p., intraperitoneal; i.t. intratumoral.

Close modal

NanoString transcriptome profiling of 1,200 immune-related genes in 005 GBM after different treatments revealed robust responses in innate and adaptive immunity in both the ICOVIR17 and combination groups (Supplementary Fig. S6). Overall, similar immune signatures were noted in the two groups receiving ICOVIR17 and ICOVIR17 + anti-PD-1. However, there was a set of genes that was differentially expressed in the ICOVIR17 group versus the combination group (Fig. 4C; Supplementary Fig. S7). Interestingly, many chemokines were among those; for example, Ccl2 and Cxcl12, were higher in the ICOVIR17, while Ccl6 and Ccl9 were higher in the combination group, highlighting an ability of anti-PD-1 to modulate oncolytic virus–induced chemokine expression (Fig. 4C).

CD4+ and CD8+ T cells and macrophages are essential for combination therapy to be effective

We used antibody or drug-induced depletion of immune cell subsets in vivo to identify cells that mediate the effects of our combination therapy. We confirmed that administration of anti-CD4 and anti-CD8 antibodies and clodronate liposome effectively depleted CD4+, CD8+, and F4/80+ cells, respectively (Fig. 4D and E). When the combination therapy was tested in animals receiving anti-CD4, anti-CD8, or clodronate (Fig. 4F), the therapeutic efficacy was abrogated with any of these interventions, as survival was statistically significantly different from that of combination therapy without depletion (Fig. 4G). This result indicated that CD4+ and CD8+ T cells and macrophages are all necessary for combination therapy to be functional.

Combination therapy upregulates iNOS and TNF in TAMs

Flow cytometric analysis showed that treatments with ICOVIR17 alone and ICOVIR17 + anti-PD-1 similarly increased the fraction of CD11b+ and F4/80+ macrophages infiltrating 005 GBM (Fig. 5A) and decreased the fraction of 005 cells (Supplementary Fig. S8A). The proportion of PD-L1+ cells was greatly and similarly increased in the two groups receiving ICOVIR17 (Fig. 5B). 005 GBM cells and macrophages were found to be the two major cell types constituting the PD-L1+ population (Fig. 5B), and the fraction of PD-L1+ cells was elevated within 005 cells, as well as in macrophages after treatment with ICOVIR17 and ICOVIR17 + anti-PD-1 (Fig. 5B; Supplementary Fig. S8B). Further characterization of phenotypic alterations in CD45high, CD11b+, and F4/80+ TAMs revealed a significant increase in iNOS+ and TNF+ TAMs after combination therapy (Fig. 5C and D), suggesting the acquirement of an M1-like proinflammatory phenotype. However, TAMs positive for an M2 marker, Arg1, and double positive for M1 marker, iNOS, and M2 marker, Arg1, also increased after combination therapy (Fig. 5C and D). NanoString analysis showed that both ICOVIR17 alone and combination treatment increased Nos2 and Arg1, while anti-PD-1 alone did not change either (Supplementary Fig. S8C).

Figure 5.

Combination therapy increased TAMs. Flow cytometric analysis of 005 tumors after treatments. Representative plots and quantification of CD11b+ F4/80+ TAMs (A), PD-L1+ cells (B), and Arg1+, iNOS+, TNF+ TAMs (C). N = 4 mice per group. C, control group; P, anti-PD-1 antibody monotherapy group; V, ICOVIR17 monotherapy group; and V+P, ICOVIR17 and anti-PD-1 combination group. D, Quantification of C, showing percentage of macrophages positive for the indicated marker(s). Data are presented mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 assessed by Student t test (two-tailed) between indicated groups.

Figure 5.

Combination therapy increased TAMs. Flow cytometric analysis of 005 tumors after treatments. Representative plots and quantification of CD11b+ F4/80+ TAMs (A), PD-L1+ cells (B), and Arg1+, iNOS+, TNF+ TAMs (C). N = 4 mice per group. C, control group; P, anti-PD-1 antibody monotherapy group; V, ICOVIR17 monotherapy group; and V+P, ICOVIR17 and anti-PD-1 combination group. D, Quantification of C, showing percentage of macrophages positive for the indicated marker(s). Data are presented mean ± SD. *, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001 assessed by Student t test (two-tailed) between indicated groups.

Close modal

Combination therapy increased the CD8/regulatory T-cell ratio in tumor-infiltrating T cells and induced tumor-specific effector T-cell responses locally and systemically

We elucidated T-cell responses that were induced by combination therapy. Flow cytometric analysis showed similar increases in tumor-infiltrating CD4+ cells in anti-PD-1, ICOVIR17, and combination groups, compared with control (Fig. 6A; Supplementary Fig. S9A). ICOVIR17 treatment increased tumor-infiltrating CD8+ cells, which was further boosted after treatment with ICOVIR17 + anti-PD-1 (Fig. 6A; Supplementary Fig. S9A). Both ICOVIR17 and combination significantly decreased Foxp3+CD4+ regulatory T-cell (Treg) population in the tumor (Fig. 6A; Supplementary Fig. S9A). As a result, the CD8/Treg ratio was the highest in tumors treated with combination therapy (Fig. 6A). We next examined treatment-induced changes in cell surface molecules that have been reported to mark dysfunctional or terminally exhausted T cells (58). In CD8+ T cells, the regimens involving ICOVIR17 greatly reduced the fraction positive for the immune checkpoint, TIM3 (Fig. 6B). Anti-PD-1, ICOVIR17, and combination all decreased CTLA-4+ CD8+ cells (Fig. 6B). Furthermore, combination therapy decreased PD-1 in CD4+ T cells (Fig. 6B).

Figure 6.

Combination therapy induced tumor-specific cytotoxicity in local and peripheral T cells. A and B, Flow cytometric analysis of TILs collected from orthotopic 005 GBM tumors after treatment with control (C), anti-PD-1 (P), ICOVIR17 (V), or ICOVIR17+anti-PD-1 (V+P). A, analysis of total CD4+ and CD4+ FOXP3+ Treg (top) and CD8+ and CD8+/Treg ratio (bottom). B, Analysis of T-cell exhaustion/checkpoint markers (PD-1, TIM3, and CTLA-4) in CD4+ cells (top) and CD8+ cells (bottom). *, P < 0.05; **, P < 0.01 (two-tailed t test) between indicated groups. C, Experimental schematic. In vitro cytotoxic assays of T cells harvested from spleens (D) and 005 GBMs (E) in control mice (black circles and lines) and combination therapy–treated mice (red squares and lines). **, P < 0.01; ***, P < 0.001 (two-tailed t test). See Supplementary Fig. S8B for T-cell enrichment from tumors. F, Intracellular flow cytometric analysis of granzyme B (GZMB) and IFNγ in spleen-derived T cells after their 24-hour exposure to 005 GBM or B16 melanoma cells. G, Quantification of CD8+ cells double positive for GZMB and IFNγ in total CD8+ cells. C, control mice; 17+P, combination therapy mice; sp only, splenocytes alone without tumor cells. *, P < 0.05; **, P < 0.01 (two-tailed t test) between indicated groups. See Supplementary Fig. S9C for gating using fluorescence minus one controls. Data are presented as mean ± SD.

Figure 6.

Combination therapy induced tumor-specific cytotoxicity in local and peripheral T cells. A and B, Flow cytometric analysis of TILs collected from orthotopic 005 GBM tumors after treatment with control (C), anti-PD-1 (P), ICOVIR17 (V), or ICOVIR17+anti-PD-1 (V+P). A, analysis of total CD4+ and CD4+ FOXP3+ Treg (top) and CD8+ and CD8+/Treg ratio (bottom). B, Analysis of T-cell exhaustion/checkpoint markers (PD-1, TIM3, and CTLA-4) in CD4+ cells (top) and CD8+ cells (bottom). *, P < 0.05; **, P < 0.01 (two-tailed t test) between indicated groups. C, Experimental schematic. In vitro cytotoxic assays of T cells harvested from spleens (D) and 005 GBMs (E) in control mice (black circles and lines) and combination therapy–treated mice (red squares and lines). **, P < 0.01; ***, P < 0.001 (two-tailed t test). See Supplementary Fig. S8B for T-cell enrichment from tumors. F, Intracellular flow cytometric analysis of granzyme B (GZMB) and IFNγ in spleen-derived T cells after their 24-hour exposure to 005 GBM or B16 melanoma cells. G, Quantification of CD8+ cells double positive for GZMB and IFNγ in total CD8+ cells. C, control mice; 17+P, combination therapy mice; sp only, splenocytes alone without tumor cells. *, P < 0.05; **, P < 0.01 (two-tailed t test) between indicated groups. See Supplementary Fig. S9C for gating using fluorescence minus one controls. Data are presented as mean ± SD.

Close modal

Finally, we sought to measure the cytotoxic function of T cells after combination therapy. Two effector cell types were prepared: (i) splenocytes that were cultured for 48 hours in the presence of IL2 and (ii) TILs, T cells isolated from 005 GBM using anti-CD4 and CD8 magnetic beads (Fig. 6C; Supplementary Fig. S9B). Twenty-four–hour coculture of splenocytes and TILs isolated from animals that received combination therapy with 005-Fluc or B16.F10-Fluc cells as targets demonstrated significantly enhanced killing of 005-Fluc cells, compared with those from mice that received PBS (intratumoral) and isotype IgG (intraperitoneally; Fig. 6D and E). Killing of irrelevant B16.F10-Fluc melanoma cells was comparable between T cells derived from control and combination therapy mice (Fig. 6D and E). To support this tumor-specific killing, IL2-stimulated splenocytes harvested from combination therapy group reacted to 005 cells, not B16 cells, by increasing the fraction of CD8+ cells double positive for granzyme B and IFNγ (Fig. 6F and G; Supplementary Fig. S9C). Thus, combination therapy of ICOVIR17 and PD-1 blockade induced tumor-specific effector T-cell responses both locally and systemically.

In this work, we show that GBM treatment with HA-degrading ICOVIR17 has a therapeutic effect in murine GBM that was accompanied by increases in tumor-infiltrating CD8+ T cells and TAMs, as well as PD-L1 levels. These changes in the TME immune profile enabled ICOVIR17 to be effectively combined with anti-PD-1 antibody to induce durable response in animals bearing aggressive GBM.

The vast majority of current oncolytic adenovirus clinical trials for GBM are investigating human adenovirus serotype 5–based DNX-2401 (40). ICOVIR15 and ICOVIR17 drive delta24-E1A expression under the control of a promoter consisting of four palindromic E2F binding sites and an Sp-1 binding site, making these viruses potentially more tumor selective and potent than DNX-2401 (42, 47). Still, we found that murine GBM cells were significantly less permissive to these oncolytic viruses compared with human GBM cells. The 005 GBM model we selected to study these oncolytic viruses in an immunocompetent setting is highly tumorigenic in C57BL/6 mice displaying stem-like features (44, 46), and recapitulated the phenotypic and immunosuppressive hallmarks of human GBM, a finding being reinforced by our time of flight cytometry immunoprofiling (59). Injections of HA-degrading ICOVIR17, but not its parental ICOVIR15, into 005 GBM were able to increase animal survival. Unlike what we observed previously in human GBM xenografts in immune-incompetent mice, where ICOVIR17 also had a better effect compared with ICOVIR15 (43), both viruses showed comparably efficient distribution of infection within GBM in this immunocompetent model. However, ICOVIR17-treated GBM contained elevated levels of CD8+ T cells and TAMs, and PD-L1+ 005 cells and TAMs, compared with ICOVIR15-treated tumors. Because the only difference between ICOVIR15 and ICOVIR17 is PH20 expression by ICOVIR17, the immunologic changes observed in treated tumors are attributable to hyaluronidase-mediated HA degradation in the GBM TME. A similar hyaluronidase-expressing oncolytic adenovirus was shown to reduce tumor growth and induce infiltration of CD8+ T cells in a subcutaneous lung cancer model (60). In a murine model of pancreatic ductal adenocarcinoma, stromal remodeling via HA degradation increased intratumoral infiltration of effector T cells when combined with cancer vaccines (61). We showed robust accumulation of TAMs in tumor areas that were virus positive and depleted of HA. Molecularly, our transcriptomic analysis of ICOVIR17-treated tumors in vivo revealed activation of many NF-κB target genes. Furthermore, we demonstrated in vitro that virus-induced NF-κB activation in BMDMs was inhibited by HMW HA, not by LMW HA, a finding consistent with reports characterizing differential abilities of HMW HA and LMW HA to induce M2-polarized macrophages and trigger activation of the TLR2/4–NF-κB signaling pathway, respectively (56, 57). Thus, HA degradation in the context of oncolytic adenovirus GBM therapy activates an inflammatory M1-like phenotype in TAMs, which might have contributed to the functional activation of effector CD8+ T cells and their recruitment to the tumor site. This work and others suggest that HA depletion in the TME may improve cancer immunotherapy by removing a physical barrier for immune cell trafficking and activating their functions (61). However, further research is necessary to determine whether HA restricts immune cell penetration to and distribution within GBM.

ICOVIR17 treatment induced distinct changes in immune checkpoint levels in GBM. The most prominent was the upregulation of PD-L1 in 005 tumor cells and TAMs. In contrast, TIM3 and CTLA-4 were downregulated in CD8+ T cells. Adenovirus-induced decreases in TIM3+ cells were also reported clinically in recurrent malignant gliomas after injections of DNX-2401 (41). The increases in CD8+ cells and M1 TAMs, as well as selective upregulation of PD-L1, set the stage for rationally combining ICOVIR17 with blockade of the PD-L1–PD-1 axis to improve immunotherapeutic activity. Indeed, this combination therapy doubled animal survival from control, with significant prolongation over monotherapies and long-term cures in a fraction (21%) of animals. Interestingly, in vivo depletion of immune subsets revealed a pivotal role that CD4+ and CD8+ T cells and macrophages all play in mediating the activity of combination therapy. This result was analogous to what was required for an IL12-expressing oncolytic herpes simplex virus in conjunction with dual checkpoint inhibition to exert curative activity in the same GBM model (46). Increases in iNOS+/TNF+ M1-like TAMs and in the CD8+/Treg ratio of TILs support treatment-induced activation of innate and adaptive immune cells, both likely contributing to therapeutic benefit. Finally, ex vivo functional assays confirmed systemic and local induction of tumor-specific cytotoxicity in mice treated with the combination therapy. Collectively, HA-degrading oncolytic adenovirus followed by PD-1 blockade acted cooperatively to overcome the suppressive TME and boost the concerted action of innate and adaptive cellular immunity to eliminate GBM. However, durable responses were not achieved in all animals, underscoring the need to understand the mechanisms underlying heterogeneous responses and to improve efficacy. Human GBM TAMs have been reported to coexpress M1 and M2 markers (62), and functional significance underlying the emergence of such TAMs after combination therapy warrants elucidation.

In summary, we identified HA abundantly present in the GBM TME as a therapeutic target in oncolytic adenovirus immunotherapy, providing an insight that could be applicable to other cancer types. ICOVIR17-mediated degradation of HA within GBM dramatically alters the immune landscape of the TME, and offers a mechanistically rational combination immunotherapy with PD-L1/PD-1 blockade. Currently, a multicenter phase II clinical trial is investigating the combinatory use of DNX-2401 and anti-PD-1 antibody (pembrolizumab) for recurrent GBM (KEYNOTE-192). This study provides a strong basis for this combinatorial clinical translation of ICOVIR17.

R. Alemany reports personal fees from VCN Biosciences outside the submitted work, as well as has a patent for hyaluronidase-armed oncolytic adenoviruses issued. S.D. Rabkin reports grants from NIH during the conduct of the study, personal fees from Replimune and from Cellinta outside the submitted work, and is a coinventor on patents relating to oncolytic herpes simplex viruses, owned and managed by Georgetown University and Massachusetts General Hospital, which have received royalties from Amgen and ActiVec Inc. K. Shah reports other from Amasa Therapeutics outside the submitted work. No disclosures were reported by the other authors.

J. Kiyokawa: Formal analysis, investigation, methodology, writing-original draft, writing-review and editing. Y. Kawamura: Investigation, writing-review and editing. S.M. Ghouse: Investigation, writing-review and editing. S. Acar: Investigation. E. Barçın: Investigation. J. Martínez-Quintanilla: Resources, methodology, writing-original draft, writing-review and editing. R.L. Martuza: Writing-original draft, writing-review and editing. R. Alemany: Resources, methodology, writing-original draft, writing-review and editing. S.D. Rabkin: Writing-original draft, writing-review and editing. K. Shah: Conceptualization, supervision, funding acquisition, writing-original draft, writing-review and editing. H. Wakimoto: Conceptualization, supervision, funding acquisition, writing-original draft, writing-review and editing.

We thank Drs. Praveen Bommareddy and Maryam Rahman for sharing with us their NanoString data. We thank Dr. Robert Colvin and Ellen Acheampong at the NanoString core at Massachusetts General Hospital (Boston, MA) and Drs. Eric Miller and Clement David of NanoString Technologies for technical assistance. This work was supported by NIH R21 NS103187 (to H. Wakimoto) and NIH R01 CA204720 (to K. Shah).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Balkwill
FR
,
Capasso
M
,
Hagemann
T
. 
The tumor microenvironment at a glance
.
J Cell Sci
2012
;
125
:
5591
6
.
2.
Klemm
F
,
Joyce
JA
. 
Microenvironmental regulation of therapeutic response in cancer
.
Trends Cell Biol
2015
;
25
:
198
213
.
3.
Broekman
ML
,
Maas
SLN
,
Abels
ER
,
Mempel
TR
,
Krichevsky
AM
,
Breakefield
XO
. 
Multidimensional communication in the microenvirons of glioblastoma
.
Nat Rev Neurol
2018
;
14
:
482
95
.
4.
Charles
NA
,
Holland
EC
,
Gilbertson
R
,
Glass
R
,
Kettenmann
H
. 
The brain tumor microenvironment
.
Glia
2012
;
60
:
502
14
.
5.
Quail
DF
,
Joyce
JA
. 
The microenvironmental landscape of brain tumors
.
Cancer Cell
2017
;
31
:
326
41
.
6.
Stupp
R
,
Mason
WP
,
van den Bent
MJ
,
Weller
M
,
Fisher
B
,
Taphoorn
MJ
, et al
Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma
.
N Engl J Med
2005
;
352
:
987
96
.
7.
Park
J
,
Kwak
H
,
Lee
S
. 
Role of hyaluronan in glioma invasion
.
Cell Adh Migr
2008
;
2
:
202
7
.
8.
Kultti
A
,
Li
X
,
Jiang
P
,
Thompson
CB
,
Frost
GI
,
Shepard
HM
. 
Therapeutic targeting of hyaluronan in the tumor stroma
.
Cancers
2012
;
4
:
873
903
.
9.
Silver
DJ
,
Siebzehnrubl
FA
,
Schildts
MJ
,
Yachnis
AT
,
Smith
GM
,
Smith
AA
, et al
Chondroitin sulfate proteoglycans potently inhibit invasion and serve as a central organizer of the brain tumor microenvironment
.
J Neurosci
2013
;
33
:
15603
17
.
10.
Chanmee
T
,
Ontong
P
,
Itano
N
. 
Hyaluronan: a modulator of the tumor microenvironment
.
Cancer Lett
2016
;
375
:
20
30
.
11.
Whatcott
CJ
,
Han
H
,
Posner
RG
,
Hostetter
G
,
Von Hoff
DD
. 
Targeting the tumor microenvironment in cancer: why hyaluronidase deserves a second look
.
Cancer Discov
2011
;
1
:
291
6
.
12.
Toole
BP
. 
Hyaluronan: from extracellular glue to pericellular cue
.
Nat Rev Cancer
2004
;
4
:
528
39
.
13.
Auvinen
P
,
Tammi
R
,
Parkkinen
J
,
Tammi
M
,
Agren
U
,
Johansson
R
, et al
Hyaluronan in peritumoral stroma and malignant cells associates with breast cancer spreading and predicts survival
.
Am J Pathol
2000
;
156
:
529
36
.
14.
Ropponen
K
,
Tammi
M
,
Parkkinen
J
,
Eskelinen
M
,
Tammi
R
,
Lipponen
P
, et al
Tumor cell-associated hyaluronan as an unfavorable prognostic factor in colorectal cancer
.
Cancer Res
1998
;
58
:
342
7
.
15.
Setala
LP
,
Tammi
MI
,
Tammi
RH
,
Eskelinen
MJ
,
Lipponen
PK
,
Agren
UM
, et al
Hyaluronan expression in gastric cancer cells is associated with local and nodal spread and reduced survival rate
.
Br J Cancer
1999
;
79
:
1133
8
.
16.
Lipponen
P
,
Aaltomaa
S
,
Tammi
R
,
Tammi
M
,
Agren
U
,
Kosma
VM
. 
High stromal hyaluronan level is associated with poor differentiation and metastasis in prostate cancer
.
Eur J Cancer
2001
;
37
:
849
56
.
17.
Whatcott
CJ
,
Han
H
,
Von Hoff
DD
. 
Orchestrating the tumor microenvironment to improve survival for patients with pancreatic cancer: normalization, not destruction
.
Cancer J
2015
;
21
:
299
306
.
18.
Anttila
MA
,
Tammi
RH
,
Tammi
MI
,
Syrjanen
KJ
,
Saarikoski
SV
,
Kosma
VM
. 
High levels of stromal hyaluronan predict poor disease outcome in epithelial ovarian cancer
.
Cancer Res
2000
;
60
:
150
5
.
19.
Yang
R
,
Yan
Z
,
Chen
F
,
Hansson
G
,
Kiessling
R
. 
Hyaluronic acid and chondroitin sulphate A rapidly promote differentiation of immature DC with upregulation of costimulatory and antigen-presenting molecules, and enhancement of NF-κB and protein kinase activity
.
Scand J Immunol
2002
;
55
:
2
13
.
20.
Gebe
JA
,
Yadava
K
,
Ruppert
SM
,
Marshall
P
,
Hill
P
,
Falk
BA
, et al
Modified high-molecular-weight hyaluronan promotes allergen-specific immune tolerance
.
Am J Respir Cell Mol Biol
2017
;
56
:
109
20
.
21.
Qadri
M
,
Almadani
S
,
Jay
GD
,
Elsaid
KA
. 
Role of CD44 in regulating TLR2 activation of human macrophages and downstream expression of proinflammatory cytokines
.
J Immunol
2018
;
200
:
758
67
.
22.
Nagy
N
,
Kuipers
HF
,
Marshall
PL
,
Wang
E
,
Kaber
G
,
Bollyky
PL
. 
Hyaluronan in immune dysregulation and autoimmune diseases
.
Matrix Biol
2019
;
78–79
:
292
313
.
23.
Wu
J
,
Qu
Y
,
Zhang
YP
,
Deng
JX
,
Yu
QH
. 
RHAMM induces progression of rheumatoid arthritis by enhancing the functions of fibroblast-like synoviocytes
.
BMC Musculoskelet Disord
2018
;
19
:
455
.
24.
Jiang
D
,
Liang
J
,
Noble
PW
. 
Hyaluronan as an immune regulator in human diseases
.
Physiol Rev
2011
;
91
:
221
64
.
25.
Nikitovic
D
,
Tzardi
M
,
Berdiaki
A
,
Tsatsakis
A
,
Tzanakakis
GN
. 
Cancer microenvironment and inflammation: role of hyaluronan
.
Front Immunol
2015
;
6
:
169
.
26.
Misra
S
,
Hascall
VC
,
Markwald
RR
,
Ghatak
S
. 
Interactions between hyaluronan and its receptors (CD44, RHAMM) regulate the activities of inflammation and cancer
.
Front Immunol
2015
;
6
:
201
.
27.
Kim
H
,
Cha
J
,
Jang
M
,
Kim
P
. 
Hyaluronic acid-based extracellular matrix triggers spontaneous M2-like polarity of monocyte/macrophage
.
Biomater Sci
2019
;
7
:
2264
71
.
28.
Kuang
DM
,
Wu
Y
,
Chen
N
,
Cheng
J
,
Zhuang
SM
,
Zheng
L
. 
Tumor-derived hyaluronan induces formation of immunosuppressive macrophages through transient early activation of monocytes
.
Blood
2007
;
110
:
587
95
.
29.
Shi
Q
,
Zhao
L
,
Xu
C
,
Zhang
L
,
Zhao
H
. 
High molecular weight hyaluronan suppresses macrophage M1 polarization and enhances IL-10 production in PM2.5-induced lung inflammation
.
Molecules
2019
;
24
:
1766
.
30.
Zhang
G
,
Guo
L
,
Yang
C
,
Liu
Y
,
He
Y
,
Du
Y
, et al
A novel role of breast cancer-derived hyaluronan on inducement of M2-like tumor-associated macrophages formation
.
Oncoimmunology
2016
;
5
:
e1172154
.
31.
Andtbacka
RH
,
Kaufman
HL
,
Collichio
F
,
Amatruda
T
,
Senzer
N
,
Chesney
J
, et al
Talimogene laherparepvec improves durable response rate in patients with advanced melanoma
.
J Clin Oncol
2015
;
33
:
2780
8
.
32.
Bell
J
,
McFadden
G
. 
Viruses for tumor therapy
.
Cell Host Microbe
2014
;
15
:
260
5
.
33.
Bommareddy
PK
,
Shettigar
M
,
Kaufman
HL
. 
Integrating oncolytic viruses in combination cancer immunotherapy
.
Nat Rev Immunol
2018
;
18
:
498
513
.
34.
Harrington
K
,
Freeman
DJ
,
Kelly
B
,
Harper
J
,
Soria
JC
. 
Optimizing oncolytic virotherapy in cancer treatment
.
Nat Rev Drug Discov
2019
;
18
:
689
706
.
35.
Russell
SJ
,
Peng
KW
,
Bell
JC
. 
Oncolytic virotherapy
.
Nat Biotechnol
2012
;
30
:
658
70
.
36.
Martinez-Quintanilla
J
,
Seah
I
,
Chua
M
,
Shah
K
. 
Oncolytic viruses: overcoming translational challenges
.
J Clin Invest
2019
;
130
:
1407
18
.
37.
Saha
D
,
Wakimoto
H
,
Rabkin
SD
. 
Oncolytic herpes simplex virus interactions with the host immune system
.
Curr Opin Virol
2016
;
21
:
26
34
.
38.
Foreman
PM
,
Friedman
GK
,
Cassady
KA
,
Markert
JM
. 
Oncolytic virotherapy for the treatment of malignant glioma
.
Neurotherapeutics
2017
;
14
:
333
44
.
39.
Niemann
J
,
Kuhnel
F
. 
Oncolytic viruses: adenoviruses
.
Virus Genes
2017
;
53
:
700
6
.
40.
Kiyokawa
J
,
Wakimoto
H
. 
Preclinical and clinical development of oncolytic adenovirus for the treatment of malignant glioma
.
Oncolytic Virother
2019
;
8
:
27
37
.
41.
Lang
FF
,
Conrad
C
,
Gomez-Manzano
C
,
Yung
WKA
,
Sawaya
R
,
Weinberg
JS
, et al
Phase I study of DNX-2401 (Delta-24-RGD) oncolytic adenovirus: replication and immunotherapeutic effects in recurrent malignant glioma
.
J Clin Oncol
2018
;
36
:
1419
27
.
42.
Guedan
S
,
Rojas
JJ
,
Gros
A
,
Mercade
E
,
Cascallo
M
,
Alemany
R
. 
Hyaluronidase expression by an oncolytic adenovirus enhances its intratumoral spread and suppresses tumor growth
.
Mol Ther
2010
;
18
:
1275
83
.
43.
Martinez-Quintanilla
J
,
He
D
,
Wakimoto
H
,
Alemany
R
,
Shah
K
. 
Encapsulated stem cells loaded with hyaluronidase-expressing oncolytic virus for brain tumor therapy
.
Mol Ther
2015
;
23
:
108
18
.
44.
Cheema
TA
,
Wakimoto
H
,
Fecci
PE
,
Ning
J
,
Kuroda
T
,
Jeyaretna
DS
, et al
Multifaceted oncolytic virus therapy for glioblastoma in an immunocompetent cancer stem cell model
.
Proc Natl Acad Sci U S A
2013
;
110
:
12006
11
.
45.
Marumoto
T
,
Tashiro
A
,
Friedmann-Morvinski
D
,
Scadeng
M
,
Soda
Y
,
Gage
FH
, et al
Development of a novel mouse glioma model using lentiviral vectors
.
Nat Med
2009
;
15
:
110
6
.
46.
Saha
D
,
Martuza
RL
,
Rabkin
SD
. 
Macrophage polarization contributes to glioblastoma eradication by combination immunovirotherapy and immune checkpoint blockade
.
Cancer Cell
2017
;
32
:
253
67
.
47.
Rojas
JJ
,
Guedan
S
,
Searle
PF
,
Martinez-Quintanilla
J
,
Gil-Hoyos
R
,
Alcayaga-Miranda
F
, et al
Minimal RB-responsive E1A promoter modification to attain potency, selectivity, and transgene-arming capacity in oncolytic adenoviruses
.
Mol Ther
2010
;
18
:
1960
71
.
48.
Davydova
J
,
Yamamoto
M
. 
Oncolytic adenoviruses: design, generation, and experimental procedures
.
Curr Protoc Hum Genet
2013
;
Chapter 12:Unit 12.14.
49.
Seyfried
TN
,
el-Abbadi
M
,
Ecsedy
JA
,
Bai
HW
,
Yohe
HC
. 
Influence of host cell infiltration on the glycolipid content of mouse brain tumors
.
J Neurochem
1996
;
66
:
2026
33
.
50.
Wakimoto
H
,
Kesari
S
,
Farrell
CJ
,
Curry
WT
 Jr
,
Zaupa
C
,
Aghi
M
, et al
Human glioblastoma-derived cancer stem cells: establishment of invasive glioma models and treatment with oncolytic herpes simplex virus vectors
.
Cancer Res
2009
;
69
:
3472
81
.
51.
Bignami
A
,
Hosley
M
,
Dahl
D
. 
Hyaluronic acid and hyaluronic acid-binding proteins in brain extracellular matrix
.
Anat Embryol
1993
;
188
:
419
33
.
52.
Quirico-Santos
T
,
Fonseca
CO
,
Lagrota-Candido
J
. 
Brain sweet brain: importance of sugars for the cerebral microenvironment and tumor development
.
Arq Neuropsiquiatr
2010
;
68
:
799
803
.
53.
Bommareddy
PK
,
Zloza
A
,
Rabkin
SD
,
Kaufman
HL
. 
Oncolytic virus immunotherapy induces immunogenic cell death and overcomes STING deficiency in melanoma
.
Oncoimmunology
2019
;
8
:
1591875
.
54.
Karachi
A
,
Yang
C
,
Dastmalchi
F
,
Sayour
EJ
,
Huang
J
,
Azari
H
, et al
Modulation of temozolomide dose differentially affects T-cell response to immune checkpoint inhibition
.
Neuro Oncol
2019
;
21
:
730
41
.
55.
Jogler
C
,
Hoffmann
D
,
Theegarten
D
,
Grunwald
T
,
Uberla
K
,
Wildner
O
. 
Replication properties of human adenovirus in vivo and in cultures of primary cells from different animal species
.
J Virol
2006
;
80
:
3549
58
.
56.
Scheibner
KA
,
Lutz
MA
,
Boodoo
S
,
Fenton
MJ
,
Powell
JD
,
Horton
MR
. 
Hyaluronan fragments act as an endogenous danger signal by engaging TLR2
.
J Immunol
2006
;
177
:
1272
81
.
57.
Tavianatou
AG
,
Caon
I
,
Franchi
M
,
Piperigkou
Z
,
Galesso
D
,
Karamanos
NK
. 
Hyaluronan: molecular size-dependent signaling and biological functions in inflammation and cancer
.
FEBS J
2019
;
286
:
2883
908
.
58.
Miller
BC
,
Sen
DR
,
Al Abosy
R
,
Bi
K
,
Virkud
YV
,
LaFleur
MW
, et al
Subsets of exhausted CD8(+) T cells differentially mediate tumor control and respond to checkpoint blockade
.
Nat Immunol
2019
;
20
:
326
36
.
59.
Khalsa
JK
,
Cheng
N
,
Keegan
J
,
Chaudry
A
,
Driver
J
,
Bi
WL
, et al
Immune phenotyping of diverse syngeneic murine brain tumors identifies immunologically distinct types
.
Nat Commun
2020
;
11
:
3912
.
60.
Al-Zaher
AA
,
Moreno
R
,
Fajardo
CA
,
Arias-Badia
M
,
Farrera
M
,
de Sostoa
J
, et al
Evidence of anti-tumoral efficacy in an immune competent setting with an iRGD-modified hyaluronidase-armed oncolytic adenovirus
.
Mol Ther Oncolytics
2018
;
8
:
62
70
.
61.
Blair
AB
,
Kim
VM
,
Muth
ST
,
Saung
MT
,
Lokker
N
,
Blouw
B
, et al
Dissecting the stromal signaling and regulation of myeloid cells and memory effector T cells in pancreatic cancer
.
Clin Cancer Res
2019
;
25
:
5351
63
.
62.
Muller
S
,
Kohanbash
G
,
Liu
SJ
,
Alvarado
B
,
Carrera
D
,
Bhaduri
A
, et al
Single-cell profiling of human gliomas reveals macrophage ontogeny as a basis for regional differences in macrophage activation in the tumor microenvironment
.
Genome Biol
2017
;
18
:
234
.