Purpose:

Peripheral T-cell lymphomas are clinically aggressive and usually fatal, as few complete or durable remissions are achieved with currently available therapies. Recent evidence supports a critical role for lymphoma-associated macrophages during T-cell lymphoma progression, but the specific signals involved in the cross-talk between malignant T cells and their microenvironment are poorly understood. Colony-stimulator factor 1 receptor (CSF1R, CD115) is required for the homeostatic survival of tissue-resident macrophages. Interestingly, its aberrant expression has been reported in a subset of tumors. In this article, we evaluated its expression and oncogenic role in T-cell lymphomas.

Experimental Design:

Loss-of-function studies, including pharmacologic inhibition with a clinically available tyrosine kinase inhibitor, pexidartinib, were performed in multiple in vitro and in vivo models. In addition, proteomic and genomic screenings were performed to discover signaling pathways that are activated downstream of CSF1R signaling.

Results:

We observed that CSF1R is aberrantly expressed in many T-cell lymphomas, including a significant number of peripheral and cutaneous T-cell lymphomas. Colony-stimulating factor 1 (CSF1), in an autocrine or paracrine-dependent manner, leads to CSF1R autophosphorylation and activation in malignant T cells. Furthermore, CSF1R signaling was associated with significant changes in gene expression and in the phosphoproteome, implicating PI3K/AKT/mTOR in CSF1R-mediated T-cell lymphoma growth. We also demonstrated that inhibition of CSF1R in vivo and in vitro models is associated with decreased T-cell lymphoma growth.

Conclusions:

Collectively, these findings implicate CSF1R in T-cell lymphomagenesis and have significant therapeutic implications.

Translational Relevance

T-cell lymphomas remain an area of unmet need, as clinical trial participation remains a standard of care in the relapsed/refractory setting, and novel therapeutic strategies are needed. We demonstrate that CSF1R is aberrantly expressed in a significant proportion of peripheral and cutaneous T-cell lymphomas, where it activates PI3K/AKT signaling, and promotes the growth and survival of malignant T cells. Consequently, pexidartinib, a selective CSF1R inhibitor, impaired the growth of CSF1R-expressing T-cell lymphomas. Overall, these findings identify CSF1R as a novel therapeutic target in these lymphomas.

Peripheral T-cell lymphomas (PTCL) are a heterogeneous group of non-Hodgkin lymphomas that are characterized by an aggressive clinical course, chemotherapy resistance, and poor survival (1–5). Although cell-surface receptors, including cytokine receptors and the T-cell receptor (6), play critical roles during T-cell lymphoma (TCL) progression and may be therapeutically targeted, the paucity of representative cell lines and animal models has hampered progress, and PTCL remains an area of unmet need. The sequential steps involved in the maturation and activation of normal T cells are tightly regulated by cues derived from their microenvironment. Not surprisingly, communication between malignant T cells and constituents of their microenvironment, including macrophages, is critical for tumor growth, survival, and migration (3, 7–11). Lymphoma-associated macrophages (LAM) are abundant constituents of the TCL microenvironment, and have emerged as an attractive therapeutic target (3, 12, 13).

Colony-stimulating factor 1 receptor (CSF1R) is required for the homeostatic survival and migration of macrophages and their progenitors (14–16). In addition to its expression on myeloid lineage cells, including macrophages (17), Langerhans cells (18), osteoclasts (19), and tumor-associated macrophages (20), CSF1R expression has also been observed on nonhematopoietic cells, including Paneth cells (21) and many solid tumors (20, 22–25). CSF1R activation occurs upon binding one of its two ligands: colony-stimulating factor 1 (CSF1) and interleukin-34 (IL34; ref. 26). Although both ligands are partially redundant, CSF1 is a dominant trophic factor for macrophages (27–30), including tumor-associated macrophages (31). CSF1R belongs to the platelet-derived growth factor receptor family, and is a type III receptor tyrosine kinase (32). Upon ligand engagement, CSF1 receptors dimerize, leading to step-wise autophosphorylation of tyrosine residues within the cytoplasmic tail and recruitment of signaling proteins, including PI3K (33, 34). More recently, it has been demonstrated that paracrine activation on CSF1R-expressing carcinoma cells activates oncogenic pathways that promote tumor invasion (31, 35). Also, autocrine activation of CSF1R in breast carcinoma is associated with tumor metastasis and growth (36) and poor outcomes (20, 37).

The aberrant expression of CSF1R has also been demonstrated in lymphoid neoplasms, particularly classic Hodgkin lymphoma (12, 38–41). CSF1R expression in Hodgkin lymphoma results from dysregulated epigenetic control and loss of methylation within an alternative CSF1R promoter, resulting in the expression of “noncanonical” CSF1R transcripts (39). Importantly, CSF1R inhibition with selective tyrosine kinase inhibitors is a rational therapeutic approach in neoplasms that aberrantly express CSF1R (22, 25, 42). Given the pathogenic role of CSF1R-expressing LAM in the TCL and the availability of CSF1R antagonists, we evaluated the expression and function of CSF1R in the T-cell lymphomas. We adopted an unbiased phosphoproteomic approach, demonstrating that CSF1R activation in T-cell lymphomas leads to AKT/mTOR activation and promotes tumor growth. Therefore, CSF1R inhibition is a rational therapeutic strategy in the TCL, with a dual mechanism of action in CSF1R+ TCL.

IHC

IHC stains were performed on selected cases using tissue microarrays or whole tissue sections. CSF1R IHC stains were performed with two antibodies: rabbit anti-CSF1R (Santa Cruz Biotechnologies H-300, dilution 1:100) and rabbit anti-CSF1R (Abcam EPR20634, dilution 1:200). IHC staining was performed at two independent laboratories (Michigan State University Histolab and University of Michigan Cancer Center histology core). CSF1R expression was validated in classic Hodgkin and non-Hodgkin lymphomas (Supplementary Fig. S1A and data not shown), both antibodies showed similar results. Cases were graded as positive for CSF1R if more than 30% of tumor cells expressed cytoplasmic CSF1R. Interpretation of CSF1R expression was performed independently by three pathologists (C. Murga-Zamalloa, K. Inamdar, and N.G. Bailey). CBFA2T3 IHC stains were performed with rabbit anti-CBFA2T3 (PA5-66808, dilution 1:1,000; Thermo Scientific), as described (43). For nuclear expression of CBFA2T3, the percentage of positive tumor cells and the intensity (0–3) were measured. The H-score was calculated (0–300), and loss of CBFA2T3 was scored if the H-score was less than 150 (less than 0.5 standard deviations from the mean). Tumor samples analyzed were collected from the pathology library of cases at the University of Michigan Health System. Cutaneous T-cell lymphoma (CTCL) cases represent primary cutaneous CD30-positive lymphoproliferative disorders (n = 31) and mycosis fungoides (n = 23).

Cell culture and shRNA lentiviral transduction

Anaplastic large cell lymphoma (ALCL) cell–derived cell lines (SR786, Karpas290, SUP-M2, SUDH1L, and DEL), CTCL-derived cell lines (MyLa, Mac-1), and PTCL-NOS (T8ML1)–derived cell lines were maintained in RPMI-1640 with 10% fetal bovine serum. Cell lines were validated, as previously described (18, 43, 44), and tested for Mycoplasma every 6 months by the Universal Mycoplasma Detection Kit (ATCC). T8ML1 cell lines were generated from a PTCL-NOS patient (45), and maintained with supplemented IL2 RPM1 media. Stable expression of doxycycline-inducible shRNA was generated with lentiviral mediated transduction of plko-Tet-On vectors. Oligo sequences for CSF1R shRNA#1: CCGGACAGGAGAGAGCGGGACTATACTCGAGTATAGTCCCGCTCTCTCCTGTTTTTTG, shRNA#2: CCGGGAATCTCACAGGACCTCTTAGCTCGAGCTAAGAGGTCCTGTGAGATTCTTTTTTG and scramble: CCGGCCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGGTTTTT. Knockdown of CBFA2T3 was performed with sigma mission pLKO.1 shRNA vectors, TRCN0000020164 (shRNA #1) and TRCN0000020165 (shRNA #2).

Compounds

Crizotinib was purchased from Selleckchem. PLX3397/pexidartinib was provided under MTA from Plexxikon Inc. Tenalisib/RP6530 was provided under MTA from Rhizen Pharmaceuticals. Unless otherwise indicated in the article, inhibitory compounds were used at 1 μmol/L final concentration, and vehicle control (DMSO) was used as an appropriate control. Human recombinant purified CSF1 was acquired from BioLegend. Induction of CSF1R signaling with recombinant CSF1 ligand was done at 20 ng/mL concentration at indicated times.

Antibodies, ELISA assay, and quantitative real-time PCR

A complete list of antibodies is included in Supplementary Table S5. ELISA assays for CSF1R and pan-phosphorylated CSF1R were purchased from RayBiotech and performed according to the manufacturer's instructions. ELISA assays for the quantification of the CSF1 ligand were purchased from RayBiotech, and performed according to manufacturer's instructions. List of primers for quantitative real-time PCR primers are included in Supplementary Table S6.

Proliferation, apoptosis, and colony-formation assays

Colony-formation assays were performed with Methocult H4230 (Stem Cell Technologies) per the manufacturer's instructions. Briefly, approximately 5,000 cells were seeded with or without doxycycline (10 ng/mL), colonies were grown for 7 days before staining with p-iodonitrotetrazolium chloride (Sigma-Aldrich). Proliferation was evaluated with CellTiter-Glo assays (Promega) over 72 hours. Multiparametric evaluation of cellular apoptosis was performed by flow cytometry analysis of Annexin V (Invitrogen) incorporation, coupled with either propidium iodide (Miltenyi Biotec, MACS) or DilC1(5) incorporation (Thermo Scientific). Staining and detection procedures for flow cytometry were performed according to the manufacturer's instructions.

Phosphoproteome analysis by mass spectrometry

Sixty million cells were lysed in 9 mol/L urea/20 mmol/L HEPES pH8.0/0.1% SDS and a cocktail of phosphatase inhibitors. Six milligrams of protein were reduced with 4.5 mmol/L DTT, alkylated with 10 mmol/L iodoacetamide, and then digested with trypsin (1/50, w/w) overnight at 37°C. Metal oxide affinity chromatography was performed to enrich phosphorylated peptides and reduce the sample complexity prior to tyrosine-phosphorylated peptide immunoprecipitation as previously described (46). Peptides were analyzed in an Orbitrap Fusion Tribid mass spectrometer (Thermo Fisher). RAW files were processed in MaxQuant version 1.6.0.1 using default setting if not stated otherwise (47). Peptides and proteins were identified with a target-decoy approach in revert mode using Andromeda search engine integrated into the MaxQuant environment. The search was performed against the human UniProt FASTA database (April 2016). Oxidized methionine, protein N-acetylation, and serine/threonine/tyrosine phosphorylation were selected as variable modifications, and carbamidomethyl cysteine was selected as fixed modification. Enzyme specificity was set to trypsin, and up to two missed cleavages were allowed for protease digestion. The false-discovery rate at the protein, peptide, and modification levels was set to 1%. The “match between runs” option was enabled.

Gene-expression profiling

Microarray-based gene-expression profiling was performed on Karpas 299 after 6-hour treatment with DMSO, pexidartinib, or crizotinib at the University of Michigan DNA sequencing core. Analysis of the data was performed with the oligo package of bioconductor, in order to fit log2 transformed expression values to the probesets. Limma was used in order to fit weighted linear models to the data and look for genes of interest. Detailed protocol and statistics are included as Supplementary Methods.

Mouse studies

Mouse studies were approved by the University Committee on Care and Use of Animals and performed in accordance with guidelines established by the Unit for Laboratory Animal Medicine at the University of Michigan. Mice were housed under specific pathogen-free conditions. SUPM2 or Karpas 299 cells (2 × 106) were injected subcutaneously in immunodeficient NSG mice or Rag2/Il2rg-immunodeficient mice with transgenic expression of humanized CSF1 ligand (48). Upon injections, mice were fed with either nutritionally complete pexidartinib-containing (275 mg PLX3397/kg) or control chow, provided under MTA by Plexxikon. Toxicity secondary to drug delivery was assessed by daily monitoring of clinical condition (appearance, activity, and body condition). Tumors were measured, and mice were humanely euthanized approximately 14 days after pexidartinib or control treatment.

Statistical analysis

All the data represent at least three independent experiments. Sample size for animal experiments was based on previous publications performing similar experiments, ensuring that a sufficient sample size was selected to confidently assess statistical significance (6). Treatment allocation was not randomized, and all animals in a given experiment were included for analysis. Significance was calculated with parametric Student t test. Statistics for gene-expression profiling analysis are indicated in Supplementary Methods. Phosphoproteomic bioinformatic analysis was conducted in Perseus (version 1.6.2.3) and Microsoft Excel. The data set was transformed into a log2 scale. To overcome the “missing value” issue, a stringent valid value filtering was performed. These required at least 30% of valid values in all groups and at least two of three of valid values in at least one group. The remaining missing values were included from a random Gaussian-shaped distribution applying a downshift of 1.5 times the standard deviation of the global data set, and a width of 0.5 times the standard deviation. The data were normalized by mean subtraction. Pathway analysis and network analysis were performed using pairwise Student t test to determine CSFR1-regulated sites after treatment by pexidartinib. Proteins carrying significantly regulated phosphorylation sites were subsequently used as input for interaction and pathway analyses using DAVID, Kyoto Encyclopedia of Genes and Genomes (KEGG), and STRING databases.

Pyrosequencing

Pyrosequencing experiments were performed at Zymo Research. Detailed protocol is included in Supplementary Materials.

CSF1R is expressed in PTCLs

To examine CSF1R expression in PTCLs and CTCLs, patient biopsies were analyzed by IHC staining (Fig. 1A–C; Supplementary Fig. S1A–S1D). CSF1R expression was most prevalent in CTCLs, as ≥30% of tumor cells expressed CSF1R in 52% of the cases examined (n = 54). CSF1R expression was variable, being observed in 5% to 99% of tumor cells (mean 54%) among the CTCL cases examined (Fig. 1B). Aberrant expression of CSF1R was also detected in different subtypes of PTCLs, including ALCLs (46%; n = 11), extranodal NK/TCLs (ENKTCL, 60%; n = 6), PTCL-NOS, 25%; n = 59), and angioimmunoblastic TCLs (AITL, 7%; n = 33; Fig. 1A–C). The number of tumor cells with aberrant expression of CSF1R was variable among PTCL cases, ranging from 10% to 95% (average 16%). As anticipated, CSF1R was localized within the cytoplasm and membrane of TCL cells. Consistent with these findings, CSF1R was detected in protein extracts from TCL lines (Fig. 1D) and was expressed at the cell surface (Supplementary Fig. S2A). In order to evaluate whether aberrant epigenetic regulation at the CSF1R promoter may explain its aberrant expression in TCLs, as observed in classic Hodgkin lymphoma, the presence of noncanonical and canonical CSF1R transcripts (39) was evaluated among different TCL lines. These experiments demonstrated that canonical and noncanonical CSF1R transcripts were present in cells that expressed CSF1R, but were largely undetectable in cells that did not express CSF1R (Supplementary Fig. S2B). Loss of the epigenetic repressor CBFA2T3 in classic Hodgkin lymphoma is associated with decreased methylation at regulatory sequences in CSF1R and increased CSF1R expression. In order to evaluate the mechanism for deregulated CSF1R expression in TCLs, assessment of CBFA2T3 expression was performed on different subtypes of TCL cases and cell lines (Supplementary Fig. S2C). Evaluation of CBFA2T3 expression in ALCL, PTCL-NOS, and ENKTCL cases that harbor aberrant expression of CSF1R revealed that CBFA2T3 is constitutively expressed in these tumors (Supplementary Fig. S2E–S2G). In contrast, decreased expression of CBFA2T3 was observed in a large proportion of CTCL cases (69%, n = 29). Importantly, a large proportion of cases with decreased CBFA2T3 expression aberrantly expressed CSF1R (70%; Supplementary Fig. S2G). Consistent with this, expression of noncanonical CSF1R transcripts was detectable in CTCL cases with low or absent CBFA2T3 expression (Supplementary Fig. S2C). To further evaluate the role of CBFA2T3 in CSF1R expression, CBFA2T3 was knocked down in T8ML1 cells. CBFA2T3 knockdown was associated with a 3-fold increase in noncanonical CSF1R transcripts, in comparison with scramble shRNA (Supplementary Fig. S2D). To further analyze the potential epigenetic regulation of CSF1R transcription, transcripts were quantified after treatment with combinations of hypomethylating agents (decitabine or azacytadine) and a histone deacetylase inhibitor (belinostat). Treatment with these agents significantly increased noncanonical and canonical transcripts in TCL lines, suggesting that CSF1R expression in TCL may be epigenetically regulated (Supplementary Fig. S3A and S3B). In addition, pyrosequencing of the alternative CSF1R promoter (39) demonstrated that TCL lines with high expression of noncanonical transcripts feature 20-fold decrease in methylation at two CpG-conserved residues, in comparison with TCL cell lines that feature low levels of noncanonical transcripts (Supplementary Fig. S3D). These findings demonstrate that CSF1R is aberrantly expressed, to varying degrees, in multiple TCL subsets, and its expression is likely epigenetically regulated. To evaluate whether CSF1R is activated in these cells, CSF1R phosphorylation was analyzed. CSF1R phosphorylation was detected among the TCL lines evaluated, suggesting that CSF1R is activated in a subset of TCL lines (Fig. 1E; Supplementary Fig. S3C). In order to investigate if activation of CSF1R can occur secondary to autocrine secretion/activation of CSF1/CSF1R, lymphoma-derived secretion of CSF1 was tested in TCL supernatants by ELISA. Secreted CSF1 was detected at different concentrations from the media of cultured TCL lines (Fig. 1F). Similarly, CSF1 mRNA was detected from tested TCL lines and was absent in lines that did not secrete CSF1 (Supplementary Fig. S3F). Importantly, the provision of exogenous CSF1 to TCL cells that do not produce CSF1 led to CSF1R activation in a time-dependent manner (Supplementary Fig. S3G). Overall, these findings demonstrate that CSF1R and CSF1 are expressed in TCL, and further, CSF1R activation may occur in an autocrine- or paracrine-dependent manner.

Figure 1.

CSF1R expression in TCLs. A, Representative photographs of PTCL cases that express CSF1R within the tumor cells (bottom) and corresponding hematoxylin and eosin (H&E) stain (top). B, Comparative analysis CSF1R expression within different subtypes of TCLs (PTCL-NOS, n = 59; ALCL, n = 11; CTCL, n = 31; ENKTCL, n = 6; and AITL, n = 33). Bars represent the percentage of positive cases for aberrant CSF1R expression within the tumor cells (≥30% positive tumor cells). C, Table indicates the number of cells at the indicated percentage intervals that express CSF1R. D, Western blot analysis displays positive CSF1R protein expression in Karpas 299, SUPM2, and DEL (ALCL) and undetectable expression in MyLa (CTCL) and T8ML1 (PTCL-NOS) lines. E, Protein expression of phosphorylated isoforms of CSF1R was detected by Western blot analysis in the indicated TCL lines. F, Secretion of the CSF1 ligand was detected from cell-cultured media of the indicated TCL lines by ELISA immunoassays. Scatter dot plot, mean ± SD.

Figure 1.

CSF1R expression in TCLs. A, Representative photographs of PTCL cases that express CSF1R within the tumor cells (bottom) and corresponding hematoxylin and eosin (H&E) stain (top). B, Comparative analysis CSF1R expression within different subtypes of TCLs (PTCL-NOS, n = 59; ALCL, n = 11; CTCL, n = 31; ENKTCL, n = 6; and AITL, n = 33). Bars represent the percentage of positive cases for aberrant CSF1R expression within the tumor cells (≥30% positive tumor cells). C, Table indicates the number of cells at the indicated percentage intervals that express CSF1R. D, Western blot analysis displays positive CSF1R protein expression in Karpas 299, SUPM2, and DEL (ALCL) and undetectable expression in MyLa (CTCL) and T8ML1 (PTCL-NOS) lines. E, Protein expression of phosphorylated isoforms of CSF1R was detected by Western blot analysis in the indicated TCL lines. F, Secretion of the CSF1 ligand was detected from cell-cultured media of the indicated TCL lines by ELISA immunoassays. Scatter dot plot, mean ± SD.

Close modal

CSF1R activity promotes the growth of TCLs in vitro

Having established the expression and activation of CSF1R in TCL, we adopted a loss-of-function strategy to address its potential oncogenic role in these TCL using complementary molecular and pharmacologic approaches. We first used a clinically available and rationally designed tyrosine kinase inhibitor that is selective for CSF1R (pexidartinib, PLX3397; refs. 25, 49). In order to confirm CSF1R inhibition upon pexidartinib treatment, TCL cells with autocrine activation of CSF1R were treated with pexidartinib. A marked decrease in CSF1R phosphorylation was observed upon treatment with pexidartinib (Fig. 2A; Supplementary Fig. S4A). Importantly, pexidartinib did not show any effect on the phosphorylation levels of the oncogenic kinase NPM–ALK, which is expressed in a portion of the TCL cells evaluated (Supplementary Fig. S4B). In addition, a dose-dependent decrease in proliferation was observed with exposure to pexidartinib (Fig. 2B; Supplementary Fig. S4D–S4E); however, these effects were not observed in TCL cells that do not express CSF1R, supporting the relative selectivity of this FDA-approved agent (Supplementary Fig. S4C). Consistent with these findings, treatment with pexidartinib was associated with increased apoptosis of TCL cells, as demonstrated by phosphatidylserine exposure (Fig. 2C–E), PARP cleavage and caspase-3 cleavage (Fig. 2F; Supplementary Fig. S4F). To further address the role of CSF1R in TCL growth, and exclude the possibility of off-target effects with a TKI, doxycycline-inducible stable expression of CSF1R-targeting shRNA were successfully generated in T-cell lymphoma–derived lines. To exclude shRNA “off-target” effects, two different shRNA constructs were generated (Fig. 3A and B). Following CSF1R knockdown, the viability of TCL lines was measured at 24-hour intervals for up to 72 hours. CSF1R knockdown led to a significant decrease in viability by 1.5-fold and 1.7-fold (n = 4, P < 0.01) in comparison with controls (Fig. 3C). To further examine the role of CSF1R during lymphoma growth, colony-formation assays were performed. TCL cells with CSF1R knockdown were cultured in methocult media, and colony formation was assessed after 10 days of culture. CSF1R knockdown led to a 1.5-fold and 2.0-fold reduction in colony formation when compared with nontargeting shRNA (n = 3, P < 0.01; Fig. 3D and E). Collectively, these findings indicate that CSF1/CSF1R-dependent signaling promotes TCL growth and survival.

Figure 2.

Pharmacologic CSF1R inhibition with pexidartinib impairs TCL growth and survival. A, The expression of phosphorylated Y723-, Y708-, and Y699-CSF1R was evaluated upon incubation with 1 μmol/L pexidartinib or DMSO vehicle control (time = 30 minutes). B, The proliferation of TCL lines was evaluated after 72-hour incubation with indicated doses of pexidartinib. C, Annexin V and propidium iodide incorporation was measured by flow-cytometric analysis upon exposure of pexidartinib (1 μmol/L, 72 hours), to evaluate the proportion of viable (Annexin V/propidium iodide) or apoptotic (Annexin V+/propidium iodide+) cells. D, DilC1 and Annexin V incorporation was measured by flow-cytometric analysis upon exposure of pexidartinib (1 μmol/L, 72 hours), to evaluate the proportion of viable (DilC1+/Annexin V) or apoptotic cells (DilC1/Annexin V+). E, Corresponding column graphs depict the proportion of viable or apoptotic cells upon exposure to pexidartinib. F, Expression of cleaved PARP was evaluated upon exposure to pexidartinib (1 μmol/L, 72 hours), in indicated TCL cells, in order to assess apoptosis. A and F, GAPDH as loading control. Figures are representative of at least three independent experiments. B and D, bars, mean ± SEM (**, P < 0.01; n = 5).

Figure 2.

Pharmacologic CSF1R inhibition with pexidartinib impairs TCL growth and survival. A, The expression of phosphorylated Y723-, Y708-, and Y699-CSF1R was evaluated upon incubation with 1 μmol/L pexidartinib or DMSO vehicle control (time = 30 minutes). B, The proliferation of TCL lines was evaluated after 72-hour incubation with indicated doses of pexidartinib. C, Annexin V and propidium iodide incorporation was measured by flow-cytometric analysis upon exposure of pexidartinib (1 μmol/L, 72 hours), to evaluate the proportion of viable (Annexin V/propidium iodide) or apoptotic (Annexin V+/propidium iodide+) cells. D, DilC1 and Annexin V incorporation was measured by flow-cytometric analysis upon exposure of pexidartinib (1 μmol/L, 72 hours), to evaluate the proportion of viable (DilC1+/Annexin V) or apoptotic cells (DilC1/Annexin V+). E, Corresponding column graphs depict the proportion of viable or apoptotic cells upon exposure to pexidartinib. F, Expression of cleaved PARP was evaluated upon exposure to pexidartinib (1 μmol/L, 72 hours), in indicated TCL cells, in order to assess apoptosis. A and F, GAPDH as loading control. Figures are representative of at least three independent experiments. B and D, bars, mean ± SEM (**, P < 0.01; n = 5).

Close modal
Figure 3.

CSF1R knockdown impairs TCL growth and survival. A, The efficiency of CSF1R knockdown upon induction (10 ng/mL doxycycline) of two independent CSF1R-specific shRNA sequences (shRNA#1 and shRNA #2) or scramble control, as measured by Western blot analysis or flow cytometry testing (B). C, Proliferation of TCL lines (Karpas 299) was evaluated after 72 hours of CSF1R shRNA or scramble shRNA induction. D, Representative pictures of colony-formation assays in methocult media (1 week growth) upon induction (+dox) or no induction (−dox) of CSF1R-specific or scramble shRNA. E, Bar graph, fold change in the number of colonies when CSF1R-specific or scramble shRNA was induced (dox) or noninduced (no dox). Figures are representative of at least three independent experiments. A, GAPDH as a loading control. C and E, bars, mean ± SEM (**, P < 0.01; n = 5).

Figure 3.

CSF1R knockdown impairs TCL growth and survival. A, The efficiency of CSF1R knockdown upon induction (10 ng/mL doxycycline) of two independent CSF1R-specific shRNA sequences (shRNA#1 and shRNA #2) or scramble control, as measured by Western blot analysis or flow cytometry testing (B). C, Proliferation of TCL lines (Karpas 299) was evaluated after 72 hours of CSF1R shRNA or scramble shRNA induction. D, Representative pictures of colony-formation assays in methocult media (1 week growth) upon induction (+dox) or no induction (−dox) of CSF1R-specific or scramble shRNA. E, Bar graph, fold change in the number of colonies when CSF1R-specific or scramble shRNA was induced (dox) or noninduced (no dox). Figures are representative of at least three independent experiments. A, GAPDH as a loading control. C and E, bars, mean ± SEM (**, P < 0.01; n = 5).

Close modal

Activation of CSF1R is associated with phosphorylation of different signaling pathways

Physiologic engagement and activation of CSF1R results in downstream phosphorylation-dependent signaling that modifies the survival and differentiation of myeloid lineage cells (33, 34). However, the downstream signals that are regulated by CSF1R activation in most nonmyeloid lineage cells are not known. In order to characterize the signaling pathways that are activated by CSF1R, an unbiased phosphoproteomic approach was performed after inhibition of CSF1R activity with pexidartinib in TCL lines. For this screening, Karpas 299 TCL lines were selected because the secretion of the CSF1 ligand together with strong surface expression of CSF1R is present. This screen identified a total of 1,936 independent phosphotyrosine peptides corresponding to 1,123 proteins. In addition, a combined set of 8,045 independent phophoserine/phosphothreonine peptides, corresponding to a total number of 3,136 proteins, were also identified in the screen (Supplementary Tables S1 and S2). A significant reduction in CSF1R autophosphorylated peptides was observed in pexidartinib-treated cells, further validating this approach (Table 1; Supplementary Fig. S5A and Supplementary Table S3). Hierarchical clustering was performed from three technical replicates, demonstrating that pexidartinib-treated cells formed a distinct cluster (Fig. 4A; Supplementary Fig. S5B), encompassing a total of 551 unique proteins with significant modifications in phosphorylated peptides. Out of those phosphorylated peptides, 451 were modifications in serine residues, 122 tyrosine residues, and 113 threonine resides (Supplementary Table 3). Signaling pathway analysis of these changes following CSF1R inhibition was performed with KEGG (online software) and was consistent with differential phosphorylation of PI3K/AKT-regulated signaling (Supplementary Table S1; Fig. 4B). Also, modifications in proteins that participate in cellular processes, including metabolism, cell-cycle progression, and actin-cytoskeleton dynamics, were also identified (Fig. 4B; Supplementary Table S4; Supplementary Fig. S5C). To further explore the signaling pathways that are activated downstream of CSF1R signaling, an unbiased gene-expression profile array was performed upon CSF1R inhibition with pexidartinib. The expression of 217 genes was significantly altered upon CSF1R inhibition with pexidartinib (n = 3, P < 0.01; Fig. 4C). Importantly, inhibition of CSF1R was associated with changes in the expression of genes that are involved in cytokine (JAK/STAT) signaling (Fig. 4D). Similarly, the phosphoproteomic screening demonstrated differential phosphorylation of proteins that are involved in JAK/STAT signaling, including STAT1, STAT3, STAT5, and SOS2 (Supplementary Table 2). Because the T-cell line used in the screen harbors the oncogenic NPM–ALK fusion, cells treated with the ALK inhibitor crizotinib were included as a control. In comparison with ALK inhibition, 46% (n = 154 genes) of the changes in gene expression observed in pexidartinib-treated cells were specific for pexidartinib (Fig. 4E), and expression of 63 genes was modified by treatment with either pexidartinib or crizotinib (Fig. 4E).

Table 1.

List of proteins within the PI3K–Akt signaling pathway with modifications upon CSF1R inhibition.

Pi3k-Akt pathway
Gene symbolProtein namep-residuePLX/DMSOP
CSF1R Macrophage colony-stimulating factor 1 receptor Y699 0.67866667 0.0235544 
IKBKG NF-kappa-B essential modulator S455 0.57060603 0.0089983 
IRS1 Insulin receptor substrate 1 Y465, Y989 2.49579897 0.0443774 
MAP2K2 Dual-specificity mitogen-activated protein kinase kinase 2 S295 1.53823261 0.0435752 
MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 T92 3.46612251 0.0125372 
PKN2 Serine/threonine-protein kinase N2 T801 1.58048452 0.022626 
PPP2R5C Serine/threonine-protein phosphatase 2A S458 0.57141452 0.0410022 
RBL2 Retinoblastoma-like protein 2 S121,T988 0.43394198 0.0064254 
SOS2 Son of sevenless homolog 2 T1232 0.31629528 0.0178266 
Pi3k-Akt pathway
Gene symbolProtein namep-residuePLX/DMSOP
CSF1R Macrophage colony-stimulating factor 1 receptor Y699 0.67866667 0.0235544 
IKBKG NF-kappa-B essential modulator S455 0.57060603 0.0089983 
IRS1 Insulin receptor substrate 1 Y465, Y989 2.49579897 0.0443774 
MAP2K2 Dual-specificity mitogen-activated protein kinase kinase 2 S295 1.53823261 0.0435752 
MCL1 Induced myeloid leukemia cell differentiation protein Mcl-1 T92 3.46612251 0.0125372 
PKN2 Serine/threonine-protein kinase N2 T801 1.58048452 0.022626 
PPP2R5C Serine/threonine-protein phosphatase 2A S458 0.57141452 0.0410022 
RBL2 Retinoblastoma-like protein 2 S121,T988 0.43394198 0.0064254 
SOS2 Son of sevenless homolog 2 T1232 0.31629528 0.0178266 
Figure 4.

Phosphoproteomic identification of CSF1R-dependent pathways. A and B, Phosphoproteomic analysis of TCL lines after CSF1R inhibition with pexidartinib. A, Clustering of TCL lines (Karpas 299) based on the relative log2 intensities of identified phosphotyrosine, after treatment with pexidartinib or DMSO vehicle (6 hours). Results represent three independent experiments. B, Functional analysis of the most represented canonical pathways based on the differential phosphorylation of proteins after CSF1R inhibition. C–E, Gene-expression analysis of TCLs after CSF1R inhibition with pexidartinib (24 hours). C, Cluster analysis of TCL lines (Karpas 299) based on the average gene expression after CSF1R inhibition with pexidartinib, NPM–ALK tyrosine kinase inhibition (crizotinib), or DMSO vehicle control. Results represent three independent experiments. D, Analysis of the most represented canonical pathways based on the differential gene expression downstream of CSF1R inhibition with pexidartinib. E, Venn diagram depicts the number of genes for which its expression is uniquely or commonly modified by CSF1R (pexidartinib) or NPM-ALK (crizotinib) inhibition.

Figure 4.

Phosphoproteomic identification of CSF1R-dependent pathways. A and B, Phosphoproteomic analysis of TCL lines after CSF1R inhibition with pexidartinib. A, Clustering of TCL lines (Karpas 299) based on the relative log2 intensities of identified phosphotyrosine, after treatment with pexidartinib or DMSO vehicle (6 hours). Results represent three independent experiments. B, Functional analysis of the most represented canonical pathways based on the differential phosphorylation of proteins after CSF1R inhibition. C–E, Gene-expression analysis of TCLs after CSF1R inhibition with pexidartinib (24 hours). C, Cluster analysis of TCL lines (Karpas 299) based on the average gene expression after CSF1R inhibition with pexidartinib, NPM–ALK tyrosine kinase inhibition (crizotinib), or DMSO vehicle control. Results represent three independent experiments. D, Analysis of the most represented canonical pathways based on the differential gene expression downstream of CSF1R inhibition with pexidartinib. E, Venn diagram depicts the number of genes for which its expression is uniquely or commonly modified by CSF1R (pexidartinib) or NPM-ALK (crizotinib) inhibition.

Close modal

Activation of CSF1R is associated with AKT and mTORC1 activation

As the phosphoproteomic screen implicated the PI3K/AKT/mTOR pathway (Table 1), and having established a functional role for CSF1R activation during T-cell lymphoma growth, the PI3K/AKT/mTOR pathway was examined further. The PI3K regulatory subunit (p85) binds phosphorylated tyrosine(s) within the CSF1R cytoplasmic tail via its SH2 domain, and is required for downstream mTOR activation in macrophages (15), demonstrating a PI3K-dependent link between CSF1R and mTOR activation. Phosphorylation-dependent activation of AKT (PKB) is required for activation of the mTOR/raptor complex (mTORC1) and plays a critical role in tumor growth and survival (50, 51), including T-cell lymphomas (52, 53). Further phosphoproteomic analysis, with less stringent statistical criteria and at least an average of 1.5 fold change, revealed modifications in several proteins within the PI3K/AKT/mTOR pathway (Fig. 5A). Similarly, a targeted approach for quantitative gene expression demonstrated that several members of the PI3K/AKT/mTOR axis were differentially expressed upon CSF1R activation (Fig. 5B; Supplementary Fig. S6B). In order to examine the extent to which CSF1R activation promotes AKT signaling, AKT phosphorylation was analyzed upon CSF1R inhibition. Phosphorylation of AKT (S473) was decreased in a time-dependent manner upon inhibition of CSF1R (Fig. 5C; Supplementary Fig. S6A). However, phosphorylation of AKT (T308) was detected at very low levels and precluded any further analysis of differential phosphorylation in the conditions tested (data not shown). Phosphorylation of extracellular signal-regulated kinase (ERK) is regulated downstream of CSF1R in myeloid lineages and contributes to mTORC1 activation independently of PI3K (54). Therefore, phosphorylation of ERK was evaluated downstream of CSF1R activation. No changes in phosphorylated ERK or total ERK levels were detected downstream of CSF1R inhibition (pexidartinib), suggesting that CSF1R activation does not contribute to ERK phosphorylation in T-cell lymphomas (Fig. 5C). In order to investigate the role of PI3K in CSF1R-dependent AKT phosphorylation, T-cell lymphoma lines were cultured with a PI3Kγ/δ inhibitor, tenalisib (RP6530). PI3K inhibition was associated with diminished AKT phosphorylation, with no changes in the total levels of AKT (Fig. 5D). Similarly, cells were cultured with CSF1 in the presence or absence of tenalisib. CSF1 led to CSF1R activation and AKT (S473) phosphorylation (Fig. 5E). However, PI3K inhibition with tenalisib abrogated AKT phosphorylation (Fig. 5E), suggesting that CSF1R-mediated AKT (S473) phosphorylation is PI3K dependent. Phosphorylation of AKT at S473 is required for optimal AKT activity (55, 56), leading to mTORC1 activation and phosphorylation of its substrates, including p70S6K and 4EBP1, both of which promote tumor growth and proliferation (53, 57, 58). To further explore the link between CSF1R and mTORC1 activation, p70S6K and 4EBP1 phosphorylation were evaluated upon CSF1R activation. CSF1R activation led to a significant increase in 4EBP1 and p70S6K phosphorylation (Fig. 5F and G), and phosphorylation of these mTORC1 substrates was inhibited up CSF1R inhibition with pexidartinib (Fig. 5F). Overall, these findings further support a role for CSF1R in T-cell lymphomas.

Figure 5.

CSF1R activates PI3K/AKT/mTOR signaling. A, Selected proteins that are involved in the PI3K/AKT/mTOR signaling pathway that feature at least an average of 2-fold change in phosphorylation after inhibition of CSF1R. The fold-change degree of quantity change in each direction is indicated by colors. B, Expression of selected genes in TCL lines that are components of the PI3K/AKT/mTOR signaling pathway was evaluated by quantitative real-time PCR after inhibition of CSF1R with pexidartinib (24 hours) or vehicle control (DMSO). C, Phosphorylation of ERK (p44/p42) and AKT (pSer473) was evaluated by Western blot after inhibition of CSF1R (pexidartinib) at indicated times in TCL lines (Karpas 299). D, Phosphorylation of AKT (pS473) was evaluated in TCL lines (Karpas 299) downstream of PI3K inhibition with tenalisib at indicated times. E, Phosphorylation of CSF1R (pY723) and AKT (pS473) was evaluated in TCL lines (Karpas 299) after incubation with human CSF1 ligand (+CSF1) for 20 minutes. Dependence of CSF1 signaling on PI3K was evaluated by concomitant incubation with tenalisib (PI3K inhibitor; +CSF1/+tenalisib). F, Phosphorylation of CSF1R (pY708, pY699), AKT (pS473), and 4EBP1 (pT37/46) was evaluated in T-cell lymphoma lines (Karpas 299) after incubation with human CSF1 ligand for 20 minutes. Specificity of CSF1 ligand activity was evaluated by concomitant incubation with pexidartinib (CSF1 + Pexi). G, Phosphorylation of p70S6K (pT389) was evaluated in T-cell lymphoma lines (Karpas 299) upon incubation with human CSF1 ligand at indicated time points. C–G, GAPDH as loading control.

Figure 5.

CSF1R activates PI3K/AKT/mTOR signaling. A, Selected proteins that are involved in the PI3K/AKT/mTOR signaling pathway that feature at least an average of 2-fold change in phosphorylation after inhibition of CSF1R. The fold-change degree of quantity change in each direction is indicated by colors. B, Expression of selected genes in TCL lines that are components of the PI3K/AKT/mTOR signaling pathway was evaluated by quantitative real-time PCR after inhibition of CSF1R with pexidartinib (24 hours) or vehicle control (DMSO). C, Phosphorylation of ERK (p44/p42) and AKT (pSer473) was evaluated by Western blot after inhibition of CSF1R (pexidartinib) at indicated times in TCL lines (Karpas 299). D, Phosphorylation of AKT (pS473) was evaluated in TCL lines (Karpas 299) downstream of PI3K inhibition with tenalisib at indicated times. E, Phosphorylation of CSF1R (pY723) and AKT (pS473) was evaluated in TCL lines (Karpas 299) after incubation with human CSF1 ligand (+CSF1) for 20 minutes. Dependence of CSF1 signaling on PI3K was evaluated by concomitant incubation with tenalisib (PI3K inhibitor; +CSF1/+tenalisib). F, Phosphorylation of CSF1R (pY708, pY699), AKT (pS473), and 4EBP1 (pT37/46) was evaluated in T-cell lymphoma lines (Karpas 299) after incubation with human CSF1 ligand for 20 minutes. Specificity of CSF1 ligand activity was evaluated by concomitant incubation with pexidartinib (CSF1 + Pexi). G, Phosphorylation of p70S6K (pT389) was evaluated in T-cell lymphoma lines (Karpas 299) upon incubation with human CSF1 ligand at indicated time points. C–G, GAPDH as loading control.

Close modal

Activation of CSF1R promotes PTCL growth in vivo

In order to further address the therapeutic relevance of these findings, the growth of T-cell lymphoma xenografts was evaluated upon CSF1R inhibition with pexidartinib. Murine CSF1 does not bind human CSF1R (48, 59); therefore, the autocrine-dependent CSF1R activation was evaluated in Karpas 299 xenografts generated in NSG mice. Tumor-bearing mice were treated with sham- or pexidartinib-containing chow, and no treatment-related toxicity was appreciated. An approximately 50% reduction in tumor growth was observed in pexidartinib-treated mice (n = 24, P < 0.05; Fig. 6A and B), and increased apoptosis was observed from protein extracts of tumors treated with pexidartinib (Fig. 6C). Phosphorylation of CSF1R (Y699) and p70S6K (T389) was examined as pharmacodynamic biomarkers using protein extracts from these xenografts, and a significant reduction in phosphorylation was observed in pexidartinib-treated mice (Fig. 6D). In similarly designed experiments, SUP-M2 cells (that require exogenous CSF1) were utilized, and xenografts generated in immunodeficient mice that either transgenically express human CSF1 (48) or in non–CSF1-expressing controls. An approximately 3-fold increase in tumor volume was observed in CSF1-producing mice compared with control mice (n = 32, P < 0.001; Fig. 6E and F). Importantly, tumor growth was inhibited in pexidartinib-treated CSF1 transgenic mice (n = 15, P < 0.001; Fig. 6E and F). However, no significant change in tumor growth was observed in the control mice treated with pexidartinib (Fig. 6E and F). Overall, these findings demonstrate that activation of CSF1R, in either an autocrine- or paracrine-dependent manner, promotes T-cell lymphoma growth, and further supports CSF1R as a rational therapeutic target in these lymphomas (Supplementary Fig. S7).

Figure 6.

CSF1 and CSF1R promote the growth of T-cell lymphoma xenografts. A, Representative photographs of tumor xenografts of Karpas 299 xenografts that secrete CSF1 and express CSF1R. Mice were fed with sham chow (control) of pexidartinib chow, and the tumors were extracted after 10 days of treatment. Only tumors that displayed at least 1 mm3 (volume) growth are included, and the total number of tumors with more than 1 mm3 tumor volume over the total number of engraftments is indicated (left). B, Graphic representation of the tumor volumes (mean ± SD) after feeding the animals with sham chow (control) or pexidartinib (n = 24). C, Protein extracts from Karpas 299 xenografts treated with control chow (control) or pexidartinib were evaluated for PARP cleavage and caspase-3 cleavage. Asterisk indicates cleaved PARP. Caspase-3 cleavage was evaluated with a specific antibody against cleaved caspase-3. D, Phosphorylation of P70S6K (pT389) was evaluated from protein extracts of T-cell lymphoma xenografts (Karpas 299) by Western blot analysis. GAPDH as loading control. E, Representative pictures of tumor xenografts of T-cell lymphoma lines that do not secrete CSF1 and express CSF1R (SUPM2). SUPM2 cells were injected in transgenic mice that secrete humanized CSF1 or control mice. Mice were fed either sham chow (control) or pexidartinib chow, and the tumors were explanted 10 days later. Only tumors that displayed at least 1 mm3 (volume) growth are displayed, and the total number of tumors with ≥1 mm3 tumor volume over the total number of injections is indicated (left). F, Graphic representation of the tumor xenograft volumes (mean ± SD), comparing the effects of CSF1 and treatment with pexidartinib, are shown (**, P < 0.05).

Figure 6.

CSF1 and CSF1R promote the growth of T-cell lymphoma xenografts. A, Representative photographs of tumor xenografts of Karpas 299 xenografts that secrete CSF1 and express CSF1R. Mice were fed with sham chow (control) of pexidartinib chow, and the tumors were extracted after 10 days of treatment. Only tumors that displayed at least 1 mm3 (volume) growth are included, and the total number of tumors with more than 1 mm3 tumor volume over the total number of engraftments is indicated (left). B, Graphic representation of the tumor volumes (mean ± SD) after feeding the animals with sham chow (control) or pexidartinib (n = 24). C, Protein extracts from Karpas 299 xenografts treated with control chow (control) or pexidartinib were evaluated for PARP cleavage and caspase-3 cleavage. Asterisk indicates cleaved PARP. Caspase-3 cleavage was evaluated with a specific antibody against cleaved caspase-3. D, Phosphorylation of P70S6K (pT389) was evaluated from protein extracts of T-cell lymphoma xenografts (Karpas 299) by Western blot analysis. GAPDH as loading control. E, Representative pictures of tumor xenografts of T-cell lymphoma lines that do not secrete CSF1 and express CSF1R (SUPM2). SUPM2 cells were injected in transgenic mice that secrete humanized CSF1 or control mice. Mice were fed either sham chow (control) or pexidartinib chow, and the tumors were explanted 10 days later. Only tumors that displayed at least 1 mm3 (volume) growth are displayed, and the total number of tumors with ≥1 mm3 tumor volume over the total number of injections is indicated (left). F, Graphic representation of the tumor xenograft volumes (mean ± SD), comparing the effects of CSF1 and treatment with pexidartinib, are shown (**, P < 0.05).

Close modal

CSF1R plays an important role in regulating the homeostatic survival of tumor-associated macrophages, which promote tumorigenesis in many human cancers, including non-Hodgkin lymphomas (3, 12, 13, 60). Therefore, CSF1R antagonism has emerged as an attractive therapeutic strategy in many cancers and is currently being examined in clinical trials using both TKI- and monoclonal antibody-based strategies. Although CSF1R expression is generally thought to be restricted to myeloid lineage cells, more recent studies have convincingly demonstrated its aberrant expression on nonmyeloid lineage cells, including malignant B cells and classic Hodgkin lymphoma (cHL; refs. 12, 38, 39). Given the importance of CSF1R-expressing macrophages in T-cell lymphoma pathogenesis, we investigated the extent to which CSF1R may be expressed by malignant T cells, as prior studies had suggested that CSF1R may be expressed in ALCL (12, 39, 61). In a large cohort of primary TCL specimens, CSF1R was prevalent in the most common TCL subtypes (e.g., PTCL-NOS) and was also observed in ALCL and cHL, as previously reported. Our findings demonstrate that CSF1R, while of little value as a diagnostic biomarker due to its expression across TCL subtypes, is an attractive therapeutic target (Supplementary Fig. S7).

Elegant studies performed in cHL demonstrated that derepression of a long-tandem repeat (LTR) generates noncanonical CSF1R transcripts. LTRs are commonly silenced epigenetically by methylation, and expression of the CSF1R gene is regulated by methylation-dependent mechanisms within the promoter and upstream LTR region during normal hematopoiesis (39, 62). The loss of expression of the ETO family member CBFA2T3 in Hodgkin lymphoma cells is associated with decreased methylation within the CSF1R LTR, explaining the aberrant CSF1R expression observed in these cells (39). Although noncanonical transcripts were detectable in cell lines, we were unable to detect these transcripts in primary PTCL-NOS specimens (data not shown). Consistent with these findings, the transcriptional repressor CBFA2T3, which is characteristically lost in CSF1R-expressing cHL, was expressed in the TCL we examined, with the exception of CTCL (ref. 39; Supplementary Fig. S2E). Epigenetic dysregulation is a recurring theme in many TCLs (3), and the increased CSF1R transcription we observed upon treatment with either hypomethylating agents or HDAC inhibitors may be consistent with an epigenetic mechanism contributing to the aberrant CSF1R expression we observed in CBFA2T3-expressing cells. Previous genomic and next-generation sequencing studies in both CTCLs and PTCLs (63–65) did not identify mutations or alterations in the CSF1R gene, suggesting that aberrant CSF1R expression in TCLs is primarily due to its epigenetic dysregulation. Collectively, these results suggest that additional epigenetic mechanisms, independent from CBFA2T3 loss, may explain CSF1R expression in the PTCL. The extent to which these therapeutic agents may select for CSF1R-expressing clones, whereas an interesting question, is unknown.

LAM are abundant constituents of the microenvironment in the TCLs, where they promote tumor growth and suppress host antitumor immunity (12). Our findings demonstrate that CSF1 is secreted by malignant T cells and may represent an important mechanism by which LAM are recruited and retained in these lymphomas. Within the TME, LAM directly promote the growth and survival of malignant T cells by providing both cell-surface ligands and cytokines (3). Therefore, the observation that paracrine activation of CSF1R in T-cell lymphoma lines was associated with increased tumor growth suggests that CSF1 secretion from cells within the tumor microenvironment, including LAM, promotes T-cell lymphoma growth and survival. However, our findings also show that autocrine activation of CSF1R promotes lymphoma growth in the absence of exogenous CSF1. CSF1 is posttranslationally modified and often retained within the extracellular matrix, and may be difficult to detect in plasma (66, 67), and could explain why CSF1 was rarely detected in plasma from TCL patients (data not shown). Future studies will be needed in a larger cohort of patients to examine the extent to which CSF1R expression is associated with disease natural history or response to therapy.

The phosphoproteomic and gene-expression profile demonstrate activation of conserved signaling pathways downstream of CSF1R/CSF1, including those that have been previously implicated in lymphoma progression. The mammalian target of rapamycin (mTOR) is a downstream target of PI3K/AKT and is the catalytic subunit of two distinct complexes, mTORC1 and mTORC2, both of which are distinguishable by their association with regulatory proteins, including Raptor and Rictor, respectively. In conventional T cells, mTOR activation is regulated by antigen, costimulatory, and cytokine receptor signaling (3), and regulates T-cell survival, differentiation, metabolism, and effector functions (68–73). Consistent with its role in normal T-cell biology and oncogenic role in other malignancies, it is not surprising that constitutive mTOR activation has been implicated in T-cell lymphomas (52). Importantly, gene-expression profiling studies have identified a cluster of PTCL cases characterized by poor clinical outcomes and dysregulation of PI3K–mTOR signaling (7, 63). Furthermore, the response rate observed (44%) with the mTORC1 inhibitor everolimus (52) approximates that observed with the PI3K inhibitors duvelisib and tenalisib (74). Nonetheless, additional signaling pathways may also contribute to the CSF1R-dependent oncogenic effects observed in T-cell lymphomas. Conversely, multiple CSF1R-independent mechanisms may promote mTOR activation in the TCL, including antigen-receptor signaling (6, 75), cytokine signaling (71, 75), ICOS activation in TFH-derived TCL, and the genetic landscape (including PTEN deletion; ref. 3).

The transcription and translation of regulatory cytokines and transcription factors may be temporally and spatially segregated in normal T cells, as the mRNA translation machinery is largely suppressed in resting T cells. However, upon activation, mRNA translation is unleashed in response to mTORC1-dependent increases in translation initiation and 5′-cap–dependent translation (76). Consequently, the translation of relevant cytokines (e.g., IL4), oncogenes (e.g., c-Myc), and transcription factors (e.g., GATA-3) that have been previously implicated in TCL pathogenesis may be regulated in an mTORC1-dependent manner (6, 58, 73, 76). Therefore, a proteomic approach, as opposed to the gene-expression profiling approach we adopted here, may provide a more comprehensive assessment of CSF1R- and mTOR-dependent proteins in the TCL. For example, mTORC1 has previously been implicated in the translational regulation of GATA-3 (6, 73), a transcription factor that was recently found to identify a distinct subset of PTCL-NOS that was enriched for mTOR-dependent genes (7, 44) and associated with chemotherapy resistance and poor outcomes (6). As mTOR plays a central role in regulating T-cell metabolism, the role of CSF1R (and PI3K/AKT/mTOR) in regulating metabolism of malignant T cells warrants further study and may have significant therapeutic implications (77–79).

In summary, CSF1R is aberrantly expressed in CTCLs and PTCLs and is activated by CSF1 in an autocrine- or paracrine-dependent manner. CSF1R activations leads to AKT phosphorylation in a PI3K-dependent manner, promoting the growth and survival of malignant T cells. Consequently, selective CSF1R inhibitors (e.g., pexidartinib) may have a novel dual mechanism of action in these lymphomas—depleting CSF1R-expressing LAM, on the one hand, and inhibiting cell-autonomous CSF1R signaling in malignant T cells, on the other (Supplementary Fig. S7).

R.A. Wilcox reports receiving other commercial research support from Incyte, CTI Biopharma, Bristol-Myers Squibb, and Takeda. No potential conflicts of interest were disclosed by the other authors.

Conception and design: C. Murga-Zamalloa, R.A. Wilcox

Development of methodology: C. Murga-Zamalloa, P. Chowdhury, O. Onder, R.A. Wilcox

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): C. Murga-Zamalloa, D.C.M. Rolland, A. Polk, A. Wolfe, O. Onder, R. Dewar, N.A. Brown, N.G. Bailey, K. Inamdar, K.S.J. Elenitoba-Johnson, R.A. Wilcox

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): C. Murga-Zamalloa, D.C.M. Rolland, H. Dewar, P. Chowdhury, O. Onder, N.A. Brown, N.G. Bailey, K. Inamdar, M.S. Lim, K.S.J. Elenitoba-Johnson, R.A. Wilcox

Writing, review, and/or revision of the manuscript: C. Murga-Zamalloa, D.C.M. Rolland, R. Dewar, N.A. Brown, K. Inamdar, M.S. Lim

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): A. Wolfe, R.A. Wilcox

Study supervision: C. Murga-Zamalloa, R.A. Wilcox

Other (performed experiments and analyzed data): P. Chowdhury

Other (provided pathology material for the study): K. Inamdar

The authors thank Craig Johnson and Dr. Chris Krebs from the University of Michigan, Biomedical Research Core Facilities DNA Sequencing Core and Microarray. They thank Gary Shangguan for technical assistance. This work was supported by grants from the NIH/NCI K08-CA218460 (to C. Murga-Zamalloa), LLS-TRP grant (#R6503-16), the 2017 AACR-Bayer Innovation and Discovery Grant (Grant Number 17-80-44-WILC), ACS (129084-RSG-16-045-01-LIB), and R37-CA233476 (to R.A. Wilcox), and by internal funds from the University of Michigan Department of Pathology (to N.A. Brown). Research reported in this article was supported by the NCI of the NIH under award number P30CA046592.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Ellin
F
,
Landstrom
J
,
Jerkeman
M
,
Relander
T
. 
Real-world data on prognostic factors and treatment in peripheral T-cell lymphomas: a study from the Swedish lymphoma Registry
.
Blood
2014
;
124
:
1570
7
.
2.
Ondrejka
SL
,
Hsi
ED
. 
T-cell lymphomas: updates in biology and diagnosis
.
Surg Pathol Clin
2016
;
9
:
131
41
.
3.
Wilcox
RA.
A three-signal model of T-cell lymphoma pathogenesis
.
Am J Hematol
2016
;
91
:
113
22
.
4.
Zhang
JY
,
Briski
R
,
Devata
S
,
Kaminski
MS
,
Phillips
TJ
,
Mayer
TL
, et al
Survival following salvage therapy for primary refractory peripheral T-cell lymphomas (PTCL)
.
Am J Hematol
2018
;
93
:
394
400
.
5.
Briski
R
,
Feldman
AL
,
Bailey
NG
,
Lim
MS
,
Ristow
K
,
Habermann
TM
, et al
Survival in patients with limited-stage peripheral T-cell lymphomas
.
Leukemia Lymphoma
2015
;
56
:
1665
70
.
6.
Wang
T
,
Lu
Y
,
Polk
A
,
Chowdhury
P
,
Zamalloa
CM
,
Fujiwara
H
, et al
T-cell receptor signaling activates an ITK/NF-kappaB/GATA-3 axis in T-cell lymphomas facilitating resistance to chemotherapy
.
Clin Cancer Res
2017
;
23
:
2506
15
.
7.
Iqbal
J
,
Wright
G
,
Wang
C
,
Rosenwald
A
,
Gascoyne
RD
,
Weisenburger
DD
, et al
Gene expression signatures delineate biological and prognostic subgroups in peripheral T-cell lymphoma
.
Blood
2014
;
123
:
2915
23
.
8.
Wilcox
RA
,
Sun
DX
,
Novak
A
,
Dogan
A
,
Ansell
SM
,
Feldman
AL
. 
Inhibition of Syk protein tyrosine kinase induces apoptosis and blocks proliferation in T-cell non-Hodgkin's lymphoma cell lines
.
Leukemia
2010
;
24
:
229
32
.
9.
Wada
DA
,
Wilcox
RA
,
Weenig
RH
,
Gibson
LE
. 
Paucity of intraepidermal FoxP3-positive T cells in cutaneous T-cell lymphoma in contrast with spongiotic and lichenoid dermatitis
.
J Cutan Pathol
2010
;
37
:
535
41
.
10.
Wilcox
RA
,
Wada
DA
,
Ziesmer
SC
,
Elsawa
SF
,
Comfere
NI
,
Dietz
AB
, et al
Monocytes promote tumor cell survival in T-cell lymphoproliferative disorders and are impaired in their ability to differentiate into mature dendritic cells
.
Blood
2009
;
114
:
2936
44
.
11.
Berger
CL
,
Hanlon
D
,
Kanada
D
,
Dhodapkar
M
,
Lombillo
V
,
Wang
N
, et al
The growth of cutaneous T-cell lymphoma is stimulated by immature dendritic cells
.
Blood
2002
;
99
:
2929
39
.
12.
Martin-Moreno
AM
,
Roncador
G
,
Maestre
L
,
Mata
E
,
Jimenez
S
,
Martinez-Torrecuadrada
JL
, et al
CSF1R protein expression in reactive lymphoid tissues and lymphoma: its relevance in classical Hodgkin lymphoma
.
PLoS One
2015
;
10
:
e0125203
.
13.
Polk
A
,
Lu
Y
,
Wang
T
,
Seymour
E
,
Bailey
NG
,
Singer
JW
, et al
Colony-stimulating factor-1 receptor is required for nurse-like cell survival in chronic lymphocytic leukemia
.
Clin Cancer Res
2016
;
22
:
6118
28
.
14.
Chang
M
,
Hamilton
JA
,
Scholz
GM
,
Masendycz
P
,
Macaulay
SL
,
Elsegood
CL
. 
Phosphatidylinostitol-3 kinase and phospholipase C enhance CSF-1-dependent macrophage survival by controlling glucose uptake
.
Cell Signal
2009
;
21
:
1361
9
.
15.
Munugalavadla
V
,
Borneo
J
,
Ingram
DA
,
Kapur
R
. 
p85alpha subunit of class IA PI-3 kinase is crucial for macrophage growth and migration
.
Blood
2005
;
106
:
103
9
.
16.
Dovas
A
,
Gevrey
JC
,
Grossi
A
,
Park
H
,
Abou-Kheir
W
,
Cox
D
. 
Regulation of podosome dynamics by WASp phosphorylation: implication in matrix degradation and chemotaxis in macrophages
.
J Cell Sci
2009
;
122
:
3873
82
.
17.
Byrne
PV
,
Guilbert
LJ
,
Stanley
ER
. 
Distribution of cells bearing receptors for a colony-stimulating factor (CSF-1) in murine tissues
.
J Cell Biol
1981
;
91
:
848
53
.
18.
Wang
Y
,
Szretter
KJ
,
Vermi
W
,
Gilfillan
S
,
Rossini
C
,
Cella
M
, et al
IL-34 is a tissue-restricted ligand of CSF1R required for the development of Langerhans cells and microglia
.
Nat Immunol
2012
;
13
:
753
60
.
19.
Kodama
H
,
Nose
M
,
Niida
S
,
Yamasaki
A
. 
Essential role of macrophage colony-stimulating factor in the osteoclast differentiation supported by stromal cells
.
J Exp Med
1991
;
173
:
1291
4
.
20.
Richardsen
E
,
Uglehus
RD
,
Johnsen
SH
,
Busund
LT
. 
Macrophage-colony stimulating factor (CSF1) predicts breast cancer progression and mortality
.
Anticancer Res
2015
;
35
:
865
74
.
21.
Huynh
D
,
Dai
XM
,
Nandi
S
,
Lightowler
S
,
Trivett
M
,
Chan
CK
, et al
Colony stimulating factor-1 dependence of paneth cell development in the mouse small intestine
.
Gastroenterology
2009
;
137
:
136
44
.
22.
Cannarile
MA
,
Weisser
M
,
Jacob
W
,
Jegg
AM
,
Ries
CH
,
Ruttinger
D
. 
Colony-stimulating factor 1 receptor (CSF1R) inhibitors in cancer therapy
.
J Immunother Cancer
2017
;
5
:
53
.
23.
Kacinski
BM
,
Scata
KA
,
Carter
D
,
Yee
LD
,
Sapi
E
,
King
BL
, et al
FMS (CSF-1 receptor) and CSF-1 transcripts and protein are expressed by human breast carcinomas in vivo and in vitro
.
Oncogene
1991
;
6
:
941
52
.
24.
Okugawa
Y
,
Toiyama
Y
,
Ichikawa
T
,
Kawamura
M
,
Yasuda
H
,
Fujikawa
H
, et al
Colony-stimulating factor-1 and colony-stimulating factor-1 receptor co-expression is associated with disease progression in gastric cancer
.
Int J Oncol
2018
;
53
:
737
49
.
25.
Tap
WD
,
Wainberg
ZA
,
Anthony
SP
,
Ibrahim
PN
,
Zhang
C
,
Healey
JH
, et al
Structure-guided blockade of CSF1R Kinase in tenosynovial giant-cell tumor
.
N Engl J Med
2015
;
373
:
428
37
.
26.
Chitu
V
,
Gokhan
S
,
Nandi
S
,
Mehler
MF
,
Stanley
ER
. 
Emerging roles for CSF-1 receptor and its ligands in the nervous system
.
Trends Neurosci
2016
;
39
:
378
93
.
27.
Tanaka
M
,
Kishi
K
,
McCarron
RM
,
Miyatake
T
. 
The generation of macrophages from precursor cells incubated with brain endothelial cells – a release of CSF-1 like factor from endothelial cells
.
Tohoku J Exp Med
1993
;
171
:
211
20
.
28.
Guilbert
LJ
,
Stanley
ER.
Specific interaction of murine colony-stimulating factor with mononuclear phagocytic cells
.
J Cell Biol
1980
;
85
:
153
9
.
29.
Nandi
S
,
Gokhan
S
,
Dai
XM
,
Wei
S
,
Enikolopov
G
,
Lin
H
, et al
The CSF-1 receptor ligands IL-34 and CSF-1 exhibit distinct developmental brain expression patterns and regulate neural progenitor cell maintenance and maturation
.
Dev Biol
2012
;
367
:
100
13
.
30.
Wei
S
,
Nandi
S
,
Chitu
V
,
Yeung
YG
,
Yu
W
,
Huang
M
, et al
Functional overlap but differential expression of CSF-1 and IL-34 in their CSF-1 receptor-mediated regulation of myeloid cells
.
J Leukocyte Biol
2010
;
88
:
495
505
.
31.
Noy
R
,
Pollard
JW
. 
Tumor-associated macrophages: from mechanisms to therapy
.
Immunity
2014
;
41
:
49
61
.
32.
Coussens
L
,
Van Beveren
C
,
Smith
D
,
Chen
E
,
Mitchell
RL
,
Isacke
CM
, et al
Structural alteration of viral homologue of receptor proto-oncogene fms at carboxyl terminus
.
Nature
1986
;
320
:
277
80
.
33.
Pixley
FJ
,
Stanley
ER.
CSF-1 regulation of the wandering macrophage: complexity in action
.
Trends Cell Biol
2004
;
14
:
628
38
.
34.
Stanley
ER
,
Chitu
V.
CSF-1 receptor signaling in myeloid cells
.
Cold Spring Harb Perspect Biol
2014
;
6
:
pii:a021857
.
35.
Wyckoff
J
,
Wang
W
,
Lin
EY
,
Wang
Y
,
Pixley
F
,
Stanley
ER
, et al
A paracrine loop between tumor cells and macrophages is required for tumor cell migration in mammary tumors
.
Cancer Res
2004
;
64
:
7022
9
.
36.
Patsialou
A
,
Wang
Y
,
Pignatelli
J
,
Chen
X
,
Entenberg
D
,
Oktay
M
, et al
Autocrine CSF1R signaling mediates switching between invasion and proliferation downstream of TGFbeta in claudin-low breast tumor cells
.
Oncogene
2015
;
34
:
2721
31
.
37.
Smith
HO
,
Stephens
ND
,
Qualls
CR
,
Fligelman
T
,
Wang
T
,
Lin
CY
, et al
The clinical significance of inflammatory cytokines in primary cell culture in endometrial carcinoma
.
Mol Oncol
2013
;
7
:
41
54
.
38.
Ullrich
K
,
Wurster
KD
,
Lamprecht
B
,
Kochert
K
,
Engert
A
,
Dorken
B
, et al
BAY 43-9006/Sorafenib blocks CSF1R activity and induces apoptosis in various classical Hodgkin lymphoma cell lines
.
Br J Haematol
2011
;
155
:
398
402
.
39.
Lamprecht
B
,
Walter
K
,
Kreher
S
,
Kumar
R
,
Hummel
M
,
Lenze
D
, et al
Derepression of an endogenous long terminal repeat activates the CSF1R proto-oncogene in human lymphoma
.
Nat Med
2010
;
16
:
571
9
.
40.
Skinnider
BF
,
Mak
TW.
The role of cytokines in classical Hodgkin lymphoma
.
Blood
2002
;
99
:
4283
97
.
41.
Komohara
Y
,
Noyori
O
,
Saito
Y
,
Takeya
H
,
Baghdadi
M
,
Kitagawa
F
, et al
Potential anti-lymphoma effect of M-CSFR inhibitor in adult T-cell leukemia/lymphoma
.
J Clin Exp Hematop
2018
;
58
:
152
60
.
42.
Giustini
N
,
Bernthal
NM
,
Bukata
SV
,
Singh
AS
. 
Tenosynovial giant cell tumor: case report of a patient effectively treated with pexidartinib (PLX3397) and review of the literature
.
Clin Sarcoma Res
2018
;
8
:
14
.
43.
Murga-Zamalloa
CA
,
Mendoza-Reinoso
V
,
Sahasrabuddhe
AA
,
Rolland
D
,
Hwang
SR
,
McDonnell
SR
, et al
NPM-ALK phosphorylates WASp Y102 and contributes to oncogenesis of anaplastic large cell lymphoma
.
Oncogene
2017
;
36
:
2085
94
.
44.
Wang
T
,
Feldman
AL
,
Wada
DA
,
Lu
Y
,
Polk
A
,
Briski
R
, et al
GATA-3 expression identifies a high-risk subset of PTCL, NOS with distinct molecular and clinical features
.
Blood
2014
;
123
:
3007
15
.
45.
Zhang
Q
,
Wang
H
,
Kantekure
K
,
Paterson
JC
,
Liu
X
,
Schaffer
A
, et al
Oncogenic tyrosine kinase NPM-ALK induces expression of the growth-promoting receptor ICOS
.
Blood
2011
;
118
:
3062
71
.
46.
Rolland
D
,
Basrur
V
,
Conlon
K
,
Wolfe
T
,
Fermin
D
,
Nesvizhskii
AI
, et al
Global phosphoproteomic profiling reveals distinct signatures in B-cell non-Hodgkin lymphomas
.
Am J Pathol
2014
;
184
:
1331
42
.
47.
Tyanova
S
,
Temu
T
,
Cox
J
. 
The MaxQuant computational platform for mass spectrometry-based shotgun proteomics
.
Nat Protoc
2016
;
11
:
2301
19
.
48.
Rathinam
C
,
Poueymirou
WT
,
Rojas
J
,
Murphy
AJ
,
Valenzuela
DM
,
Yancopoulos
GD
, et al
Efficient differentiation and function of human macrophages in humanized CSF-1 mice
.
Blood
2011
;
118
:
3119
28
.
49.
Patwardhan
PP
,
Surriga
O
,
Beckman
MJ
,
de Stanchina
E
,
Dematteo
RP
,
Tap
WD
, et al
Sustained inhibition of receptor tyrosine kinases and macrophage depletion by PLX3397 and rapamycin as a potential new approach for the treatment of MPNSTs
.
Clin Cancer Res
2014
;
20
:
3146
58
.
50.
Vadlakonda
L
,
Dash
A
,
Pasupuleti
M
,
Anil Kumar
K
,
Reddanna
P
. 
The paradox of Akt-mTOR interactions
.
Front Oncol
2013
;
3
:
165
.
51.
Vadlakonda
L
,
Pasupuleti
M
,
Pallu
R
. 
Role of PI3K-AKT-mTOR and Wnt signaling pathways in transition of G1-S phase of cell cycle in cancer cells
.
Front Oncol
2013
;
3
:
85
.
52.
Witzig
TE
,
Reeder
C
,
Han
JJ
,
LaPlant
B
,
Stenson
M
,
Tun
HW
, et al
The mTORC1 inhibitor everolimus has antitumor activity in vitro and produces tumor responses in patients with relapsed T-cell lymphoma
.
Blood
2015
;
126
:
328
35
.
53.
Gupta
M
,
Hendrickson
AE
,
Yun
SS
,
Han
JJ
,
Schneider
PA
,
Koh
BD
, et al
Dual mTORC1/mTORC2 inhibition diminishes Akt activation and induces Puma-dependent apoptosis in lymphoid malignancies
.
Blood
2012
;
119
:
476
87
.
54.
Marzec
M
,
Kasprzycka
M
,
Liu
X
,
El-Salem
M
,
Halasa
K
,
Raghunath
PN
, et al
Oncogenic tyrosine kinase NPM/ALK induces activation of the rapamycin-sensitive mTOR signaling pathway
.
Oncogene
2007
;
26
:
5606
14
.
55.
Sarbassov
DD
,
Guertin
DA
,
Ali
SM
,
Sabatini
DM
. 
Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex
.
Science
2005
;
307
:
1098
101
.
56.
Chu
N
,
Salguero
AL
,
Liu
AZ
,
Chen
Z
,
Dempsey
DR
,
Ficarro
SB
, et al
Akt kinase activation mechanisms revealed using protein semisynthesis
.
Cell
2018
;
174
:
897
907
.
57.
Witzig
TE
,
Reeder
CB
,
LaPlant
BR
,
Gupta
M
,
Johnston
PB
,
Micallef
IN
, et al
A phase II trial of the oral mTOR inhibitor everolimus in relapsed aggressive lymphoma
.
Leukemia
2011
;
25
:
341
7
.
58.
Demosthenous
C
,
Han
JJ
,
Stenson
MJ
,
Maurer
MJ
,
Wellik
LE
,
Link
B
, et al
Translation initiation complex eIF4F is a therapeutic target for dual mTOR kinase inhibitors in non-Hodgkin lymphoma
.
Oncotarget
2015
;
6
:
9488
501
.
59.
Yoshida
H
,
Hayashi
S
,
Kunisada
T
,
Ogawa
M
,
Nishikawa
S
,
Okamura
H
, et al
The murine mutation osteopetrosis is in the coding region of the macrophage colony stimulating factor gene
.
Nature
1990
;
345
:
442
4
.
60.
Edwards
VD
,
Sweeney
DT
,
Ho
H
,
Eide
CA
,
Rofelty
A
,
Agarwal
A
, et al
Targeting of colony-stimulating factor 1 receptor (CSF1R) in the CLL microenvironment yields antineoplastic activity in primary patient samples
.
Oncotarget
2018
;
9
:
24576
89
.
61.
Mathas
S
,
Kreher
S
,
Meaburn
KJ
,
Johrens
K
,
Lamprecht
B
,
Assaf
C
, et al
Gene deregulation and spatial genome reorganization near breakpoints prior to formation of translocations in anaplastic large cell lymphoma
.
Proc Natl Acad Sci U S A
2009
;
106
:
5831
6
.
62.
Tagoh
H
,
Schebesta
A
,
Lefevre
P
,
Wilson
N
,
Hume
D
,
Busslinger
M
, et al
Epigenetic silencing of the c-fms locus during B-lymphopoiesis occurs in discrete steps and is reversible
.
EMBO J
2004
;
23
:
4275
85
.
63.
Heavican
TB
,
Bouska
A
,
Yu
J
,
Lone
W
,
Amador
C
,
Gong
Q
, et al
Genetic drivers of oncogenic pathways in molecular subgroups of peripheral T-cell lymphoma
.
Blood
2019
;
133
:
1664
76
.
64.
Kiel
MJ
,
Sahasrabuddhe
AA
,
Rolland
DCM
,
Velusamy
T
,
Chung
F
,
Schaller
M
, et al
Genomic analyses reveal recurrent mutations in epigenetic modifiers and the JAK-STAT pathway in Sezary syndrome
.
Nat Commun
2015
;
6
:
8470
.
65.
Ng
SY
,
Yoshida
N
,
Christie
AL
,
Ghandi
M
,
Dharia
NV
,
Dempster
J
, et al
Targetable vulnerabilities in T- and NK-cell lymphomas identified through preclinical models
.
Nat Commun
2018
;
9
:
2024
.
66.
Kremlev
SG
,
Chapoval
AI
,
Evans
R
. 
CSF-1 (M-CSF) enhances the inflammatory response of fibronectin-primed macrophages: pathways involved in activation of the cytokine network
.
Nat Immunol
1998
;
16
:
228
43
.
67.
Kremlev
SG
,
Chapoval
AI
,
Evans
R
. 
Cytokine release by macrophages after interacting with CSF-1 and extracellular matrix proteins: characteristics of a mouse model of inflammatory responses in vitro
.
Cell Immunol
1998
;
185
:
59
64
.
68.
Zeng
H
,
Chi
H
. 
mTOR and lymphocyte metabolism
.
Curr Opin Immunol
2013
;
25
:
347
55
.
69.
Zeng
H
,
Cohen
S
,
Guy
C
,
Shrestha
S
,
Neale
G
,
Brown
SA
, et al
mTORC1 and mTORC2 kinase signaling and glucose metabolism drive follicular helper T cell differentiation
.
Immunity
2016
;
45
:
540
54
.
70.
Zeng
H
,
Yang
K
,
Cloer
C
,
Neale
G
,
Vogel
P
,
Chi
H
. 
mTORC1 couples immune signals and metabolic programming to establish T(reg)-cell function
.
Nature
2013
;
499
:
485
90
.
71.
Ray
JP
,
Staron
MM
,
Shyer
JA
,
Ho
PC
,
Marshall
HD
,
Gray
SM
, et al
The interleukin-2-mTORc1 kinase axis defines the signaling, differentiation, and metabolism of T Helper 1 and follicular B helper T cells
.
Immunity
2015
;
43
:
690
702
.
72.
Essig
K
,
Hu
D
,
Guimaraes
JC
,
Alterauge
D
,
Edelmann
S
,
Raj
T
, et al
Roquin suppresses the PI3K-mTOR signaling pathway to inhibit T helper cell differentiation and conversion of treg to Tfr cells
.
Immunity
2017
;
47
:
1067
82
.
73.
Lee
K
,
Gudapati
P
,
Dragovic
S
,
Spencer
C
,
Joyce
S
,
Killeen
N
, et al
Mammalian target of rapamycin protein complex 2 regulates differentiation of Th1 and Th2 cell subsets via distinct signaling pathways
.
Immunity
2010
;
32
:
743
53
.
74.
Horwitz
SM
,
Koch
R
,
Porcu
P
,
Oki
Y
,
Moskowitz
A
,
Perez
M
, et al
Activity of the PI3K-delta,gamma inhibitor duvelisib in a phase 1 trial and preclinical models of T-cell lymphoma
.
Blood
2018
;
131
:
888
98
.
75.
Ng
SY
,
Brown
L
,
Stevenson
K
,
deSouza
T
,
Aster
JC
,
Louissaint
A
 Jr
, et al
RhoA G17V is sufficient to induce autoimmunity and promotes T-cell lymphomagenesis in mice
.
Blood
2018
;
132
:
935
47
.
76.
Gigoux
M
,
Lovato
A
,
Leconte
J
,
Leung
J
,
Sonenberg
N
,
Suh
WK
. 
Inducible costimulator facilitates T-dependent B cell activation by augmenting IL-4 translation
.
Mol Immunol
2014
;
59
:
46
54
.
77.
Shukla
SK
,
Purohit
V
,
Mehla
K
,
Gunda
V
,
Chaika
NV
,
Vernucci
E
, et al
MUC1 and HIF-1alpha signaling crosstalk induces anabolic glucose metabolism to impart gemcitabine resistance to pancreatic cancer
.
Cancer Cell
2017
;
32
:
71
87
.
78.
Salmond
RJ.
mTOR regulation of glycolytic metabolism in T cells
.
Front Cell Dev Biol
2018
;
6
:
122
.
79.
Gupta
M
,
Dillon
SR
,
Ziesmer
SC
,
Feldman
AL
,
Witzig
TE
,
Ansell
SM
, et al
A proliferation-inducing ligand mediates follicular lymphoma B-cell proliferation and cyclin D1 expression through phosphatidylinositol 3-kinase-regulated mammalian target of rapamycin activation
.
Blood
2009
;
113
:
5206
16
.