Lack of Immunomodulatory Interleukin-27 Enhances Oncogenic Properties of Mutant p53 In Vivo

p53, which functions as a tumor suppressor, is mutated in about 50% of tumors, often through missense mutations occurring in the DNA-binding domain. Aside from affecting the transcriptional activity of p53, these missense mutations are often associated with an increase in the half-life of p53, causing mutant p53 to accumulate in the tumor cells and often acquire a gain-of-function phenotype. Although mutant p53 is inherently unstable, various stressors affect the oncogenic activation and properties of this protein. For example, DNA damage and oncogene activation such as RAS mutations, c-myc, or p16^INK4a can alter the oncogenic properties of mutant p53 (1, 2).

IL27 is known to be an important proinflammatory or anti-inflammatory cytokine. IL27 has been increasingly studied for its role in regulating the intensity and duration of T-cell response. Briefly, IL27 can antagonize IL2 production (3) and GATA3 expression by limiting Th2 response (4), as well as decrease RoRγ expression by limiting Th17 (5) and increase IL10 expression by inducing Th10 cells (6–8). IL27 signaling through STAT1 and T-bet can also enhance Th1-type responses. Furthermore, IL27 has been shown to have antitumor effects in subcutaneously injected neuroblastoma, colon carcinoma, lung carcinoma, and acute myeloid leukemia cells (9–13). However, IL27 can also increase PDL1, an important immunosuppressor checkpoint in both cancer and inflammation (14). Therefore, the biology of IL27 is complex and context dependent; IL27 may either dampen or promote different types of inflammation or cancer.

Although inflammation plays a central role in all aspects of cancer, from tumor initiation to progression and metastasis, it remains unknown if or how inflammatory signals stabilize or promote oncogenic properties, such as tumor development and survival of oncogenes such as mutant p53. Recent mouse models have been developed to better dissect the role of mutant p53. Specifically, mice were bred with mutations at amino acid 172 of p53 (R172H, Li-Fraumeni mice), corresponding to the human p53 hotspot mutation at amino acid 175. However, how endogenous levels of IL27 affect tumorigenesis or survival in these mice remains largely unknown. In the current study, we found that lack of IL27 signaling significantly shortens survival duration in mice with both copies of the mutant p53 gene (Li-Fraumeni mice, p53^H/H). Interestingly, in mice heterozygous for mutant p53 (p53^H/+), lack of IL27 signaling not only significantly shortened the survival but also doubled the incidence of osteosarcomas. This suggests that IL27 signaling negatively modulates the oncogenic properties of mutant p53 and lack of IL27 signaling is closely associated with early mutant p53 stability in vivo.

We bred IL27RA^−/− mice with p53^R172H/+ (generously donated by Dr. Lozano, University of Texas MD Anderson Cancer Center, Houston, TX) mice to create IL27RA^−/−p53^R172H/H, IL27RA^−/−p53^R172H/+, and IL27RA^−/−p53^+/+ mice, which were born at a Mendelian ratio. All mouse strains were maintained in C57Bl/6 cohorts. IL27RA^−/− mice were previously donated by Dr. Frederic de Sauvage (Genentech). Mice were monitored over time for tumor development. Genotyping was performed as described below for both p53 and IL27 receptor alpha (IL27RA). For the cohort studies, mice were euthanized when they met the criteria for euthanasia, mainly related to tumor burden or distress. For the time course study, mice from each genotype were euthanized at the indicated times. Tissue was fixed in neutralized paraformaldehyde prior to sectioning. All procedures involving animals were approved by The University of Texas MD Anderson Cancer Center Institutional Animal Care and Use Committee.

Sections of paraffin-embedded tissues were stained with hematoxylin and eosin. The pathologic readings for various abnormal growths were scored by a pathologist at MD Anderson Cancer Center. Images were captured using a Nikon Eclipse Ti microscope.

CT images were acquired as described previously (15). Briefly, images were acquired in five 100-ms frames at 1° rotation increments with an X-ray tube potential of 80 kVp and a current of 450 μA using an RS-9 micro-CT scanner (GE Healthcare). Two adjacent image volumes were acquired with an overlap of 40% of the field of view in the axial direction, and these images were stitched together after reconstruction. Images had a nominal isotropic resolution of 91 μm and required approximately 25 minutes of scan time. The bone was visualized using the GEHC Microview Software (GE Healthcare). All image isosurfaces were visualized and analyzed for bone mineral density using the same image threshold value.

Briefly, paraffin-embedded unstained slides from IL27RA^−/− p53^R172H/+ or control (p53^R172H/+) mice were processed for heat-induced antigen retrieval in pH 6.0 citrate buffer for 40 minutes in the steamer. Slides were incubated with rabbit monoclonal anti-p53 (1:100, Novus Biologicals) or rabbit anti-p21 (1:50, Santa Cruz Biotechnology) antibodies diluted at 1:100 in goat serum/fish gel/BSA blocking buffer overnight at 4°C. The next day, tissue was washed, blocked for 15 minutes in blocking buffer, and incubated with anti-rabbit IgG-Biotin (diluted at 1:500 in blocking buffer) for 1 hour at room temperature, followed by 30 minutes of incubation in the ABC enhanced Vectastain Kit System (Vector Laboratories). Similarly, other antibodies used for IHC staining included: Ki67 (1:800, Abcam); CD3 (1:100, Abcam), NCR1 (1:100, Abcam), B220 (1:50, BD Pharmingen), Foxp3 (1:100, Cell Signaling Technology), Endoglin (1:100, Vector Laboratories).

DNA was extracted from ear tissue, and PCR analysis for the p53 gene was performed using the primer sequence described by Lang and colleagues (16). The presence of the IL27RA gene was confirmed using the forward primer sequence CAAGAAGAGGTCCCGTGCTG and the reverse primer sequence TTGAGCCCAGTCCACCACAT. PCR primers used to determine the absence of IL27RA were as follows: GCTTTCGTCTCCCGTGTGCT (forward) and TGAGCCCAGAAAGCGAAGGA (reverse).

The osteosarcoma H318 cell line derived from a p53^H/+ mouse and expresses functional levels of IL27RA was used for these studies (17). The invasion assay was performed using Transwell inserts (Greiner Bio-one) in 24-well plates. To perform invasion assays, inserts were precoated with 30-μL phenol red–free Matrigel (BD Biosciences) for 1 hour at 37°C. Approximately, 10⁵ cells in 100-μL heat-inactivated complete RPMI media (with or without rIL27) were plated on top of the Matrigel-coated insert. The insert was placed at each well of 24-well plate. Then the insert was placed on top of the 500-μL complete media containing 10% FBS in each well of 24-well plate overnight at 37°C. Forty-eight hours later, the media was removed from the bottom chamber, and the insert was incubated with 500-μL media containing 8 μmol/L Calcein-AM for 1 hour at 37°C. Then the insert was transferred to a new well containing 500 μL of prewarmed 1 mmol/L EDTA to detach the cells on the outer surface of the insert. A total of 100 μL of cell suspension was transferred to each well (triplicate) of 96-well plate to measure fluorescence using spectramax. The migration assay was performed in a similar fashion with 10⁴ cells in 100 μL (with or without rIL27) without coating the insert with Matrigel. Cells inside the inserts were removed with cotton-tipped swabs on next day after overnight incubation.

H318 cell lines were serum starved overnight. Approximately 10,000 cells/well were treated with or without rIL27 (20 ng/mL) containing heat-inactivated serum media in quadruplicate for 24 or 48 hours. For 48 hours treatment, fresh heat-inactivated media (with or without rIL27) was added to each well after 24 hours. To measure the viability of H318 cells after treating with or without rIL27, 100 μL of CyQUANT NF Cell Proliferation Assay reagent was added to each well after aspiration of medium. After incubation for 1 hour at 37°C, fluorescence was measured (excitation 485 nm, emission 538 nm) on a SpectraMax Geminin EM microplate reader (Molecular Devices) using Softmax Pro version 5.4.

Bone marrow cells from age-matched wild-type, p53^H/+, or IL27RA^−/−p53^H/+ mice were isolated as described previously (18) and seeded at 3 × 10⁶ in RPMI media in a 6-well plate. These cells were irradiated with 6 Gy or left unirradiated. These samples were harvested 4 and 24 hours postirradiation.

Isolated bone marrow cells from 3-month-old mice were blocked for nonspecific staining in 2% BSA and with anti-CD16 (5 μg/mL) for 20 minutes at 4°C. Afterward, cells were stained in 2% BSA with anti-CD4-Violet421 (1:100, Pharminogen), anti-CD8-PE-Cy7 (1:100, Biolegend), anti-F4/80- Fitc (1:100, eBiosciences), anti-CD3-e450 (eBiosciences), anti-NK1.1-PE-Cy7 (eBiosciences), anti-CD19-Violet421 (1:100, Biolegend) and anti-B220-PerCP (1:100, Biolegend), anti-CD11c-Violet 421 (1:100, Biolegend), anti-MHCII-PerCP (1:100, Biolegend). At last, the cells were washed twice in 2% BSA and analyzed by flow cytometry using Attune (Invitrogen) and FlowJo.

Briefly, cells were lysed in lysis buffer, and supernatants were quantified for protein amount. Eighty micrograms of cell lysate was loaded in 10% SDS–PAGE, transferred to a nitrocellulose membrane, and incubated with primary antibody overnight at 4°C [1,000X dilution for anti-p53 (Novus Biologicals), 1,000X anti-actin].

Femur, tibia, and lumbar vertebras from mice were cut aseptically in 1.5-mm small pieces, rinsed in PBS, and placed in digestion media consisting 5 mg collagenase, 5 mg pronase, and 1 mg DNAse for 45 minutes at 37°C (19). Following digestion, single-cell suspension was passed through a 70-μm strainer twice. And finally, these cells were rinsed in PBS three times prior to intraosseous (1×10⁷ in 15-μL PBS) or subcutaneous injections (1×10⁷ in 30-μL PBS) as described previously (20).

The Student t test was used to analyze differences between groups. P < 0.05 was considered statistically significant. GraphPad Prism for Windows was used to prepare and analyze the graphs (GraphPad Software).

The role of endogenous IL27 during spontaneous tumorigenesis, and more specifically in a Li-Fraumeni mouse model, is not known. To understand the in vivo significance of IL27 in regulating mutant p53-driven oncogenic properties, we crossed IL27RA^−/− mice with heterozygous p53^H/+ mice, which allowed us to examine tumor incidence and survival between IL27RA^−/− p53^H/H mice and p53^H/H mice. Interestingly, we found that mice lacking IL27RA signaling that carried both alleles of mutant p53 (IL27RA^−/− p53^H/H mice) had significantly shorter survival times than p53^H/H mice (Fig. 1A), suggesting that endogenous IL27 signaling has antitumor properties. We observed a similar spectrum of tumor development between IL27RA^−/−p53^H/H mice and p53^H/H mice, including malignancies such as lymphoma and sarcoma (Fig. 1B–D). However, the incidence of lymphomas in IL27RA^−/−p53^R172H/H mice was threefold higher than in p53^R172H/H mice.

Because IL27RA^−/−p53^R172H/H mice have a short survival span, some important IL27RA^−/−-facilitated oncogenic interactions may be difficult to observe in these mice. Consequently, we sought to investigate the role of IL27 signaling in p53^R127H/+ heterozygote background. Therefore, we compared survival and tumor spectrum between IL27RA^−/−p53^H/+ and p53^H/+ mice (IL27RA^−/−p53^H/+ mice have a longer survival time than p53^H/H mice because these mice carry only one mutant p53 allele). Similar to the IL27RA^−/− p53^H/H mice, IL27RA^−/−p53^H/+ mice had significantly shorter survival times than p53^H/+ mice (Fig. 2A). Interestingly, the incidence of osteosarcomas in IL27RA^−/− p53^R172H/+ mice (68%) was twice that in p53^R172H/+ mice (Fig. 2B). More than 80% of these IL27RA^−/− p53^H/+ osteosarcomas were osteoblastic, and 12% had fibroblastic and giant cell differentiation.

Finally, 41% of the IL27RA^−/−p53^H/+ mice that had osteosarcomas progressed to rear leg paresis (Fig. 2B and Supplementary Fig. S1), whereas none of p53^H/+ mice in our cohort developed any of this phenotype.

Similar to human patients, micro-CT imaging showed that IL27RA^−/− p53^H/+ mice developed tumors in various anatomic sites, including the spine, ribs, or tibia (Fig. 2C). As 41% of osteosarcoma-positive IL27RA^−/−p53^H/+ mice developed rear leg paresis, compressive myelopathy and Wallerian degeneration were observed histologically in these mice (Fig. 2D).

Interestingly, osteosarcomas occurred in multiple locations simultaneously in the IL27RA^−/−p53^H/+ mice. Within the same mouse, we found multicentric osteosarcoma in the femur and throughout the spine, including the lumbar, thoracic, and cervical vertebrae (Fig. 2D). These multicentric osteosarcomas were found in 41% of the IL27RA^−/−p53^H/+ mice. And finally, these osteosarcomas also had the potential not only to invade into the spinal cord, spinal canal, or subjacent muscle, but also to form metastases to the lung (Fig. 2D). However, the metastatic potential to the lung was not increased in IL27RA^−/−p53^H/+ mice when compared with p53^H/+. These observations suggest that lack of IL27 signaling might generate a tumor-promoting environment.

To determine whether these osteosarcomas were aggressive, we transplanted the primary tumors into NSG mice. Briefly, we collected primary bone marrow from the femur or spine of mice that did not have visible tumor growth, minced the bone marrow, and placed it in enzymatic digestion media. Single-cell suspensions were injected directly into NSG mice either subcutaneously or orthotopically via intraosseous injections. Within 6 to 10 weeks, these mice developed visible tumors, which become aggressive osteosarcomas (Supplementary Fig. S2A–S2C).

Mutant p53 protein stability is often associated with oncogenic functions of this protein. Because IL27RA^−/− p53^H/+ mice have a higher incidence of osteosarcomas and shorter survival times than p53^H/+ mice, one possibility is that the lack of IL27 signaling increases the number of cells with stable mutant p53 protein at a faster rate than under normal IL27 signaling conditions. To examine the stability of mutant p53 over time, we stained for p53 healthy tumor-free bone marrow tissue derived from the spinal vertebrae of 8-month age-matched wild-type, IL27RA^−/−, p53^H/+, and IL27RA^−/− p53^H/+ mice (Fig. 3A). Indeed, we found significant expression of p53 in IL27RA^−/− p53^H/+ mice but not in controls. Stable p53 was detected as early as 2 months of age, but the levels of p21 were not detectable (Fig. 3B). These findings suggest that the absence of IL27 signaling modulates the oncogenic properties of mutant p53 in vivo and is closely associated with early mutant p53 stability.

p53 is stabilized in response to stress signals, which could come from either irradiation, or from the stress of exposing primary cells in tissue culture growth and oxygen exposure. To test whether different stressor modulate p53 stability in absence of IL27, we exposed bone marrow cell from wild-type, p53^H/+, and IL27RA^−/−p53^H/+ age-matched mice to irradiation and growth in culture. We hypothesize that bone marrow cells derived from IL27RA^−/−p53^H/+ may have higher levels of p53 in response to in vitro culture or due to irradiation. Indeed, bone marrow cells from IL27RA^−/−p53^H/+ had higher levels of p53 stability when grown in culture (compared with other genotypes at 24 hours) and when exposed to irradiation (Fig. 3C).

In addition, the authors tested whether recombinant IL27 (rIL27) could reduce p53 levels in osteosarcomas cell lines derived from p53^H/+ mice (17). Indeed, short-term treatment (30 minutes) with rIL27 has modestly reduced the p53 levels in these cells (Fig. 3D).

Natividad and colleagues showed that absence of IL27 signaling enhanced tumor growth in a carcinogen-induced fibrosarcoma and oncogene-driven mammary carcinoma. Lack of IL27 signaling was associated with a decrease of IFNγ-positive CD4 and CD8 T cells and absence of T-regulatory cells (21). To understand which immune cell population may be involved in our model in absence of IL27 signaling, we performed an immune cell profiling among different mice at the age of 3 months in the bone marrow (premalignant niche). No significant changes were seen in immune cell subgroups among all genotypes, except the number of F4/80-positive cells were significantly increased in the bone marrow of IL27RA^−/−p53^H/+ mice when compared with the controls (Fig. 4A).

Similarly, in end-stage osteosarcoma tumors derived from p53^H/+ versus IL27RA^−/−p53^H/+ ones, we found no differences in immune cell infiltrates (CD3, Foxp3, NCR1, or B220-positive cells. We only found differences in the number of macrophages in these established osteosarcomas (Fig. 4B). The immune cell infiltrates in these osteosarcomas are different from Natividad which saw a T-cell–dependent mechanism in carcinogen-induced fibrosarcomas. One possibility for this discrepancy may rely on the fact that carcinogen-induced tumors are more immunogenic than oncogene-induced spontaneously developing tumors.

To better understand on a mechanistic basis, the increased tumorigenicity and shorten survival that occurs in p53^H/+ mice lacking IL27, we compared neoangiogenesis markers and proliferation markers between p53^H/+ versus IL27RA^−/−p53^H/+ osteosarcoma cells. We saw no differences in terms of proliferation, but increase in neoangiogenesis marker endoglin was observed (Fig. 4C and D). Endoglin has been suggested as an appropriate marker for tumor-related angiogenesis and neovascularization (22).

And finally, to better understand the role of IL27 in osteosarcoma tumor cells, we determined the effects on proliferative capacity, migration, and invasive properties on H318 osteosarcoma that is derived from p53^H/+ mice. H318 also contains IL27RA expression. Interestingly, we found that in vitro rIL27 has a modest increase in osteosarcoma cell proliferation and invasion, but not migration (Supplementary Fig. S3A–S3C). However, these effects are derived from cell lines in vitro while neglecting the immune response and in absence of the tumor microenvironment implying the importance of functionally understanding the biologic significance of these cytokines in vivo.

Our study is one of the first to report that, in addition to other oncogenes such as Kras or c-myc, inflammatory signals such as IL27 can negatively regulate the oncogenic properties of mutant p53.

The mouse studies reported here are in concordance with a study in human patients showing that IL27p28 levels were significantly lower in patients with osteosarcoma than in healthy controls (23). Furthermore, in that study, as the disease progressed, the levels of IL27p28 were further reduced. The antitumor properties of IL27 in the Li-Fraumeni mouse model were also closely associated with mutant p53 stability in our study. One possible explanation is that inflammatory signals such as the absence of IL27 signaling stabilize p53 in vivo. Another explanation could be that IL27 promotes immunosurveillance to eradicate cells with excessive levels of stable p53.

In summary, endogenous levels of IL27 affected the oncogenic properties of mutant p53 in vivo in a Li-Fraumeni mouse model. Lack of IL27 signaling led to shortened survival times and increased incidence of osteosarcomas, suggesting that lack of IL27 signaling was closely associated with early mutant p53 stability.

No potential conflicts of interest were disclosed.

Conception and design: D. Dibra, A. Mitra, S. Li

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): X. Xia, M. Newman, J. Cutrera, M. Gagea

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): D. Dibra, J. Cutrera, M. Gagea, G. Lozano, S. Li

Writing, review, and/or revision of the manuscript: D. Dibra, A. Mitra, J. Cutrera, M. Gagea, E.S. Kleinerman, S. Li

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): A. Mitra, E. Kleinerman

Study supervision: D. Dibra, E. Kleinerman, S. Li

Other (provided reagents): G. Lozano

The authors thank pathologist, Dr. Laura Pageon for her histopathologic readings. The authors also thank Connie Larsson for providing the positive control slide for p21.

This study was supported by NIH R01 CA120985.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.