Autocrine Activation of CHRM3 Promotes Prostate Cancer Growth and Castration Resistance via CaM/CaMKK–Mediated Phosphorylation of Akt

This article is featured in Highlights of This Issue, p. 4497

Prostate cancer is the most common malignant disease in men in developed countries (1). In 2014, 233,000 new cases of prostate cancer are expected to occur in the United States, which accounts for 27% of incident cases in men (1). Although androgen deprivation is initially effective, the patients inevitably encounter the problem of resistance to androgen deprivation therapy, called castration resistance (2). Discovery of novel strategies to suppress castration resistance is especially helpful for the management of advanced prostate cancer.

Acetylcholine, normally released from nerve endings, is a classical neurotransmitter in the central and peripheral nervous system. A recent study reported the involvement of nerve ending–derived acetylcholine–activated cholinergic muscarinic receptor 1 (CHRM1) in mesenchymal cells in the tumor microenvironment to promote prostate cancer invasion and metastasis (3). However, besides nerve ending–derived acetylcholine, there is also widespread synthesis of acetylcholine by a variety of non-neuronal cell types, including lung, colon, airway, and ovarian epithelial cells (4). Whether there is synthesis of acetylcholine in prostate epithelial cells, which might play an autocrine activation role in promoting prostate cancer progression has not yet been studied.

Muscarinic receptors are G-protein–coupled receptors consisting of five members, CHRM1-CHRM5 (5). Activation of muscarinic receptors triggers Ca²⁺ influx, which causes smooth muscle contraction and glandular secretion. In the 1990s, muscarinic receptor subtypes were firstly defined as conditional oncogenes when they were activated by acetylcholine in NIH-3T3 cells (6). Subsequently, muscarinic receptors have been implicated to be involved in a few types of epithelial cancers, including colorectal cancer and small-cell lung cancer (7, 8). In addition, activation of muscarinic receptors was reported to promote prostate cancer cell proliferation in vitro (9). However, the mechanism and comprehensive functions of muscarinic receptors in prostate cancer progression, particularly in castration-resistant prostate cancer (CRPC), has not been clearly elucidated.

In the present study, we found the presence of a functional cholinergic system in prostate epithelial cells. An autocrine activation of CHRM3 that regulated prostate cancer cell growth and castration resistance was observed. Blockade of CHRM3 via a specific antagonist or shRNAs could effectively inhibit prostate cancer growth and castration resistance. The cholinergic signaling occurred via the CaM/CaMKK–mediated phosphorylation of Akt. These findings suggest a potential application of muscarinic receptor antagonists in the treatment of prostate cancer.

Human prostate cell lines used in this study: LNCaP, PNT1B (10), BPH1 (a kind gift from Dr. Simon W. Hayward; ref. 11), C4-2B, PC3, PC3-AR⁺, and PC3-luc (kind gifts from Dr. Jianhua Wang at Shanghai Jiao Tong University School of Medicine; refs. 12, 13). Cells were cultured in DMEM or RPMI-1640 supplemented with 10% FBS and penicillin and streptomycin at 37°C, 5% CO₂. In the cell proliferation assay, cell numbers were determined by hemocytometer.

Two shRNA sequences for CHRM3 (5′-3′, AGCAGAGACAGTCGGTCATTT and TCGGCAACATCCTGGTAATTG) and scrambled shRNA were cloned into the lentiviral vector pUCTP. The cDNA of CHRM3 was subcloned into the lentiviral expression vector EGH. Transfection efficiencies were determined at both the protein and mRNA levels.

In the scratch tests, confluent monolayer cells were scraped with a pipette tip. Cells were cultured in standard cell culture medium containing 10% FBS. Photographs were taken immediately and at 24 hours after wounding. To rule out the potential effects of cell proliferation on cell migration, we normalized the cell migration distance with the total number of cells at 24 hours.

In the Transwell assays, cells were first starved in serum-free medium for 24 hours. Ten thousand to 50,000 cells in 100 μL serum-free medium were seeded on the top of a Transwell chamber (8-μm pore size, 3422, Corning), 500 μL medium containing 10% FBS was added in the bottom of 24-well plates to induce cell migration. Twelve hours later, the culture inserts were fixed with 4% paraformaldehyde and stained in 0.1% crystal violet for 10 minutes. Cells that stayed on the top of the membrane were gently scraped by a cotton swab. To eliminate the effects of cell proliferation on cell migration, we starved PNT1B cells (Lenti-vector and Lenti-CHRM3 transfected PNT1B cells) and PC3 cells (scramble, shRNA1, and shRNA2 transfected PC3 cells) in serum-free medium for 24 hours and replaced the medium with standard cell culture medium for 12 hours. We measured the cell numbers before and at 12 hours after the replacement of the standard cell culture medium and calculated the cell number changes in both PNT1B cells and PC3 cells (data not shown). Then, we normalized the results in Transwell assays with the total number of cells at 12 hours.

For the subcutaneously xenografted tumor models, 1,000,000 cells (50 μL cell suspension + 50 μL Matrigel) were injected s.c. into the flank regions of 6-week-old male BALB/c nude mice. Tumor volume was measured once a week (V = 0.5ab²; i, the longest side; ii, the shortest side). For orthotopical implantation assays, 8-week-old male BALB/c nude mice were first castrated. Two weeks later, 1,000,000 cells (25 μL cell suspension + 25 μL Matrigel) were injected into the anterior lobes of the prostate with a 31G insulin syringe. Bioluminescent signal was induced by i.p. injection of D-luciferin (GoldBio, 1.5 mg D-luciferin per 10 g body weight in saline) and analyzed 10 minutes later using a Berthold imaging system. In some assays, darifenacin was injected i.p. at doses of 1 and 5 mg/kg/d. Vehicle (PBS mixed with DMSO at 1:1) was injected in the control group. Mice were fed in the SPF grade animal facility of Ren Ji hospital with controlled temperature and humidity. All animal studies were carried out following the guidelines of the Ren Ji hospital institutional animal care and ethics committee.

Paraffin-embedded human prostate tissue array slides containing 58 spots (29 paired prostate cancer and adjacent non-cancerous tissues; OD-CT-UrPrt03-001) were purchased from Shanghai Outdo Biotech Ltd. A primary antibody against CHRM3 (Abbiotec) and horseradish peroxidase (HRP)–conjugated secondary antibodies (Jackson ImmunoResearch) were applied. The immunostaining was visualized with DAB (3,3′-diaminobenzidine). Images were captured using a Leica DM2500 microscope under the same exposure conditions and analyzed with the Image-pro Plus 6.0 software (Media Cybernetics).

Cells were incubated with Fluo-4 AM (Invitrogen, 2 μmol/L in Hank's Balanced Salt Solution, HBSS) for 60 minutes at 37°C and incubated for another 15 minutes in fresh HBSS to allow de-esterification of intracellular AM esters. Acetylcholine and carbachol were added to the culture medium to trigger a Ca²⁺ influx. For antagonist studies, darifenacin was added 5 minutes before the stimulation of 10 μmol/L carbachol. Images were taken with a Leica inverted microscope for 300 seconds at intervals of 6 seconds. Data were analyzed with the Image-pro Plus 6.0 software.

In Western blotting assays, cells were lysed in a RIPA buffer (Thermo Fisher Scientific) with proteinase inhibitors and phosphatase inhibitors (Roche). Total proteins were measured by a BCA method (Thermo Fisher Scientific). Primary antibodies against GAPDH, E-cadherin, N-cadherin, Vimentin (Epitomic), CaMKKα (Santa Cruz Biotechnology), CHRM3 (Abbiotec), Flag (Sigma), Slug, Akt, pAkt-Ser473, pAkt-Thr308 (CST), and HRP-conjugated secondary antibodies were applied. Immunoblots were visualized with an ECL blotting detection kit (Thermo Fisher Scientific). In the immunoprecipitation assay, cell lysates were incubated with the rabbit Akt antibody or control mouse IgG antibody at 4°C overnight. Protein A-agarose beads (Roche) were added, and lysates were further incubated for 1 hour at room temperature. Beads were precipitated by centrifugation at 5,000 rpm for 3 minutes and boiled in SDS–PAGE loading buffer for 5 minutes. The samples were then detected according to standard Western blotting procedures.

Immunofluorescent staining was performed as previously described (14). Antibodies used in this study included Tuj-1 (Sigma), choline acetyltransferase (ChAT; Millipore), CHRM3 (Abbiotec), Ki67, E-cadherin, N-cadherin, Vimentin (Epitomic), and Cleaved caspase-3 (CST). The TUNEL apoptosis detection system (Promega) was used to detect apoptotic cells in mouse xenografted tumor sections. Images were taken using a Leica DM2500 microscope.

Total RNA was obtained and reverse-transcripted to cDNA by the RNeasy plus Mini Kit and the QuantiTect RT Kit (Qiagen). SYBR (Roche) real-time PCR was performed on the 7900HT machine (ABI). The sequences of the primers used in this study are listed in Supplementary Table S1.

Data in this study are expressed as the means ± SEM. Immunostaining densities of CHRM3 in matched human prostate cancerous and adjacent non-cancerous tissues were compared by the paired Student t test. Cell proliferation, real-time PCR and in vivo tumor xenograft growths were analyzed using a nonparametric Student t test. Ki67, TUNEL, and cleaved caspase-3–positive cells were counted in at least three randomly selected visual fields and analyzed using a nonparametric Student t test. The Kaplan–Meier log-rank test was used for analysis of mouse survival data. Data were analyzed with GraphPad Prism 5 software (GraphPad Software). Statistical significance was defined as *, P < 0.05; **, P < 0.01; and ***, P < 0.001.

Autonomic nerves were reported to regulate prostate cancer metastasis by regulating the microenvironment of epithelial cancer cells (3). Immunostaining of mouse prostate sections confirmed dense innervation of Tuj-1 immunoreactive nerve fibers; however, few, if any, fibers could be observed inside the epithelium (Fig. 1A). Instead, mouse prostate epithelial cells showed strong immunoreactivity of ChAT, which is the enzyme necessary for acetylcholine synthesis (Fig. 1B). Importantly, ChAT immunoreactivity in human prostate sections also showed the expression of ChAT in the epithelium (Fig. 1C). In addition, we detected the secretion of acetylcholine from both cancerous and non-cancerous human prostate epithelial cells, which are free of any neuronal innervations (Fig. 1D). These data demonstrate clearly that there is endogenous production and secretion of acetylcholine from prostate cancerous and non-cancerous epithelial cells.

A complete, functional cholinergic loop requires the presence of not only acetylcholine but also muscarinic receptors. To determine the expression patterns of muscarinic receptors in the prostate, we profiled gene expression in the Oncomine database and GEO Profiles database. Of five muscarinic cholinergic receptors, only CHRM3 was significantly elevated in prostate cancer samples compared with non-cancer samples (Supplementary Fig. S1). To confirm the Oncomine and GEO data analysis, we performed IHC of CHRM3 in the human prostate cancer tissue array and found that CHRM3 was mainly expressed in the prostate epithelium rather than in the mesenchyme (Fig. 1E). Notably, CHRM3 was significantly upregulated in cancer tissues compared with their matched, adjacent non-cancer tissues (Fig. 1F).

To determine whether the autocrine acetylcholine could activate muscarinic receptors in epithelial cells, we performed experiments to measure Ca²⁺ influx, which is a direct indicator of muscarinic receptor activation. We measured Ca²⁺ influx with Fluo-4 AM, a commonly used fluorescent Ca²⁺ influx indicator, and found that both acetylcholine and its stable analogue carbachol could induce Ca²⁺ influx. CHRM3-specific antagonist darifenacin could largely reduce Ca²⁺ influx induced by carbachol (Fig. 1G). In addition, conditioned medium from PC3 cells also triggered Ca²⁺ influx, suggesting the occurrence of secretion of endogenous non–nerve ending–derived acetylcholine (Fig. 1H). Importantly, the Ca²⁺ influx induced by endogenous acetylcholine could be effectively blocked by the CHRM3 specific inhibitor (Fig. 1H). Taken together, these findings show the presence of functional autocrine cholinergic signaling in prostate epithelium.

To evaluate the role of autocrine cholinergic signaling in prostate cancer growth, we overexpressed CHRM3 in nontumorigenic PNT1B cells. Overexpression of CHRM3 in PNT1B cells promoted cell growth as time proceeded (Fig. 2A), implicating that overexpressed CHRM3 could be activated by endogenous acetylcholine. In contrast, the knockdown of CHRM3 by shRNA in PC3 cells inhibited cell growth (Fig. 2C). The lentiviral transfection efficiencies were analyzed by Western blot analysis (Fig. 2B and 2D). In addition, we treated PC3 cells with carbachol (a stable agonist of muscarinic receptors) and darifenacin (a selective antagonist of CHRM3). Although carbachol promoted the proliferation of PC3 and 22Rv1 cells, blockade of CHRM3 by darifenacin could effectively reduce cell proliferation (Fig. 2E and F).

To extend our in vitro studies to an in vivo setting, we implanted CHRM3 knockdown PC3 cells subcutaneously in BALB/c nude mice. We found that knockdown of CHRM3 reduced tumor growth in vivo (Fig. 2G). Consistently, CHRM3-specific antagonist darifenacin also inhibited the growth of xenografted PC3 and 22Rv1 cells (Fig. 2H and I). Histologic examination of PC3 xenografted tumors treated with darifenacin showed a reduced percentage of Ki67 positive, proliferating cells, and increased the percentage of apoptotic cells (Fig. 2J–L). These findings indicate that autocrine activation of CHRM3 promotes prostate cancer growth.

To evaluate the role of CHRM3 in regulating cell migration, we performed Transwell assays and scratch tests. In Transwell assays, overexpression of CHRM3 in PNT1B cells increased the number of cells that migrated through the membrane (Fig. 3A and B). In scratch tests, overexpression of CHRM3 promoted the confluence of scratched cells (Supplementary Fig. S2A and S2B). To rule out the potential effects of cell proliferation on cell migration, we normalized the results in Transwell assay and scratch test with the total number of cells at the same detection time point as described in Materials and Methods. On the contrary, knockdown of CHRM3 in PC3 cells inhibited their migration capability both in the Transwell assay and in the scratch test (Fig. 3C and D; Supplementary Fig. S2C and S2D). Similarly, the cell migration results were also normalized to the total number of cells at the same detection time point.

Epithelial–mesenchymal transition (EMT) is an important process in epithelial cancer progression, which facilitates cell migration and invasion (15). To verify whether the activation of CHRM3 could induce EMT, we overexpressed CHRM3 in PNT1B cells. We observed that CHRM3 upregulation caused the PNT1B cells to become less attached to each other and exhibit a mesenchymal phenotype (Fig. 3E). Immunostaining of these cells with E-cadherin, N-cadherin, and Vimentin antibodies confirmed that E-cadherin expression was decreased in CHRM3-overexpressing PNT1B cells; N-cadherin and Vimentin expression was sharply increased (Fig. 3E). Western blotting analysis confirmed the decreased E-cadherin protein level and increased Vimentin protein level in CHRM3-overexpressing PNT1B cells (Fig. 3F). Consistently, real-time PCR analysis also showed an increase in mesenchyme-related gene expression, whereas E-cadherin was downregulated in these CHRM3-overexpressing PNT1B cells (Fig. 3G). On the contrary, CHRM3 knockdown PC3 cells reversed its mesenchymal status and expressed more E-cadherin and less N-cadherin (Fig. 3H). The immunoblotting analysis also confirmed that CHRM3 knockdown reversed EMT in PC3 cells (Fig. 3I). In addition, real-time PCR analysis of several EMT-related genes also showed that CHRM3-silenced PC3 cells underwent an opposite process of EMT, that is, mesenchymal–epithelial transition (Fig. 3J). These findings together indicate that autocrine activation of CHRM3 promotes prostate cell migration by regulating EMT.

To evaluate the role of CHRM3 in castration resistance, a very important feature of prostate cancer, we first measured CHRM3 expression in paired CRPC and androgen-dependent prostate cancer cells: C4-2B and LNCaP, PC3 and PC3-AR⁺. C4-2B was a bone metastatic and castration-resistant subline of androgen-dependent LNCaP cells (16). PC3-AR⁺ cells were generated through stable expression of full-length human androgen receptor (AR) in PC3 cells (17). Reexpression of AR restored the response to androgens in PC3-AR⁺ cells (17, 18). Real-time PCR analysis revealed higher CHRM3 mRNA levels in castration-resistant C4-2B and PC3 cells than their paired androgen-dependent LNCaP and PC3-AR⁺ cells, respectively (Fig. 4A). Second, we treated LNCaP cells with bicalutamide, a clinically used androgen deprivation agent, to imitate the androgen deprivation condition in vitro. After several generations, the expression of CHRM3 was obviously upregulated in bicalutamide-treated LNCaP cells (Supplementary Fig. S3A). Third, we s.c. implanted PC3-AR⁺ cells in nude mice. When tumors grew for approximately 1 month, we castrated the recipient mice. We analyzed CHRM3 mRNA levels before and post castration. We found that the expression of CHRM3 was significantly increased after castration (Fig. 4B). These findings are in agreement with the GEO database, indicating that androgen deprivation resulted in enhanced CHRM3 expression in LuCaP35 cells (Supplementary Fig. S3B; ref. 19). All of these data together suggest a positive correlation of CHRM3 with castration resistance.

To evaluate whether activation of CHRM3 could cause castration resistance in vivo, we established tumor xenografts in castrated nude mice. At first, we wanted to establish in vivo tumor models with LNCaP cells. However, LNCaP cells failed to efficiently and consistently form tumors in normal, uncastrated nude mice even with 10 million cells. Then, we engrafted PC3-AR⁺ and PC3 cells subcutaneously in castrated nude mice. We observed that PC3 cells transfected with control lentivirus indeed formed tumors in androgen deprivation conditions (Fig. 4C). On the contrary, PC3-AR⁺ cells transfected with control lentivirus failed to do so under the same conditions (Fig. 4C). More importantly, overexpression of CHRM3 in these PC3-AR⁺ cells caused them to re-gain the castration-resistant capability and form tumors under conditions of hormone deprivation condition (Fig. 4C). Consistently, immunofluorescent staining of Ki67 and cleaved caspase-3 in tumor sections showed increased cell proliferation and decreased cell apoptosis, respectively, in CHRM3 overexpressed xenografts (Fig. 4D–G). These results suggest that activation of CHRM3 can enhance castration-resistant growth capability of the androgen-dependent prostate cancer cells.

To study whether the blockade of CHRM3 could influence castration-resistant growth or the sensitivity of prostate cancer cells under androgen deprivation conditions, we established an orthotopic prostate cancer model with luciferase stably expressing PC3 (PC3-luc) cells under an androgen deprivation paradigm, which is more similar to the in situ castration-resistant prostate cancer. Seven weeks after implantation, we examined tumor growth by bioluminescence (Fig. 5A). Stable silencing of CHRM3 reduced tumor growth when compared with the scrambled shRNA transfected group (Fig. 5B and C). When these primary xenografted tumor sections were processed for immunofluorescent staining with anti-Ki67 antibody to detect the proliferating cells, we observed decreased Ki67-positive nuclei in CHRM3 knockdown tumors (Fig. 5D and E). Similarly, when the tumor-recipient mice were treated with vehicle or darifenacin at a dosage of 1 mg/kg/d, darifenacin significantly inhibited castration resistant growth of PC3-luc cells when compared with the vehicle group (Fig. 5F–H). In addition, darifenacin improved the survival status in tumor-bearing recipient mice (Fig. 5I). Immunostaining of Ki67 also showed decreased cell proliferation in darifenacin-treated tumors (Fig. 5J). These findings together confirm that blockade of CHRM3 enhances the sensitivity of androgen-independent PC3-luc cells to androgen deprivation.

Next, we wanted to explore the mechanism of autocrine cholinergic signaling in regulating prostate cancer growth and castration resistance. Previous studies reported that Ca²⁺ influx could promote the phosphorylation of Akt (20–22). Because our data had shown that activation of muscarinic receptors stimulated Ca²⁺ influx in prostate cancer cells, we next wanted to determine whether the autocrine activation of cholinergic signaling could enhance calcium signaling-mediated phosphorylation of Akt. As shown in Fig. 6A, overexpression of CHRM3 in LNCaP cells increased the phosphorylation of Akt due to the production of endogenous acetylcholine from the LNCaP cells (Fig. 6A). On the contrary, silencing of CHRM3 in PC3 cells decreased the phosphorylation of Akt (Fig. 6B). These findings indicate that the autocrine cholinergic signaling could promote Akt phosphorylation.

To confirm that Akt phosphorylation induced by the autocrine cholinergic signaling is calcium-signaling dependent, we first treated PC3 cells with the CHRM3-specific antagonist darifenacin and the calmodulin-selective antagonist W-7. Western blotting analysis revealed that both darifenacin and W-7 could effectively inhibit Akt phosphorylation stimulated by carbachol (Fig. 6C). Next, we treated PC3 cells with CaMKK antagonist STO-609 to determine whether the downstream signaling of CaM was involved in Akt phosphorylation. STO-609 could also effectively block Akt phosphorylation induced by carbachol (Fig. 6D). Furthermore, co-immunoprecipitation showed a direct binding of Akt to CaMKKα (Fig. 6E). These data suggest that autocrine cholinergic signaling promotes prostate cancer growth and castration resistance through CaM/CaMKK–mediated activation of Akt (Fig. 6F).

Although a previous study reported a role for neuronal cholinergic signaling in prostate cancer metastasis (3), the present study demonstrates several different and novel findings. First, we found the autonomous expression of ChAT and synthesis of acetylcholine in prostate epithelial cells, suggesting the presence of autocrine cholinergic signaling in the prostate epithelium. Second, we detected an upregulation of CHRM3 in human prostate cancer tissues compared with their adjacent non-cancer tissues, implicating that CHRM3 might be an additional diagnostic marker of prostate cancer. Third, different from the parasympathetic cholinergic signaling that regulated the microenvironment to promote prostate cancer metastasis (3), we found that direct overexpression or knockdown of CHRM3 in the prostate cells significantly promoted or inhibited cell migration through the regulation of EMT. Finally, we found that activation or inhibition of CHRM3 promoted or inhibited prostate cancer growth and castration resistance both in vitro and in vivo. Thus, our data strongly indicate that there is an autocrine activation of CHRM3 in prostate cancer epithelial cells.

Our study shows, for the first time, the secretion of autocrine acetylcholine from prostate epithelial cells and cancer cells. Immunostaining indicated the expression of ChAT in both mouse and human prostate epithelia. In addition, we detected the production of acetylcholine by human prostate epithelial cells, including both cancer cells and non-cancer cells. The concentration of autocrine acetylcholine in the cell culture medium is approximately 2 to 4 μmol/L, which is sufficient to stimulate Ca²⁺ influx that can be induced by 0.1 μmol/L of acetylcholine or carbachol (Supplementary Fig. S4). Considering that in the microenvironment of prostate cancer, the concentration of acetylcholine in prostate cancer tissues may be even higher than the acetylcholine secreted into the medium due to higher cell density, such autocrine acetylcholine signaling likely functions in the prostate in vivo. Further support for our autocrine cholinergic signaling model also comes from the results reported previously in other tissue adenocarcinoma cells, such as colon cancer cells and small-cell lung cancer cells (7, 8).

The present study provides important insights into the mechanism for the biologic effects of activation of muscarinic receptors. First, either the CHRM3-specific inhibitor darifenacin or the calmodulin-selective antagonist W-7 can effectively inhibit Akt phosphorylation stimulated by carbachol. Second, CaMKK antagonist STO-609, which is a downstream signaling component of CaM, also effectively blocks Akt phosphorylation induced by activation of CHRM3. Third, there is direct binding between Akt and CaMKK based on coimmunoprecipitation assays. Fourth, calcium signaling has been shown to mediate Ca²⁺ influx-induced Akt phosphorylation (22, 23). Finally, a blockade of Akt activity has been shown to suppress castration-resistant growth in both mouse models and clinical settings (24–27). These findings together suggest that autocrine cholinergic signaling promotes prostate cancer growth and castration resistance through the CaM/CaMKK–mediated activation of Akt (Fig. 6F).

Castration resistance is a major challenge in prostate cancer treatment. However, an effective approach for targeting castration-resistant prostate cancer is currently unavailable. In this study, we found that CHRM3 was upregulated in CRPC cells compared with matched androgen-dependent cells. Although overexpression of CHRM3 was sufficient to cause androgen-dependent PC3-AR⁺ cells to form tumors in castrated mice, stable silencing of CHRM3 inhibited the castration-resistant growth of PC3 cells in orthotopic xenografts. Notably, our study showed that the CHRM3-specific antagonist darifenacin was effective to inhibit PC3 cell growth in castrated nude mice. Given that specific antagonists of CHRM3 have been widely used in clinical conditions such as OAB (overactive bladder) and COPD (chronic obstructive pulmonary diseases), clinical trials with such CHRM3 antagonists are warranted and may hold promise for the treatment of primary prostate cancer as well as CRPC.

No potential conflicts of interest were disclosed.

Conception and design: N. Wang, R. Yang, W.-Q. Gao

Development of methodology: N. Wang, Y. Quan, W.-Q. Gao

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): N. Wang, M. Yao

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): N. Wang, R. Yang, W.-Q. Gao

Writing, review, and/or revision of the manuscript: N. Wang, R. Yang, W.-Q. Gao

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): J. Xu, K. Zhang, R. Yang

Study supervision: R. Yang, W.-Q. Gao

The study is supported by funds to W.-Q. Gao from the Chinese Ministry of Science and Technology (2012CB966800, 2013CB945600, and 2012CB967903), the National Natural Science Foundation of China (81130038 and 81372189), the Science and Technology Commission of Shanghai Municipality (Pujiang program), the Shanghai Education Committee Key Discipline and Specialty Foundation (J50208), the Shanghai Health Bureau Key Discipline and Specialty Foundation and the KC Wong foundation.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.