PLK1 Inhibitors Synergistically Potentiate HDAC Inhibitor Lethality in Imatinib Mesylate–Sensitive or –Resistant BCR/ABL⁺ Leukemia Cells In Vitro and In Vivo Free

Chronic myelogenous leukemia (CML) is neoplastic stem cell disorder characterized by the 9,22 translocation, producing the BCR/ABL fusion protein, a constitutively active kinase which signals downstream to multiple antiapoptotic proteins (e.g., CRKL, STAT5, and Bcl-xL; ref. 1). CML treatment has been revolutionized by the BCR/ABL kinase inhibitor imatinib mesylate (IM) and second-generation agents (e.g., nilotinib, dasatinib, and bosutinib; refs. 2, 3). Despite long-term responses to these agents, drug intolerance, the development of resistance-conferring mutations (e.g., T315I), and the failure to eradicate primitive leukemia-initiating cells represent therapeutic challenges (4). In addition, patients in blast phase of CML or with Ph¹⁺ acute lymphoblastic leukemia (ALL) generally respond poorly to therapy (5). Consequently, the need for new and more effective treatment options remains.

Polo-like kinase 1 (PLK1) is a conserved serine-threonine kinase involved in mitotic progression through interactions with cyclin B, the CDC25C phosphatase, and Wee1 (6). It has been implicated in progression into M phase, mitotic spindle formation, cytokinesis, and chromosome segregation (7). PLK1 modulates DNA damage responses, including recovery from the G₂ DNA damage checkpoint (8). Moreover, interactions between PLK1 and multiple checkpoint proteins, including Chk1/2, p53, claspin, and FoxM1, have been described (9). PLK1 is highly expressed in multiple malignancies, including leukemia (10) and lymphoma (11), prompting the development of multiple PLK1 inhibitors, including the specific ATP-competitive inhibitor BI2536, which displays a 10,000-fold increase (12) in specificity for PLK1 compared with other tyrosine and threonine kinases (12). It was recently reported that PLK1 represented a downstream target of BCR/ABL in CML cells and that PLK1 interruption by inhibitors such as BI2536 or short hairpin RNA (shRNA) knockdown promoted leukemia cell death in highly imatinib mesylate–resistant cells expressing BCR/ABL gatekeeper mutations (e.g., T315I; ref. 13). BI6727 (volasertib) is a highly potent, clinically relevant PLK1 inhibitor which has superior pharmacokinetic properties compared with BI2536 (14).

Histone deacetylase inhibitors (HDACI) act by modifying chromatin structure and, by extension, gene expression (15). These agents also trigger acetylation of various non-histone proteins, particularly those implicated in DNA damage responses, including DNA repair proteins (Ku70) and chaperone proteins (Hsp90; ref. 16). In addition, HDACIs downregulate DNA repair proteins (e.g., Rad51 and MRE11; refs. 17). Indeed, HDACI lethality has been attributed to oxidative injury [e.g., reactive oxygen species (ROS); ref. 18], due to impaired induction of antioxidant proteins (19). HDACIs have been shown to enhance the activity of tyrosine kinase inhibitors in CML cells (20), including early progenitor cells (21). Currently, no information exists concerning PLK1/HDACI interactions in human CML cells. Consequently, interplay between BI2536 and the HDACI vorinostat has been examined in BCR/ABL⁺ leukemia cells (both CML and ALL), including highly imatinib mesylate–resistant cells expressing gatekeeper mutations. The present results show highly synergistic interactions both in vitro and in vivo in imatinib mesylate–sensitive and -resistant BCR/ABL⁺ leukemia cells and suggest multiple mechanisms, including enhanced inhibition of BCR/ABL and downstream targets, as well as marked potentiation of oxidative injury and DNA damage. These findings provide a theoretical foundation for a strategy combining HDAC and PLK1 inhibitors to eradicate BCR/ABL⁺ leukemia cells.

LAMA 84 cells were purchased from the German Collection of Microorganisms and Cell Cultures. K562 and BaF/3 cells were obtained as before (22). Cells were cultured in RPMI media as described previously (22). CD34⁺ cells were obtained with informed consent from patient bone marrows and processed as before (22). CML adult T315I and BV173/E255K ALL cells were generated as described (23). K562 cells expressing ectopically PLK1-CA or shRNA/scrambled sequence were generated by electroporation (Amaxa) as described (24). K562 and LAMA84 cell lines were authenticated by STR DNA fingerprinting using the AmpFlSTR Identifiler Kit (Applied Biosystems). The short tandem repeat (STR) profiles were compared with known American Type Culture Collection database and to the German Collection of Microorganisms and Cell Cultures database (http://www.dsmz.de/).

PLK1 inhibitors BI2536 and BI6277 were purchased from ChemieTek Inc. and Selleck BioChem. GW843682 and 7-aminoactinomycin D (7-AAD) were from Sigma-Aldrich and vorinostat was from Merck. All drugs were formulated in sterile dimethyl sulfoxide (DMSO) before use. Annexin V/propidium iodide (PI) was from BD PharMingen and MnTBAP was from Calbiochem.

Cell viability was monitored by flow cytometry using 7-AAD as before (24). Apoptosis was evaluated by Annexin V/PI staining (24) and verified by Wright–Giemsa staining. Results of morphologic assessment, 7-AAD staining, and Annexin V/PI staining were highly concordant.

Cells were harvested and cytosolic S-100 fractions were prepared as before (22, 24). Western blot analysis assessing cytochrome c, SMAC, and AIF release was conducted as below.

Immunoblotting was conducted as described previously (22, 24). Primary antibodies were as follows: AIF, cytochrome c, p-stat5, stat5, p-ATM, and ATR (Santa Cruz Biotechnology); p-BCR/ABL, BCR/ABL, p-PLK1(Thr210), PLK1, cleaved caspase-3, and p-ATR (Cell Signaling Technology); PARP (C-2–10; BioMol Research Laboratories); SMAC and γH2A.X (Upstate Biotechnology); tubulin (Oncogene); ATM and Histone1.2 (Abcam); and p-PLK1 (Ser137; Millipore).

Cells were treated with 20 μmol/L 2′,7′-dicholorodihydrofluorescein diacetate for 30 minutes at 37°C, and fluorescence was monitored by flow cytometry and analyzed with CellQuest software (25).

Cell-cycle distribution was determined by flow cytometry using a commercial software program (ModFit, Becton Dickinson) as per standard protocol (25).

Plasmids encoding Homo sapiens PLK1 in pCMV6-Entry vectors were obtained from Origene Technologies. Four separate sequences were used to knock down PLK1 (i.e., 1- GGCAAGATTGTGCCTAAGTCTCTGCTGCT, 2-ACCAGCACGTCGTAGGATTCCACGGCTT, 3-TCACAGTCCTCAATAAAGGCTTGGAGAAC, 4- TGGACTGGCAACCAAAGTCGAATATGACG) and one nonspecific control sequence (NC-GGAATCTCATTCGATGCATAC) as negative control. Similarly, the following sequences are used to known down Histone 1.2 (AAGGTTGCGAAGCCCAAGAAA, NC- GGAATCTCATTCGATGCATAC from SA Biosciences). Details of the shRNA for knocking down HDAC1–3 are follows (shHDAC1: 5′-GCTCCATCCGTCCAGATAACA-3′; shHDAC2: 5′-GCTGGAGCTGTGAAGTTAAAC3-′; shHDAC3: 5′-GCACCATGCCAAGAAGTTTGA-3′; NC- GGAATCTCATTCGATG CATAC).

Transient transfections of K562 cells used an Amaxa Nucleofector. Protocols for each cell line used Transfection Kit V and a cell-specific optimized protocol (T-16) as before (22).

Animal studies used Beige-nude-XID mice (NIH-III; Charles River). A total of 10 × 10⁶ K562 cells were pelleted, washed twice with 1 × PBS, and injected subcutaneously into the right flank. Once tumors were visible, 5 to 6 mice were treated with BI2536 with or without vorinostat and tumor growth or regression monitored as before (24, 25). To investigate effects of tumor size on regimen efficacy, experiments were carried out with different initial tumor sizes [e.g., (i) average, 150 mm³ and (ii) average, 550 mm³. Systemic tumor models used BV173/E255K/Luc cl4 cells as described earlier (23). Briefly, 2 × 10⁶ BV173/E255K/Luc cl4 cells in 100 μL PBS were tail vein injected and animals noninvasively imaged using an in vivo Imaging System (IVIS-200; Xenogen) following luciferase injection (d-luciferin; Research Products International). BI2536 was administered orally by gavage; vorinostat was given intraperitoneally. Both drugs were given simultaneously daily, 3 days a week (TIW). BI2536 was dissolved in 0.1 (N) HCl solution; 0.9% NaCl was added as diluent. The BI2536 volume was 100 μL. Vorinostat was administered as described (24).

The significance of differences between experimental conditions was determined with the 2-tailed Student t test. Synergistic and antagonistic interactions were characterized using median dose–effect analysis in conjunction with a commercially available software program (CalcuSyn; ref. 26).

Concomitant exposure (48 hours) of K562 cells to vorinostat (1.5 μmol/L) and very low, minimally toxic (e.g., 3 nmol/L) concentrations of BI, significantly increased apoptosis, which exceeded 80% at 5 to 6 nmol/L BI2536 (Fig. 1A). Vorinostat concentrations as low as 0.5 μmol/L, potentiated BI lethality which became more pronounced at concentrations ≥ 1.0 μmol/L (Fig. 1B). Time course analysis revealed discernible increases in cell death after 24 hours of exposure, which increased at 48 hours (Supplementary Fig. S1A). Median dose–effect analysis yielded combination index values considerably below 1.0, reflecting a highly synergistic interaction (Fig. 1C). Combined treatment also strikingly reduced colony formation of K562 cells (Fig. 1D). In contrast, individual or combined treatment with BI and vorinostat minimally affected normal CD34⁺ cells (Supplementary Fig. S1B).

Similar interactions were observed when BCR/ABL⁺ LAMA84 were exposed to BI (2.0 nmol/L) and 1.0 μmol/L vorinostat (Supplementary Fig. S2A) or in K562 cells exposed to other PLK1 inhibitors (e.g., BI6277 or GW843682) or HDACIs (e.g., vorinostat or SBHA; Supplementary Fig. S2B). Median dose–effect analysis revealed synergism between GW843682 and vorinostat in LAMA84 cells (Supplementary Fig. S2C). Notably, BI2536/vorinostat synergism occurred in highly imatinib mesylate–resistant human T315I BCR/ABL⁺ ALL cells or E255K BV173 ALL cells bearing the E255K mutation (ref. 23; Supplementary Fig. S2D and S2E). In contrast to normal CD34⁺ cells, BI2536/vorinostat induced marked apoptosis in primary BCR/ABL⁺ CD34⁺ cells (Supplementary Fig. S2F). Finally, the BI2536/vorinostat regimen exerted pronounced lethality toward BaF/3 cells expressing wild-type (wt) or 3 BCR/ABL mutants (E255K, M351T, or T315I; Supplementary Fig. S2G). In separate studies, sequential administration of BI2536 and vorinostat was slightly less effective than simultaneous exposure in inducing cell death (data not shown). These findings indicate that HDACIs synergistically potentiate the lethality of extremely low concentrations of PLK1 inhibitors in imatinib mesylate–sensitive or -resistant BCR/ABL⁺ leukemia cells but are relatively sparing toward their normal counterparts.

Effects of vorinostat/BI2536 on various signaling and survival events were examined. These studies were conducted at relatively early exposure intervals and before the onset of extensive apoptosis (e.g., 24 hours). Combined treatment of K562 cells with BI2536 (5 nmol/L) and vorinostat (1.5 μmol/L) resulted in a marked increase in cytochrome c, AIF, and SMAC release into the cytosolic fraction, accompanied by enhanced PARP and caspase-3 cleavage (Fig. 2A and B). While the agents administered alone had little effect on BCR/ABL phosphorylation, combined treatment induced modest reductions in phospho-BCR/ABL expression but not total expression (Fig. 2B). Combined treatment had little effect on T210 phosphorylation of PLK1 but clearly reduced S137 phospho-PLK1. No changes in total PLK1 were noted. Finally, combined treatment reduced levels of phospho-STAT5, a downstream BCR/ABL target (27).

While vorinostat alone modestly upregulated histone 1.2, a marker of DNA damage (28), co-administration of BI-2536, which had no effect by itself, dramatically increased histone 1.2 levels, accompanied by pronounced induction of γH2A.X, an indicator of DNA double-strand breaks (ref. 29; Fig. 2C). Combined treatment also resulted in clear increases in phosphorylation of the checkpoint proteins ATR and ATM (Fig. 2C), accompanied by downregulation of DNA repair proteins (e.g., MLH1, MSH3, MSH6, MRE11, and RAD51; Fig. 2D). Increased DNA damage occurred in highly imatinib mesylate–resistant BV173/E255 ALL cells (Fig. 2E). Finally, time course studies of K562 cells exposed to BI2536 and vorinostat resulted in clear increases in γH2A.X formation and ATM phosphorylation at 12 hours and ATR phosphorylation at 18 hours (Fig. 2F). In separate studies, co-administration of the broad caspase inhibitor BOC-FMK did not prevent DNA damage or ATM/ATR phosphorylation by the BI2536/vorinostat regimen (data not shown). Finally, histone 1.2 knockdown significantly reduced BI2536/vorinostat lethality (P < 0.05; Supplementary Fig. S3A) and diminished PARP cleavage (Supplementary Fig. S3B). Collectively, these findings indicate that the BI2536/vorinostat regimen downregulates various survival proteins and promotes DNA damage in BCR/ABL⁺ leukemia cells and argue for a functional role for DNA damage in lethality.

To evaluate the functional significance of PLK1 in these interactions, K562 cells ectopically expressing PLK1 were generated. Two clones (CA6 and CA9) expressing significantly greater levels of PLK1 than scrambled controls (Fig. 3A, inset) were used. The lethality of the BI2536 regimen in PLK1-expressing clones was significantly attenuated (P < 0.05) compared with controls (Fig. 3A). Conversely, shRNA knockdown of PLK1 (Fig. 3B, inset) significantly increased vorinostat lethality (Fig. 3B). Finally, PLK1-knockdown cells exposed to vorinostat exhibited significant increases in caspase-3 cleavage, γH2A.X formation, and ATM phosphorylation compared with controls (Fig. 3C).

Previous evidence implicated oxidative injury in HDACI lethality toward myeloid leukemia cells (18, 30). While BI2536 and vorinostat alone modestly induced ROS, manifested as early as 30 minutes after administration and increasing over the ensuing 24 hours, combined treatment significantly increased ROS levels (Fig. 4A). Notably, the ROS scavenger TBAP blocked ROS generation (Fig. 4B) as well as lethality (Fig. 4C) in BI2536/vorinostat-treated cells. TBAP also blocked BI2536/vorinostat-mediated caspase-3 and PARP cleavage, γH2A.X formation, and ATM/ATR phosphorylation (Fig. 4D), suggesting a functional role for oxidative injury in DNA damage and lethality.

Previous studies have implicated HDACs (e.g., HDAC3) in the DNA damage response (31). Consequently, the effects of HDAC knockdown on responses to BI2536 were examined. Three transiently transfected lines exhibiting knockdown of HDAC1–3 respectively (Fig. 5A, inset) were significantly more susceptible to BI2536 lethality (2.5–7.5 nmol/L) than controls (Fig. 5A). Moreover, HDAC3 knockdown cells exposed to BI2536 displayed increased caspase-3 and PARP cleavage, λH2A.X formation, and phospho-ATR compared with controls (Fig. 5B). Similar results were obtained in HDAC1 or 2 knock-down cells (data not shown), arguing that interference with HDAC function contributes to BI2536/vorinostat anti-leukemic interactions.

Exposure to vorinostat alone (24 hours) induced a marked increase in the G₁ fraction, consistent with previous reports (refs. 32, 33; Supplementary Fig. S4A). BI2536 by itself modestly increased G₂–M accumulation and slightly reduced the G₁ fraction. However, vorinostat/BI2536 co-administration induced pronounced G₂–M accumulation, accompanied by an increase in the sub-diploid (apoptotic) population (Supplementary Fig. S4A). Virtually identical changes were observed in PLK1 shRNA knockdown cells exposed to vorinostat but not in controls (Supplementary Fig. S4B and S4C), raising the possibility that abrogation of HDACI-mediated G₁ arrest and accumulation of cells in G₂–M may be due to enhanced DNA damage may contribute to BI2536/vorinostat lethality.

To assess the in vivo activity of the BI2536 regimen, 2 xenograft models were used. In the first, Beige mice were injected in the flank with 10 × 10⁶ K562 cells; when tumors were first visible (volumes < 150 mm³), animals were treated with BI2536 (30 mg/kg) ± vorinostat (70 mg/kg) for 2 weeks. Alternatively, identical treatment regimens were initiated when tumor volumes exceeded 550 mm³. In the first model, vorinostat alone had little effect whereas BI2536 delayed but did not prevent tumor growth (Fig. 6A). However, combined treatment essentially abrogated tumors, which did not recur during the entire 38-day observation period. In the late-stage model, vorinostat alone had no effect, whereas BI2536 along marginally delayed tumor growth (Fig. 6B). However, combined treatment substantially reduced tumor size over the entire observation period. Western blot analysis of tumor sections obtained after 6 days of treatment (early-stage model) revealed that combined but not single-agent treatment downregulated phospho-BCR/ABL and downstream targets (phospho-STAT5 and -CRKL) while increasing PARP/caspase-3 cleavage and γH2A.X formation (Fig. 6C). Similar results were obtained in day-21 specimens (data not shown). Finally, BI2536 (30 mg/kg) and vorinostat (70 mg/kg) cotreatment significantly increased animal survival compared with no or single-agent treatment in a systemic imatinib-resistant luciferase-labeled BV173/E255K model (P < 0.05; Fig. 6D). Tumor weights for all treatment groups did not decline by more than 10%, and no other signs of toxicity (torpor, weight loss, etc.) were observed (data not shown).

The marked reduction in size of the flank tumors in BI2536/vorinostat-treated animals is shown in at the end of drug treatment (Supplementary Fig. S5A) and 14 days after terminating the treatment (Supplementary Fig. S5B). Finally, combined treatment substantially reduced tumor growth compared with single-agent treatment in a systemic, luciferase-labeled BV173/E255K model system (Supplementary Fig. S5C). Collectively, these findings indicate that combined in vivo treatment with BI2536 and vorinostat induces many of events observed in in vitro studies and that this regimen exhibits pronounced in vivo activity against early- and late-stage leukemia xenograft models.

The present results indicate that HDACIs strikingly increase PLK1 inhibitor (e.g., BI2536) lethality in BCR/ABL⁺ leukemia cells, including those exhibiting marked resistance to imatinib mesylate through gatekeeper or other mutations. Previously, BI2536 showed single-agent activity against such cells and suggested that PLK1 represents an important BCR/ABL downstream target responsible for survival functions (13). Notably, HDACIs have been shown to enhance BCR/ABL kinase inhibitor activity through various mechanisms, including BCR/ABL downregulation due to chaperone function disruption (20, 34) or enhanced BCR/ABL inhibition (35). Here, vorinostat/BI2536 promoted modest inactivation/dephosphorylation of BCR/ABL and its downstream target STAT5 (27). The mechanism underlying HDACI/BI2536-mediated disruption of the BCR/ABL pathway remains to be determined, as does the contribution of BCR/ABL inhibition to lethality. Indeed, preliminary studies in BCR/ABL-negative acute myelogenous leukemia (AML) cells suggest similar PLK1/HDAC inhibitor interactions (Dasmahapatra and Grant, unpublished observations). Such findings argue that BCR/ABL pathway inhibition is unlikely to be the sole mechanism of lethality for this regimen. Finally, vorinostat potentiated BI2536-mediated inhibition of PLK1 phosphorylation at Ser137, which has been implicated in late mitotic progression and the mitotic spindle checkpoint (36), potentially contributing to lethality.

The present results suggest that enhanced HDAC/PLK1 inhibitor lethality involves potentiation of DNA damage. HDACIs induce DNA damage through diverse mechanisms, including downregulation of DNA repair proteins (e.g., RAD51 and MRE11; ref. 17) or acetylation (e.g., Ku70; ref. 37). PLK1 also plays an important role in the mitotic spindle apparatus and DNA damage responses (38), suggesting that enhanced lethality stems from the disabling of the DNA damage and repair response. In support of this concept, combining BI2536 with vorinostat sharply increased expression of the atypical histone γH2A.X, reflecting double-strand DNA breaks (29) and DNA damage checkpoint kinase activation (ATM and ATR). Moreover, BI2536/vorinostat co-exposure produced reductions in the expression of multiple DNA repair proteins, including RAD51, MRE11, ERCC1, MSH2/6, and MLH1, compared with vorinostat alone. The mechanism underlying this phenomenon remains to be determined, but as in the case of BCR/ABL inactivation, may represent secondary, apoptosis-related events. In this context, knockdown of HDACIs (e.g., HDAC3) promotes DNA damage (31), possibly reflecting the contribution of HDACs to DNA repair complexes (39). Consistent with these findings, HDAC1–3 knockdown significantly increased BI2536-mediated DNA damage and lethality. Conversely, ectopic PLK1 expression significantly reduced BI2536/vorinostat-mediated apoptosis, whereas shRNA PLK1 knockdown significantly increased vorinostat-induced cell death, implicating on-target actions in synergistic interactions. Finally, the observation that knockdown of histone 1.2, which links DNA damage to the apoptotic apparatus (28) significantly protected cells, argues for a functional role for DNA damage in lethality.

HDACIs have been shown to kill transformed cells, including leukemia cells, through the induction of ROS (18), and selective induction of oxidative injury in transformed cells may reflect impairment in upregulation of antioxidant proteins (e.g., thioredoxin reductase; ref. 40). On the other hand, a link between PLK1 and oxidative injury has not previously been described. Interestingly, while minimally toxic vorinostat or BI2536 concentrations modestly induced ROS, combined treatment resulted in significant increases as early as 30 minutes after drug exposure which persisted over the ensuing 24 hours. The ability of the antioxidant TBAP to block BI 2536/vorinostat-mediated ROS generation and lethality indicates an important functional role for oxidative injury in synergistic interactions. While ROS generation could stem from DNA damage (41), the observation that TBAP blocked γH2A.X formation and ATM/ATR activation suggests that ROS generation operates upstream of DNA breaks.

In cells sustaining DNA damage, HDACIs perturb the G₁ checkpoint (42, 43), although interference with the intra-S (43) and G₂–M checkpoints (43) has also been described. Here, minimally toxic concentrations of vorinostat induced marked G₀–G₁ arrest, consistent with the ability of this agent to upregulate p21^CIP1 (32). Exposure to BI2536 or PLK1 knockdown produced modest but discernible G₂–M accumulation, reflecting the role of PLK1 in mitotic progression (44). Notably, vorinostat combined with BI2536 or PLK1 knockdown essentially abrogated G₀–G₁ arrest and resulted in a striking accumulation of cells in G₂–M phase. Thus, combining HDAC with PLK1 inhibition may disable the G₁ checkpoint while simultaneously increasing DNA damage, promoting accumulation of cells in G₂–M and subsequently apoptosis.

The combination of BI2536 and vorinostat showed marked inhibition of tumor growth of imatinib mesylate–sensitive or -resistant BCR/ABL⁺ leukemias in both flank and systemic in vivo models and significantly increased survival compared with single agents. Notably, multiple events observed in cells exposed to these agents in vitro (e.g., BCR/ABL and STAT5 dephosphorylation, γH2A.X formation, and PARP cleavage occurred in vivo, suggesting that similar mechanisms may be operative in the latter setting. The relative lack of toxicity of this regimen was consistent with the minimal in vitro effects observed in normal hematopoietic cells (CD34⁺). Transformed cells exhibit impaired DNA damage checkpoints (45) and increased PLK1 expression in leukemia (10) may reflect a compensatory mechanism designed to circumvent otherwise lethal effects of DNA damage. Thus, leukemia cells may be particularly vulnerable to a strategy combining PLK1 inhibition with HDACIs, which promote DNA injury while disrupting checkpoint mechanisms (46). Of note, the BI2536/vorinostat regimen displayed significant activity against large tumors in immunocompromised mice. Such tumors tend to be resistant to both conventional and targeted therapy as a consequence of impaired vasculature, a hypoxic environment, and a low growth fraction (47). The ability of the BI 2536/vorinostat regimen to induce substantial tumor regression in advanced disease argues that resistance resulting from these mechanisms may be circumvented, at least in part, by the current strategy.

HDACIs such as vorinostat are approved for the treatment of cutaneous T-cell lymphoma (CTCL; ref. 48). However, while a role for these agents in CML has not yet been established, recent studies suggest that HDACIs may interact with tyrosine kinase inhibitors to target CML stem cells (49). In light of preclinical evidence of activity of PLK1 inhibitors in CML (13) and early preclinical indications of in vivo activity of such agents in other diseases (e.g., non–Hodgkin lymphoma; ref. 50), the concept of enhancing PLK1 inhibitor activity with HDACIs warrants further attention. Accordingly, studies investigating PLK1/HDAC inhibitor interactions in BCR/ABL-negative hematopoietic malignancies are currently underway.

No potential conflicts of interest were disclosed.

Conception and design: G. Dasmahapatra, S. Grant

Development of methodology: G. Dasmahapatra, S. Grant

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): G. Dasmahapatra, H. Patel, T.K. Nguyen, E. Attkisson, S. Grant

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): G. Dasmahapatra, H. Patel, T.K. Nguyen, S. Grant

Writing, review, and/or revision of the manuscript: G. Dasmahapatra, S. Grant

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): G. Dasmahapatra, T.K. Nguyen, E. Attkisson, S. Grant

Study supervision: G. Dasmahapatra, S. Grant

G. Dasmahapatra, H. Patel, and S. Grant were supported by awards CA63753, CA93738, and CA100866 from the NIH; award R6059-06 from the Leukemia and Lymphoma Society of America, the Multiple Myeloma Research Foundation, Myeloma Spore (P50CA142509), the V Foundation, and Lymphoma SPORE award 1P50 CA130805.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.