Purpose: Currently, there are no approved targeted therapies for the treatment of ovarian cancer, despite the fact that it is the most lethal gynecological malignancy. One proposed target is c-Met, which has been shown to be an important prognostic indicator in a number of malignancies, including ovarian cancer. The objective of this study was to determine whether an orally available multikinase inhibitor of c-Met and vascular endothelial growth factor receptor-2 (foretinib, GSK1363089) blocks ovarian cancer growth.

Experimental Design: The effect of foretinib was tested in a genetic mouse model of endometrioid ovarian cancer, several ovarian cancer cell lines, and an organotypic 3D model of the human omentum.

Results: In the genetic mouse model, treatment with foretinib prevented the progression of primary tumors to invasive adenocarcinoma. Invasion through the basement membrane was completely blocked in treated mice, whereas in control mice, invasive tumors entirely replaced the normal ovary. In 2 xenograft mouse models using human ovarian cancer cell lines, the inhibitor reduced overall tumor burden (86% inhibition, P < 0.0001) and metastasis (67% inhibition, P < 0.0001). The mechanism of inhibition by foretinib involved (a) inhibition of c-Met activation and downstream signaling, (b) reduction of ovarian cancer cell adhesion, (c) a block in migration and invasion, (d) reduced proliferation mediated by a G2–M cell-cycle arrest, and (e) induction of anoikis.

Conclusions: This study shows that foretinib blocks tumorigenesis and reduces invasive tumor growth in different models of ovarian cancer by affecting several critical tumor functions. We believe that it provides a rationale for the further clinical development of foretinib for the treatment of ovarian cancer. Clin Cancer Res; 17(12); 4042–51. ©2011 AACR.

Translational Relevance

Since liposomal doxorubicin in 1999, no new drugs have been approved for the treatment of ovarian cancer. We and others have shown that c-Met is a valuable therapeutic target in ovarian cancer; however, few clinically viable therapeutics exist to inhibit c-Met function. Foretinib is a multikinase inhibitor of c-Met and vascular endothelial growth factor receptor-2 which is undergoing clinical testing in phase II studies for different cancer types. This study reports on preclinical studies aimed at evaluating foretinib's effectiveness in ovarian cancer and understanding its mechanism of action. In a genetic model of ovarian cancer and in 2 ovarian cancer xenograft models, foretinib successfully inhibits tumor growth and metastasis. The inhibitor induces anoikis and blocks many functions important for ovarian cancer metastasis including, c-Met signaling, adhesion, invasion, and proliferation. Based on an understanding of the drug's mechanism and its effectiveness in multiple in vivo models, we believe that foretinib should be considered for clinical trials in ovarian cancer.

Ovarian cancer is the most lethal gynecological malignancy because it is often diagnosed at a late stage, after tumor cells are widely metastasized within the peritoneal cavity. Despite aggressive treatment, which includes surgical cytoreduction followed by combination chemotherapy with paclitaxel and carboplatin, more than two thirds of all patients succumb to the disease (1, 2). Clearly, novel treatments targeting key cancer functions are needed to improve survival of patients with this deadly disease.

Deregulation of the c-Met-HGF/SF (hepatocyte growth factor/scatter factor) signaling axis has been identified as a contributing factor to tumorigenesis and tumor progression in numerous cancers (3). We and others have shown that c-Met is overexpressed in ovarian cancer, and this is associated with an adverse prognosis (4–8). Recently, we showed that blocking c-Met expression, using adenovirus-mediated delivery of a c-Met siRNA, inhibited adhesion, peritoneal dissemination, and tumor growth in ovarian cancer xenografts (7). In addition, inhibition of c-Met using an inhibitor reduced ovarian cancer growth in a xenograft model of ovarian cancer (9). However, using adenoviruses in patients is problematic and xenograft models have a low predictive value for future success in the clinic (10).

Foretinib is an orally available, small molecule inhibitor (11) designed to target the receptor tyrosine kinases c-Met and vascular endothelial growth factor receptor-2 (VEGFR-2) both of which have been implicated in the development, progression, and spread of cancer. Phase II studies published as abstracts in papillary renal cell (12) and gastrointestinal carcinoma (13) indicated that foretinib is well tolerated and exhibits antitumor activity. A recently published phase I study determined the maximally tolerated dose and showed that foretinib inhibited c-Met phosphorylation and decreased proliferation in tumors biopsied after treatment (14, 15). Given the important role of c-Met in epithelial ovarian cancer, the lack of effective treatments for patients with ovarian cancer, and the availability of a multikinase inhibitor already in clinical testing which allows for convenient oral administration, we set out to understand its mechanism(s) of action in ovarian cancer.

Our results show that foretinib is an efficient inhibitor of HGF/SF/c-Met signaling, negatively affecting several key tumor functions: In a genetic mouse model of ovarian cancer, the inhibitor blocked invasion of cancer cells through the basement membrane (BM) and in 2 xenograft mouse models, it reduced tumor burden through inhibition of angiogenesis and induction of apoptosis. Exposure of ovarian cancer cell lines to foretinib in vitro reduced cellular adhesion in a 3D model, reduced cellular proliferation through a G2–M cell-cycle arrest, and induced caspase-dependent anoikis. These data suggest that foretinib should be considered for clinical testing in patients with ovarian cancer.

Reagents

Foretinib and pazopanib were a gift from Dr. T. Gilmer at GlaxoSmithKline (Research Triangle, NC). Anti-phospho-c-Met (Tyr1,230/1,234/1,235 and Tyr1,003) antibody was from BioSource. Total c-Met (C-28) was from Santa Cruz Biotechnology. Antibodies against p44/42 MAPK (mitogen activated protein kinase), phospho-p44/42 MAPK, Akt, phospho-Akt (Ser473), cdc25C, total caspase-3, cleaved caspase-3, actin rabbit antibodies, cyclin B1, p21 Waf1/Cip1, and VEGFR-2 mouse antibodies were obtained from Cell Signaling. Anti-PARP [poly (ADP-ripose) polymerase] mouse monoclonal antibody (mAb) was purchased from BIOMOL. c-Met was inhibited using a mixture of 4 siRNAs with the following target sequences: (i) GAAACUGUAUGCUGGAUGA; (ii) GAACAGAAUCACUGACAUA; (iii) CCAGAGACAUGUAUGAUAA; and (iv) GAAGAUCAGUUUCCUAAUU (siGENOME SMARTPOOL, Dharmacon).

Cells lines

The human ovarian cancer cell lines CaOV3, CaOV-4, SKOV-3, OVCAR-5, and MCF-7 were purchased from American Type Culture Collection (ATCC). OVMZ-6 cells were provided by Dr. V. Mobus (Hospital Frankfurt-Höchst, Germany), and SKOV3ip1 and HEY cells were from Dr. G. Mills (MD Anderson Cancer Center, Houston, TX). Cell lines were authenticated by short tandem repeat (STR) DNA fingerprinting by using the AmpFℓSTR Identifier Kit (Applied Biosystems). The STR profiles were compared with known ATCC fingerprints, the cell line integrated molecular authentication (CLIMA) database, and the MD Anderson fingerprint database.

Proliferation assay and cell-cycle analysis

Cells were treated with foretinib for 24 hours, fixed, and resuspended in propidium iodide (PI)/RNase staining buffer. Cells were analyzed with a fluorescence- activated cell sorting (FACS) Calibur (Becton Dickinson). The percentage of cells in the G2–M and the sub-G0–G1 population (apoptotic cells) was determined by FlowJo software. Control stimulations were performed with leucine-zipper Fas ligand (LzFasL). Proliferation was measured by a fluorescence dye intercalating into DNA (7).

Quantitative real-time PCR for p21

A total of 2 μg of total RNA was reverse transcribed, and quantitative real-time PCR (RT-PCR)was performed by SYBR Green. Primers: p21 forward: AAGACCATGTGGACCTGTCACTGT; p21 reverse: AGGGCTTCCTCTTGGAGAAGATCA.

Western blot

For the detection of cell-cycle proteins, cells were seeded for 24 hours in normal growth media prior to administration of foretinib. For caspase-3, only nonadherent cells (except for the untreated control cells) were collected. Cells were lysed by RIPA buffer and 15 μg lysate separated by SDS-PAGE.

Branching morphogenesis

The assay was done as previously described (16). Briefly, 2,000 cancer cells were seeded in 100 μL of a 1:1 mixture of growth factor–reduced Matrigel and serum-free Dulbecco's modied Eagle's medium. The Matrigel plug was allowed to gel for 30 minutes at 37°C. A total of 100 μL of media supplemented with 40 ng/mL of HGF/SF, 1 μmol/L inhibitor, or vehicle were placed on top.

Trypan blue and Hoechst staining

CaOV3 cells were pretreated for 1 hour with 40 μmol/L of the pan-caspase inhibitor zVAD-fmk followed by 10 μmol/L foretinib or vehicle [dimethyl sulfoxide (DMSO)]. Nonadherent cells were collected and stained with trypan blue or fixed with formaldehyde and stained by using Hoechst 33342 stain.

Measurement of mitochondrial membrane potential (ΔΨm)

CaOV3 cells pretreated with 40 μmol/L of zVAD-fmk for 1 hour prior to stimulation with foretinib (10 μmol/L) were collected and stained with MitoShift dye (Trevigen) and analyzed by flow cytometry (17).

Primary cells, 3D model, adhesion, migration, and invasion assay

Primary human peritoneal mesothelial cells and the 3D omental culture were assembled as described (18). Adhesion, invasion, and migration assays were done as described (19).

Xenograft models

SKOV3ip1 or HeyA8 cells (1 × 106) were injected intraperitoneal (i.p.) into 6-week old female athymic nude mice. Tumors were allowed to initiate growth for 4 or 11 days postinjection for HeyA8 and SKOV3ip1, respectively, and then treatment with the indicated doses of foretinib or the vehicle (1% hydroxypropyl methylcellulose, 0.2% sodium lauryl sulfate) began. Treatment lasted for 16 or 21 days for HeyA8 and SKOV3ip1, respectively, and was given 6 days/week by mouth (p.o.). Mice were sacrificed and tumor burden was analyzed by excision of the tumors to determine total tumor weight and the number of metastasis.

LSL-KrasG12D/+PtenloxP/loxP ovarian cancer mouse model (20, 21)

Tumors were initiated by injection of AdCre virus in the right ovarian bursa. The left ovary was not injected and served as an internal control. Oral treatment with foretinib, administered at 30 mg/kg/day, 6×/week, began 4 weeks after injection of the virus and continued for 3 weeks. Mice were then sacrificed and the primary tumor was excised and embedded in paraffin for staining.

Immunohistochemistry

Slides were stained with H&E, or incubated with antibodies against Ki-67, CD31, and cleaved caspase-3. Detection was done with the Vectastain ABC Kit. Negative controls were prepared by omitting the primary antibody. Staining was evaluated by 2 gynecologic pathologists (Anthony Montag and Thomas Krausz). Stromal invasion was classified according to criteria applied for human cancers as either advanced invasive adenocarcinoma or noninvasive surface hyperplasia.

Statistical analysis

For the xenograft and in vitro experiments, statistical differences between treated and control groups were determined by an unpaired 2-sided Student's t test. For the genetic mouse model, 2-sided Fisher's exact test was used to determine significance between control and treated groups and a 2-sided Wilcoxon–Mann–Whitney test was used to determine statistical difference in cytology.

Foretinib prevents invasion in a genetic mouse model of ovarian cancer

c-Met is expressed in human ovarian tumors (7) and in most ovarian cancer cell lines (Supplementary Fig. S1A). We initially confirmed that foretinib indeed blocks c-Met activation and the canonical downstream c-Met signaling; namely extracellular signal regulated kinase (ERK)/MAPK and phosphoinositide 3-kinase (PI3K)/AKT (Supplementary Fig. S1B). Foretinib also inhibited HGF/SF-induced branching morphogenesis (Supplementary Fig. S1C). Knockdown of c-Met using siRNA mimicked the effect of foretinib on c-Met signaling and branching morphogenesis (Supplementary Fig. S1D and E). Since foretinib is a multikinase c-Met/VEGFR-2 inhibitor (11), we also examined expression of VEGFR-2 but found it to be undetectable in the cell lines used in this study (Supplementary Fig. S1F). Having shown that foretinib inhibits c-Met signaling in vitro, we sought to test whether the compound could affect early tumorigenesis in a genetic mouse model of ovarian cancer. Immunocompetent mice carrying Cre-inducible oncogenic K-ras in combination with deletion of Pten in the ovaries develop invasive endometrioid ovarian cancer about 7 weeks after injection with adeno Cre virus (20). Mice were treated 6 times a week by oral gavage with the inhibitor or vehicle starting 4 weeks after tumor induction. At 7 weeks after induction, 7 of 11 control treated mice had a high-grade invasive adenocarcinoma which completely replaced the normal ovary (Fig. 1A–C). Staining for cytokeratin 19 confirmed the epithelial origin of the tumor cells (Fig. 1C). In contrast, in 9 of 10 mice that received the c-Met inhibitor, the ovarian tumors did not invade through the BM into the normal ovarian stroma (P = 0.027; Fig. 1A–C and Table 1). The treated mice showed noninvasive surface hyperplasia of low nuclear grade (H&E, Ki-67). To determine whether foretinib affected the mouse tumor cells in vitro, we treated a cell line we recently established (21) from an ovarian cancer formed in the LSL-K-rasG12D/+PtenloxP/loxP mice with foretinib. The inhibitor blocked migration and invasion (Fig. 1D) as well as proliferation in soft agar and branching morphogenesis (Supplementary Fig. S2A and B), whereas the VEGFR family inhibitor, pazopanib, had no effect. Finally, treatment of the K-ras/Pten cell line with foretinib induced apoptosis as evidenced by an increase in sub-G0–G1 cells (Supplementary Fig. S2C). Collectively, these data show that treatment with foretinib significantly suppressed early ovarian cancer growth and invasion in a genetic mouse tumor model.

Figure 1.

Treatment with foretinib inhibits progression to an invasive adenocarcinoma in a genetic mouse model of endometrioid ovarian cancer. A, H&E staining of a normal ovary (left), an ovarian tumor from a control mouse (middle), and an ovary from a mouse which received treatment with foretinib (right), magnification 10×. Tumors were initiated by injection of AdCre virus in the right ovarian bursa of LSL-K-rasG12D/+PtenloxP/loxP mice. The left ovary was not injected and served as an internal control. Oral treatment with foretinib was administered 6×/week and began 4 weeks after injection of the virus, continuing for 3 weeks. The primary tumor was excised and stained with H&E (“fo.”, follicle; “Inv. Ca,” invasive cancer; “Hyperplasia,” noninvasive surface hyperplasia; “BM,” basement membrane). The BM is outlined with a dashed line. B, H&E staining showing representative ovarian tumors from 2 control and 2 treated mice. Magnification 100× (inset 200×). The untreated mice showed an invasive cancer transforming the entire ovary, whereas the treated mice showed noninvasive surface hyperplasia but no cancer. C, CK-19 staining detecting epithelial tumor cells and Ki-67 staining to evaluate proliferation, magnification 100×. D, migration and invasion with and without foretinib or pazopanib in K-ras/Pten mouse ovarian cancer cells. (n.s., not significant; ***, P < 0.0001).

Figure 1.

Treatment with foretinib inhibits progression to an invasive adenocarcinoma in a genetic mouse model of endometrioid ovarian cancer. A, H&E staining of a normal ovary (left), an ovarian tumor from a control mouse (middle), and an ovary from a mouse which received treatment with foretinib (right), magnification 10×. Tumors were initiated by injection of AdCre virus in the right ovarian bursa of LSL-K-rasG12D/+PtenloxP/loxP mice. The left ovary was not injected and served as an internal control. Oral treatment with foretinib was administered 6×/week and began 4 weeks after injection of the virus, continuing for 3 weeks. The primary tumor was excised and stained with H&E (“fo.”, follicle; “Inv. Ca,” invasive cancer; “Hyperplasia,” noninvasive surface hyperplasia; “BM,” basement membrane). The BM is outlined with a dashed line. B, H&E staining showing representative ovarian tumors from 2 control and 2 treated mice. Magnification 100× (inset 200×). The untreated mice showed an invasive cancer transforming the entire ovary, whereas the treated mice showed noninvasive surface hyperplasia but no cancer. C, CK-19 staining detecting epithelial tumor cells and Ki-67 staining to evaluate proliferation, magnification 100×. D, migration and invasion with and without foretinib or pazopanib in K-ras/Pten mouse ovarian cancer cells. (n.s., not significant; ***, P < 0.0001).

Close modal
Table 1.

Results of foretinib administration in the LSL-K-rasG12D/+PtenloxP/loxP mouse model of endometrioid ovarian cancer

ControlForetinibP value
Invasive adenocarcinoma 7/11 1/10  0.027 
Noninvasive surface hyperplasia 4/11 9/10  
Grade (Tumor cytology) Low 4/11, High 7/11 Low 9/10, High 1/10  0.038 
ControlForetinibP value
Invasive adenocarcinoma 7/11 1/10  0.027 
Noninvasive surface hyperplasia 4/11 9/10  
Grade (Tumor cytology) Low 4/11, High 7/11 Low 9/10, High 1/10  0.038 

NOTE: Results of foretinib treatment in the LSL-K-rasG12D/+PtenloxP/loxP mouse model of endometrioid ovarian cancer. Control or foretinib treated tumors were categorized as either invasive adenocarcinoma or noninvasive surface hyperplasia. Tumor cell cytology was classified as either high or low grade. For tumor classification, significance was determined by a 2-sided Fisher's exact test. For tumor cell cytology, significance was determined by a 2-sided Wilcoxon–Mann–Whitney test. A P < 0.05 value was considered significant.

Foretinib reduces tumor burden in a xenograft model of metastatic ovarian cancer

To study the in vivo efficacy of foretinib in an additional model, female athymic nude mice with established i.p. SKOV3ip1 tumors received either the inhibitor orally or vehicle alone. Foretinib reduced the number of metastatic tumor nodules (30 mg/kg: 67% inhibition, P < 0.0001) and tumor weight (30 mg/kg: 86% inhibition, P < 0.0001) in a dose-dependent fashion (Fig. 2A). Similar effects were also seen in a second xenograft model by HeyA8 cells in reduction of tumor weight (71% inhibition, P < 0.0001; Fig. 2B). Western analysis on tumors extracted from several mice showed reduced c-Met phosphorylation upon treatment with foretinib (Supplementary Fig. S3A). Treated tumors consistently revealed significant areas of necrosis, impaired angiogenesis with a significant reduction (P < 0.005) in CD31-positive endothelial cells, a reduced proliferation rate (Ki-67 staining), and an increase in caspase-3 a marker of tumor cell apoptosis (Fig. 2C).

Figure 2.

Inhibition of tumor growth and metastasis in an ovarian cancer xenograft models. A, mice injected i.p. with SKOV3ip1 cells underwent treatment 11 days postinjection with vehicle (control) or the indicated doses of foretinib p.o. 6 days/week for 21 days. The number of metastases and tumor weight were measured. Bar indicates the average for each group (n.s., not significant; *, P < 0.05; **, P < 0.005; ***, P < 0.0001). B, overall tumor weight of mice with HeyA8 i.p. tumors treated with either vehicle or 30 mg/kg foretinib. HeyA8 cells were injected i.p. and underwent treatment 4 days postinjection with vehicle (control) or foretinib p.o. 6 days/week for 16 days. The tumor weight was measured. Bar indicates average for each group (***, P < 0.0001). C, immunohistochemistry of treated and control SKOV3ip1 tumors. H&E, CD31, Ki-67, active caspase-3, and negative control (upper). Magnification 200×, scale bar 100 μmol/L (‡, necrosis; **, P < 0.005). Quantification of staining (below). D, adhesion assay to a 3D omental culture (schematic, left). Fluorescently labeled SKOV3ip1 cells were pretreated with foretinib (10 μmol/L) and plated on the 3D culture. After 2 hours, the number of adherent cells was quantified by measuring fluorescence intensity. The experiment was repeated 3 times with different preparations of primary cells (***, P < 0.001).

Figure 2.

Inhibition of tumor growth and metastasis in an ovarian cancer xenograft models. A, mice injected i.p. with SKOV3ip1 cells underwent treatment 11 days postinjection with vehicle (control) or the indicated doses of foretinib p.o. 6 days/week for 21 days. The number of metastases and tumor weight were measured. Bar indicates the average for each group (n.s., not significant; *, P < 0.05; **, P < 0.005; ***, P < 0.0001). B, overall tumor weight of mice with HeyA8 i.p. tumors treated with either vehicle or 30 mg/kg foretinib. HeyA8 cells were injected i.p. and underwent treatment 4 days postinjection with vehicle (control) or foretinib p.o. 6 days/week for 16 days. The tumor weight was measured. Bar indicates average for each group (***, P < 0.0001). C, immunohistochemistry of treated and control SKOV3ip1 tumors. H&E, CD31, Ki-67, active caspase-3, and negative control (upper). Magnification 200×, scale bar 100 μmol/L (‡, necrosis; **, P < 0.005). Quantification of staining (below). D, adhesion assay to a 3D omental culture (schematic, left). Fluorescently labeled SKOV3ip1 cells were pretreated with foretinib (10 μmol/L) and plated on the 3D culture. After 2 hours, the number of adherent cells was quantified by measuring fluorescence intensity. The experiment was repeated 3 times with different preparations of primary cells (***, P < 0.001).

Close modal

To study the early steps (adhesion/invasion) of tumor cell metastasis to the peritoneum/omentum (2,19), we recently established a 3D culture model assembled from primary human mesothelial cells and fibroblasts extracted from human omentum (ref. 18; Fig. 2D). Treatment with foretinib significantly abrogated SKOV3ip1 attachment to the 3D culture (Fig. 2D) and adhesion to various ECMs or primary human mesothelial (Supplementary Fig. S3B). Similarly to the mouse K-ras/Pten cell line, addition of foretinib to SKOV3ip1 cells (Supplementary Fig. S3C) nearly completely blocked migration and invasion, whereas pazopanib had no significant effect, suggesting that it is the inhibition of c-Met, not of VEGFR-2, which is mediating these effects.

Foretinib inhibits cell proliferation via a G2–M cell-cycle arrest

Because we observed a profound reduction proliferation in foretinib tumors treated and impaired in vitro proliferation (Supplementary Fig. S4A), we asked whether foretinib inhibits cell-cycle progression or affects apoptosis. In both SKOV3ip1 and CaOV3 cells, foretinib profoundly increased the percentage of cells in the G2–M phase (Fig. 3A) while decreasing the percentage of cells in the G0–G1 phase. Moreover, in CaOV3 cells, a significant number of cells underwent cell death, as indicated by the appearance of sub-G0–G1 cells (Fig. 3A, see #, Supplementary Table S1). A similar decrease in the number of cells in the G1 and S phase was observed with both cell lines (Supplementary Table S1), indicating that treatment with foretinib leads to a G2–M cell-cycle arrest. Next, we studied the effect of foretinib on the expression of proteins that regulate the G2–M transition. Cdc25C is a phosphatase which functions in the nucleus to drive cell-cycle progression by activating the Cdc2-cyclin B mitotic kinase complex, thereby permitting cell entry into mitosis (22). In SKOV3ip1 and CaOV3 cells, foretinib treatment resulted in a decrease of both Cdc25C and cyclin B1 protein expression over time (Fig. 3B). Both mRNA and protein expression of the G2–M checkpoint regulator p21 (23, 24) was significantly increased (Fig. 3C) following inhibitor treatment, whereas a p53 luciferase reporter construct transfected into SKOV3ip1 cells was not induced by foretinib, suggesting p53-independent transcriptional regulation of p21 (Supplementary Fig. S4B). These data show that foretinib inhibits the proliferation of ovarian cancer cells through a G2–M cell-cycle arrest.

Figure 3.

Foretinib inhibits ovarian cancer proliferation mediated by G2–M arrest. A, flow cytometric analysis of PI staining of cancer cells after 48 hours in the presence of DMSO vehicle (control, left) or foretinib 10 μmol/L (right). Percentage of cells in G2–M phase is shown. # indicates sub-G0–G1 phase. B, immunoblotting of G2–M cell-cycle regulators in SKOV3ip1 (left) and CaOV3 cells (right). Cells were treated with DMSO, 1 or 10 μmol/L of foretinib for 24 and 48 hours and membranes probed for Cdc25C and cyclin B1. C, expression of p21. SKOV3ip1 cells were treated with 10 μmol/L foretinib or solvent control. Western blot (top) on lysates for p21. Quantitative RT-PCR (bottom) of p21 transcript. Mock is DMSO treatment. A total of 1 μmol/L nocodazole was used as a positive control (***, P < 0.001).

Figure 3.

Foretinib inhibits ovarian cancer proliferation mediated by G2–M arrest. A, flow cytometric analysis of PI staining of cancer cells after 48 hours in the presence of DMSO vehicle (control, left) or foretinib 10 μmol/L (right). Percentage of cells in G2–M phase is shown. # indicates sub-G0–G1 phase. B, immunoblotting of G2–M cell-cycle regulators in SKOV3ip1 (left) and CaOV3 cells (right). Cells were treated with DMSO, 1 or 10 μmol/L of foretinib for 24 and 48 hours and membranes probed for Cdc25C and cyclin B1. C, expression of p21. SKOV3ip1 cells were treated with 10 μmol/L foretinib or solvent control. Western blot (top) on lysates for p21. Quantitative RT-PCR (bottom) of p21 transcript. Mock is DMSO treatment. A total of 1 μmol/L nocodazole was used as a positive control (***, P < 0.001).

Close modal

Foretinib induces cell death in a 2-stage process

The increase of cleaved caspase-3 in foretinib-treated xenograft tumors (Fig. 2C) and the increase in cells in the sub-G1 phase (Fig. 3A, Supplementary Table S1) suggest that foretinib induces apoptosis. This was confirmed by detecting increased PARP cleavage upon treatment with foretinib in 2 cell lines (Fig. 4A). To determine whether the apoptosis was caspase-dependent, CaOV3 cells were pretreated for 1 hour with the oligo-caspase inhibitor, zVAD-fmk, followed by treatment with the inhibitor. Foretinib induced a time-dependent increase in apoptotic cells, as evidenced by cells containing sub-G1 nuclei (Fig. 4A). The caspase inhibitor substantially inhibited apoptosis induced by foretinib. Interestingly, we noted that CaOV3 cells began to round up and detach as early as 8 hours after the addition of foretinib (data not shown), when apoptosis was not detectable. The detachment of cells induced by foretinib could not be inhibited by zVAD-fmk, indicating that this process is caspase-independent. One of the earliest events in the apoptosis pathway (17) is the collapse of the mitochondrial transmembrane potential (ΔΨm). Twelve hours after addition of foretinib, only a small number of cells lost their ΔΨm, as determined by staining with Mito Tracker, but this number increased significantly 24 hours after treatment. The loss of ΔΨm could be blocked by zVAD-fmk, showing that it is caspase-dependent (Fig. 4B).

Figure 4.

Foretinib induces ovarian cancer cell detachment and causes cell death. A, cells were pretreated with DMSO control or 40 μmol/L zVAD-fmk for 1 hour and incubated with 10 μmol/L foretinib or with 100 ng/mL LzFasL. Attached and detached cells were pooled and analyzed for DNA fragmentation. Western blot analysis (inset) of PARP and β-actin of lysates obtained from cells treated with 10 μmol/L foretinib (F) for 48 hours. B, CaOV3 cells were pretreated with DMSO or 40 μmol/L zVAD-fmk and incubated with 10 μmol/L foretinib (F). Both adherent and detached cells were pooled and stained with MitoShift to determine loss of mitochondrial transmembrane potential (ΔΨm). C, CaOV3 cells were treated with 10 μmol/L foretinib and the attached or detached cells were stained with MitoShift to quantify the loss of ΔΨm.

Figure 4.

Foretinib induces ovarian cancer cell detachment and causes cell death. A, cells were pretreated with DMSO control or 40 μmol/L zVAD-fmk for 1 hour and incubated with 10 μmol/L foretinib or with 100 ng/mL LzFasL. Attached and detached cells were pooled and analyzed for DNA fragmentation. Western blot analysis (inset) of PARP and β-actin of lysates obtained from cells treated with 10 μmol/L foretinib (F) for 48 hours. B, CaOV3 cells were pretreated with DMSO or 40 μmol/L zVAD-fmk and incubated with 10 μmol/L foretinib (F). Both adherent and detached cells were pooled and stained with MitoShift to determine loss of mitochondrial transmembrane potential (ΔΨm). C, CaOV3 cells were treated with 10 μmol/L foretinib and the attached or detached cells were stained with MitoShift to quantify the loss of ΔΨm.

Close modal

These data imply that soon after foretinib administration, cells detach and only secondarily undergo caspase-mediated apoptosis. To test this hypothesis, we determined the ΔΨm in the attached and detached cells after treatment with foretinib (Fig. 4C). Sixteen hours after addition of foretinib, the number of attached cells with reduced ΔΨm had not decreased, suggesting that cell detachment is not the result of apoptosis. Although most detached cells had reduced ΔΨm, about a third of the cells still had intact mitochondrial membrane potential. This number decreased more than the next 8 hours, indicating that it is the detached cells that undergo apoptosis. Consistently, the detached cells showed signs of nuclear fragmentation (Fig. 5A) and a low level of activation of caspase-3 (Fig. 5B) both of which could be blocked by zVAD-fmk. To determine the order of events, we quantified the number of dead and alive detached cells at different times after addition of foretinib (Fig. 5C). Eight hours after the addition of foretinib, about half of the detached cells were dead, a number that was not reduced by treatment with zVAD-fmk. More than the next 40 hours, the number of dead cells increased. This increase could be inhibited by zVAD-fmk, indicating that it was caused by a caspase-dependent process. On the basis of this data, we conclude that foretinib induces cell death of ovarian cancer cells through a 2-step mechanism; cells first detach and then subsequently undergo caspase-dependent apoptosis, similar to the process of anoikis (suspension-induced apoptosis).

Figure 5.

Foretinib induces anoikis through a 2-step process. A, Hoechst 33342 staining of detached cells. CaOV3 cells were pretreated with DMSO or 40 μmol/L zVAD-fmk for 1 hour and incubated with 10 μmol/L foretinib for 48 hours. B, detached CaOV3 cells were collected and lysates immunoblotted with total caspase-3 mAb. C, detached CaOV3 cells were collected, stained with Trypan blue, and counted for viability.

Figure 5.

Foretinib induces anoikis through a 2-step process. A, Hoechst 33342 staining of detached cells. CaOV3 cells were pretreated with DMSO or 40 μmol/L zVAD-fmk for 1 hour and incubated with 10 μmol/L foretinib for 48 hours. B, detached CaOV3 cells were collected and lysates immunoblotted with total caspase-3 mAb. C, detached CaOV3 cells were collected, stained with Trypan blue, and counted for viability.

Close modal

This study reports on the efficacy and mechanism of action of the small-molecule multikinase inhibitor foretinib in preclinical models of ovarian cancer metastasis. Our data suggest 4 principal mechanisms for how foretinib inhibits ovarian cancer growth and metastasis. In ovarian cancer cell lines, the inhibitor: (i) blocked activation of c-Met signaling; (ii) reduced proliferation mediated by a G2–M cell-cycle arrest; (iii) induced cell death through a 2-step mechanism in which cells detach followed by a caspase-dependent form of anoikis; and (iv) reduced proliferation, adhesion, migration, and invasion during early tumor development. In mouse models of ovarian cancer metastasis, foretinib reduced tumor burden and metastasis mediated by reduced angiogenesis, proliferation, and increased apoptosis. The multiple activities of foretinib are consistent with the numerous effects that have been attributed to c-Met and angiogenesis in the context of cancer (3).

Foretinib targets c-Met and VEGFR-2 with the highest affinity but also inhibits platelet-dervied growth factor-β (PDGFRβ), Tie-2, RON, c-Kit, and FLT3 kinases in vitro although with lower affinity (11). In this study, we used 3 ovarian cancer cell lines which do not express VEGFR-2. Treatment with the antiangiogenic inhibitor pazopanib, which targets the VEGFR family (−1, −2, and −3) along with PDGFR-α/β and c-Kit, did not inhibit migration and invasion at a dose more than 300-fold greater than the reported IC50 (inhibitory concentration; ref. 25). Therefore, the in vitro effects observed with foretinib treatment are less likely to be due to the inhibition of VEGFR-2. Nonetheless, a potent reduction in microvessel density was seen in tumors from treated mice when compared with those of control mice and was probably mediated by inhibition of VEGFR-2 on mouse endothelial cells. Many studies have shown the important role of angiogenesis in ovarian cancer and there are currently several agents (bevacizumab, sunitinib, and sorafenib) in late phase clinical testing (26, 27). Given the very efficient inhibition of c-Met–mediated function(s), additional inhibition of angiogenesis would likely only add to foretinib's antitumor efficiency and relevance for ovarian cancer treatment.

Our data suggest that anoikis induction contributes to the potent antitumor effects of the inhibitor. Characterization of the cell death observed in vitro revealed that the cells first detach from the extracellular matrix and then undergo anoikis. Consistent with a mechanism of anoikis, cell death occurred in 2 distinct stages; detachment followed by caspase-mediated apoptosis. Furthermore, inhibition of caspase activation with zVAD-fmk did not prevent cell detachment but blocked apoptosis. Upon adhesion to extracellular matrices, tumor cells activate HGF/SF c-Met signaling (28, 29). We recently showed that knockdown of c-Met via siRNA inhibits adhesion to various ECMs (7), suggesting that inhibition of c-Met will affect tumor cell survival. Consistent with our findings, the activation of c-Met signaling has been shown to play a role in cell survival by conferring resistance to anoikis through coordinate activation of ERK/MAPK and PI3K/AKT pathways (30, 31). Even with inhibition of c-Met signaling, it is probable that cancer cells are capable of activating these signaling pathways via alternate mechanisms that will ultimately lead to resistance against the c-Met inhibitor. It would be of interest to determine whether combining a c-Met inhibitor with a PI3K pathway inhibitor would be more effective in inducing cell death than the c-Met inhibitor alone.

One of the mechanisms identified for the inhibition of metastasis by foretinib is through the induction of a G2–M cell-cycle arrest. In eukaryotic cells, entry into mitosis is controlled by the activation of the cyclin B/Cdc2 protein kinase, resulting in the degradation of cyclin B. The cyclin B/Cdc2 complex is activated by dephosphorylation of key residues by the Cdc25 family of phosphatases. We have shown by FACS analysis that treatment with foretinib leads to the accumulation of cells in G2–M phase and to the downregulation of both cyclin B1 and Cdc25C expression. In addition, protein and mRNA expression of the cyclin-dependent kinase inhibitor, p21, was upregulated after exposure to foretinib, providing an explanation for the observed cell-cycle inhibition. Our results are supported by the recently published results of a phase I study on foretinib which reported decreased Ki-67 staining and increased terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling staining in patient biopsies (14).

The results of the in vitro and xenograft experiments show that foretinib inhibits ovarian cancer growth in multiple ways, suggesting that several key ovarian cancer functions may be targeted by the compound. However, these experiments cannot substitute for one involving immunocompetent mice with relevant genetic lesions. In the K-ras/Pten genetic mouse model (20, 21), endometrioid ovarian cancer develops at correct anatomical locations (primary cancer in the ovary, metastases in the peritoneum) with nonclonal diverse tumors, mimicking the presentation of ovarian cancer in patients. Although this genetic model produces endometrioid ovarian cancer rather than the more common serous papillary subtype, both subtypes are reported to have high c-Met overexpression at relatively equal frequency (32). Our data show, for the first time, the efficacy of a small-molecule inhibitor in preventing ovarian cancer progression in a genetic mouse tumor model. Foretinib almost completely prevented cancer cells from breaking through the basement membrane raising the intriguing possibility that c-Met inhibition might be further developed for cancer prevention.

Because ovarian cancer is rare, the opportunity to test new compounds in clinical trials is limited. Preclinical testing of a compound in several in vitro (cell lines and 3D models) and in vivo models (genetic mouse models and xenograft) as well as understanding its mechanism of action might help to evaluate preclinically whether a compound should be further developed for clinical testing. We believe that the preclinical results presented here suggest that foretinib may be particularly effective for the treatment of patients with advanced ovarian cancer.

Glaxo Smith Kline (GSK) provided the drug and funding for the xenograft experiments (Fig. 2). GSK did not interfere with the planning, execution, interpretation of the results, or with the composition of the manuscript.

We greatly appreciate Gail Isenberg for editing the manuscript. The leucine-zipper Fas ligand was provided by Dr. H. Walczak.

This work was supported by the Ovarian Cancer Research Fund (Liz Tilberis Scholars Program) and NIH grant R01 CA111882 (to E. Lengyel).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Cannistra
SA
. 
Cancer of the ovary
.
N Engl J Med
2004
;
351
:
2519
29
.
2.
Lengyel
E
. 
Ovarian cancer development and metastasis
.
Am J Pathol
2010
;
177
:
1053
64
.
3.
Birchmeier
C
,
Birchmeier
W
,
Gherardi
E
,
Woude
GFV
. 
Met, metastasis, motility and more
.
Nat Rev Mol Cell Biol
2003
;
4
:
915
25
.
4.
Koon
EC
,
Ma
PC
,
Salgia
R
,
Welch
WR
,
Christensen
JG
,
Berkowitz
RS
, et al
Effect of a c-Met specific, ATP-competitive small-molecule inhibitor SU11274 on human ovarian carcinoma cell growth, motility, and invasion
.
Int J Gynecol Cancer
2007
;
18
:
841
9
.
5.
Di Renzo
MF
,
Olivero
M
,
Katsaros
D
,
Crepaldi
T
,
Gaglia
P
,
Zola
P
, et al
Overexpression of the MET/HGF receptor in ovarian cancer
.
Int J Cancer
1994
;
58
:
658
62
.
6.
Huntsman
D
,
Resau
JH
,
Klineberg
E
,
Auersperg
N
. 
Comparison of c-met expression in ovarian epithelial tumors and normal epithelia of the female reproductive tract by quantitative laser scan microscopy
.
Am J Pathol
1999
;
155
:
343
8
.
7.
Sawada
K
,
Radjabi
AR
,
Shinomiya
N
,
Kistner
E
,
Kenny
HA
,
Salgia
R
, et al
C-Met overexpression is a prognostic factor in ovarian cancer and an effective target for inhibition of peritoneal dissemination and invasion
.
Cancer Res
2007
;
67
:
1670
80
.
8.
Shinomiya
N
,
Gao
C
,
Xie
Q
,
Gustafson
M
,
Waters
D
,
Zhang
Y
, et al
RNA interference reveals that ligand-independent Met activity is required for tumor cell signaling and survival
.
Cancer Res
2004
;
64
:
7962
70
.
9.
Zillhardt
M
,
Christensen
J
,
Lengyel
E
. 
An orally available small molecule inhibitor of c-Met, PF-2341066, reduces tumor burden in a pre-clinical model of ovarian cancer metastasis
.
Neoplasia
2010
;
12
:
1
10
.
10.
Voskoglou-Nomikos
T
,
Pater
JL
,
Seymour
L
. 
Clinical predicitive value of the in vitro cell line, human xenograft, and mouse allograft preclinical cancer models
.
Clin Cancer Res
2003
;
9
:
4227
39
.
11.
Qian
F
,
Engst
S
,
Yamaguchi
K
,
Yu
P
,
Won
K
,
Mock
L
, et al
Inhibition of tumor cell growth, invasion, and metastasis by EXEL-2880 (XL880, GSK 1363089), a novel inhibitor of HGF and VEGF receptor tyrosine kinases
.
Cancer Res
2009
;
69
:
8009
16
.
12.
Srinivasan
R
,
Linehan
WM
,
Vaishampayan
U
,
Logan
T
,
Shankar
SM
,
Sherman
LJ
, et al
A phase II study of two dosing regimens of GSK 1363089 (GSK089), a dual MET/VEGFR2 inhibitor, in patients (pts) with papillary renal carcinoma (PRC) [Abstract]
.
J Clin Oncol
2009
;
27
:
Suppl 5103.
13.
Jhawer
M
,
Kindler
HL
,
Wainberg
Z
,
Ford
J
,
Kunz
P
,
Tang
L
, et al
Assessment of two dosing schedules of GSK1363089 (GSK089), a dual MET/VEGFR2 inhibitor, in metastatic gastric cancer (GC): interim results of a multicenter phase II study [Abstract]
.
J Clin Oncol
2009
;
27
:
Suppl 4502
.
14.
Eder
JP
,
Shapiro
GI
,
Appleman
LJ
,
Zhu
AX
,
Miles
D
,
Keer
H
, et al
A phase I study of foretinib, a multi-targeted inhibitor of c-Met and vascular endothelial growth factor receptor 2
.
Clin Cancer Res
2010
;
16
:
3507
16
.
15.
Olive
KP
,
Jacobetz
MA
,
Davidson
CJ
,
Gopinathan
A
,
McIntyre
D
,
Honess
D
, et al
Inhibition of hedgehog signaling enhances delivery of chemotherapy in a mouse model of pancreatic cancer
.
Science
2009
;
324
:
1457
61
.
16.
Jeffers
M
,
Rong
S
,
Woude
GFV
. 
Enhanced tumorigenicity and invasion-metastasis by hepatocyte growth factor/scatter factor-met signalling in human cells concomitant with induction of the urokinase proteolysis network
.
Mol Cell Biol
1996
;
16
:
1115
25
.
17.
Kroemer
G
. 
Mitochondrial control of apoptosis: an overview
.
Biochem Soc Symp
1999
;
66
:
1
15
.
18.
Kenny
HA
,
Krausz
T
,
Yamada
SD
,
Lengyel
E
. 
Use of a novel 3D culture model to elucidate the role of mesothelial cells, fibroblasts and extra-cellular matrices on adhesion and invasion of ovarian cancer cells
.
Int J Cancer
2007
;
121
:
1463
72
.
19.
Kenny
HA
,
Kaur
S
,
Coussens
L
,
Lengyel
E
. 
The initial steps of ovarian cancer cell metastasis are mediated by MMP-2 cleavage of vitronectin and fibronectin
.
J Clin Invest
2008
;
118
:
1367
79
.
20.
Dinulescu
D
,
Ince
T
,
Quade
B
,
Shafer
S
,
Crowley
D
,
Jacks
T
. 
Role of K-ras and PTEN in the development of mouse models of endometriosis and endometrioid ovarin cancer
.
Nature Med
2005
;
11
:
63
70
.
21.
Romero
I
,
Gordon
I
,
Jagadeeswaran
S
,
Mui
KL
,
Lee
WS
,
Dinulescu
D
, et al
Effects of oral contraceptives or a gonadotropin-releasing hormone agonist on ovarian carcinogenesis in genetically engineered mice
.
Cancer Prev Res
2009
;
2
:
792
9
.
22.
Boutros
R
,
Lobjois
V
,
Ducommun
B
. 
CDC25 phosphatases in cancer cells: key players? Good targets?
Nat Rev Cancer
2007
;
7
:
495
507
.
23.
Taylor
WR
,
Stark
GR
. 
Regulation of the G2/M transition by p53
.
Oncogene
2001
;
20
:
1803
15
.
24.
Abbas
T
,
Dutta
A
. 
P21 in cancer: intricate networks and multiple activities
.
Nat Rev Cancer
2009
;
9
:
400
14
.
25.
Podar
K
,
Tonon
G
,
Sattler
M
,
Tai
Y
,
LeGouill
S
,
Yasui
H
, et al
The small-molecule VEGF receptor inhibitor pazopanib (GW786034B) targets both tumor and endothelial cells in multiple myeloma
.
Proc Natl Acad Sci U S A
2006
;
103
:
19478
83
.
26.
Spannuth
WA
,
Sood
AK
,
Coleman
RL
. 
Angiogenesis as a strategic target for ovarian cancer therapy
.
Nat Clin Prac Oncol
2008
;
5
:
194
204
.
27.
Yap
TA
,
Carden
CP
,
Kaye
SB
. 
Beyond chemotherapy: targeted therapies in ovarian cancer
.
Nat Rev Cancer
2009
;
9
:
167
81
.
28.
Hov
H
,
Holt
RU
,
Ro
TB
,
Fagerli
U-M
,
Hjorth-Hansen
H
,
Baykov
V
, et al
A selective c-Met inhibitor blocks an autocrine hepatocyte growth factor loop in ANBL-6 cells and prevents migration and adhesion of myeloma cells
.
Clin Cancer Res
2009
;
10
:
6686
94
.
29.
Beviglia
L
,
Matsumoto
K
,
Lin
C-S
,
Ziober
BL
,
Kramer
RH
. 
Expression of the c-Met/HGF receptor in human breast carcinoma: correlation with tumor progression
.
Int J Cancer
1997
;
74
:
301
9
.
30.
Tang
M
,
Zhou
HY
,
Yam
JW
,
Wong
AST
. 
c-Met overexpression contributes to the acquired apoptotic resistance of nonadherent ovarian cancer cells through a cross talk mediated by phosphatidylinositol 3-kinase and extracellular signal-regulated kinase 1/2
.
Neoplasia
2010
;
12
:
128
38
.
31.
Wang
R
,
Kobayashi
R
,
Bishop
JM
. 
Cellular adherence elicits ligand-independent activation of the Met cell-surface receptor
. 
Proc Natl Acad Sci U S A
1996
;
93
:
8425
30
.
32.
Knudsen
BS
,
Zhao
P
,
Resau
JH
,
Cottingham
S
,
Gherardi
E
,
Xu
E
, et al
A novel multipurpose monoclonal antibody for evaluating human c-Met expression in pre-clinical and clinical settings
.
Appl Immunohistochem Mol Morphol
2009
;
17
:
57
67
.