Purpose: This study was to investigate the clinicopathologic significance and potential role of HOXB7 in the development and progression of colorectal cancer (CRC).

Experimental Design: The relationship between HOXB7 expression and clinical characteristics of CRC was analyzed in 224 paraffin-embedded archived CRC specimens by immunohistochemistry (IHC). The effects of HOXB7 on cell growth and proliferation, as well as on tumorigenesis, were examined both in vitro and in vivo, using MTT assay, colony formation assay, cell cycle analysis, soft agar assay, and tumorigenesis in nude mice. Western blotting and real-time reverse transcriptase-PCR were performed to examine the impact of HOXB7 on the PI3K/Akt and MAPK signaling pathways.

Results: HOXB7 protein level was significantly correlated with advanced Dukes stage (P < 0.001), T stage (P = 0.012), distant metastasis (P = 0.042), higher proliferation index (P = 0.007) and poor survival of patients (P = 0.005). Enforced expression of HOXB7 in CRC cell lines significantly enhanced cell growth, proliferation and tumorigenesis. Conversely, knockdown of HOXB7 caused an inhibition of cell growth, proliferation, and tumorigenesis. We also showed that HOXB7 accelerated G0–G1 to S-phase transition concomitantly with upregulation of cyclin D1 and downregulation of p27Kip1. On the contrary, knockdown of HOXB7 caused G1–S-phase arrest, downregulation of cyclin D1 and upregulation of p27Kip1. Enforced expression of HOXB7 could enhance PI3K/AKT and MAPK pathway activity.

Conclusion: Our findings suggest that HOXB7 protein, as a valuable marker of CRC prognosis, plays an important role in the development and progression of human CRC. Clin Cancer Res; 17(11); 3569–78. ©2011 AACR.

Translational Relevance

HOXB7 is a transcriptional factor that regulates the expression of multiple genes involved in cell growth, viability and tissue-specific differentiation. Amplification or overexpression of HOXB7 is closely associated with transformation, proliferation, and survival of tumor cells. However, the biological functions of HOXB7 in the control of colorectal tumorigenesis and tumor progression are largely unknown. This study revealed that expression of HOXB7 was significantly correlated with the invasive and aggressive characteristics of human CRC and poor survival of patients as well. We also revealed that HOXB7 overexpression promoted proliferation and tumorigenic growth of human CRC cells, both in vitro and in vivo. The effect of HOXB7 on proliferation and tumorigenic growth of human CRC may result from the upregulation of cyclinD1 and the downregulation of p27Kip1 via activation of MAPK and PI3K-Akt signaling pathways. Our findings suggest that HOXB7 protein, as a valuable marker of CRC prognosis, plays an important role in the development and progression of human CRC.

Colorectal cancer (CRC) is one of the most common malignancies worldwide. Colorectal carcinogenesis is a multistep process involving progressive disruption of epithelial-cell proliferation, apoptosis, differentiation, and survival mechanisms (1–2). About half of the individuals with locally advanced CRC can be cured by surgery and multimodal treatment. Because traditional methods do not allow precise prediction of prognosis for the patients after surgical removal of the primary tumor, there is an acute need for biomarkers capable of distinguishing patients with poor or good prognosis (3).

The homeobox genes encode a family of transcriptional factors, which are essential for morphogenesis and differentiation (4, 5). Homeobox genes are categorized into 2 large groups. Homeobox genes of class I, also called HOX genes, contain at least 39 members that are organized in 4 clusters (A, B, C, and D) located on chromosomes 7, 17, 2, and 12, respectively (6). Homeobox genes of class II, known as divergent homeobox genes (non-HOX), are scattered on different chromosomes (6). Homeobox genes of both classes play key roles in development and carcinogenesis in gastrointestinal tract (7, 8). For instance, Cdx1 and Cdx2, 2 divergent Homeobox genes, are normally expressed in the gut during development and adulthood. However, expressions of Cdx1 and Cdx2 are often lost in CRC cell lines and tissues (9). Downregulation of Cdx1 or Cdx2 expression can promote tumor development and invasiveness, whereas overexpression of Cdx2 in CRC cell lines can inhibit cell growth and tumorigenesis (10–12). On the contrary, HOXB6, B8, C8, and C9 transcripts were upregulated at various stages of CRC (13). Other researchers found that expressions of HOXA9, HOXB7, and HOXD11 were altered in primary colon cancers and their hepatic metastases (14). In short, these findings suggest an association between deregulation of HOX gene expression and CRC progression.

It has been well documented that HOXB7, a member of class I homeobox, plays an important role in tumorigenesis. First, deregulation of HOXB7 was observed in several kinds of tumors (15–19). Overexpression of HOXB7 was closely associated with poor prognosis of breast cancer and oral cancer patients (18, 20). Second, HOXB7 facilitated transforming ability in NIH3T3 fibroblasts and in immortalized breast epithelial cells MCF10A (21, 22). Enforced HOXB7 promoted invasion, metastasis, angiogenesis, and cell proliferation (17, 18, 20, 23–25). However, biological functions of HOXB7 in the control of colorectal tumorigenesis and tumor progression have not been well characterized. Here, we sought to investigate the potential role of HOXB7 in the development and progression of CRC.

Cell cultures

The human CRC cell lines Caco2, Colo205, Ls174t, DLD-1, HT-29, HCT116, SW480, and SW620 were purchased from American Type Culture Collection. SW620 and HT29 were cultured in DMEM medium (Gibco) supplemented with 10% FBS (PAA). Caco2, Colo205, Ls174t, DLD-1, HT-29, HCT116, and SW480 were cultured in RPMI 1640 medium (Gibco) with 10% FBS (PAA).

Vectors construction and retroviral infection

The HOXB7 construct was generated by subcloning PCR-amplified full-length human HOXB7 cDNA into pLncx2. For deletion of HOXB7, shRNA sequence (GCTCAGGAACTGACCGCAAAC) was cloned into pSuper-retro-puro. Retroviral production and infection were performed as previously described (26). Stable cell lines expressing HOXB7 or shHOXB7 were selected for 10 days with 400 mg/mL G418 or 0.5 μg/mL puromycin, respectively.

Patient samples

Paraffin-embedded, archived CRC samples were obtained from 224 patients diagnosed as CRC between January 2001 and December 2003 at Nanfang Hospital, Southern Medical University. Medical records of the 224 patients provided information of age, gender, and following parameters: tumor histology, pathologic stage, Dukes stage, T stage, lymph node metastases, and distant metastasis. Survival data were available for all patients. The median follow-up time was 57.5 months (range, 2–87 months). The mean age at diagnosis was 56.4 years (range, 23–86 years). One hundred and twenty-seven patients (56.7%) were male. At the end of the follow-up period, distant metastasis was noted in 72 patients. Eight biopsies of CRC tissues and the matched adjacent noncancerous mucosa tissues were frozen and stored in liquid nitrogen until further use.

RNA extraction, RT-PCR and real-time PCR

Total RNA extraction, RT-PCR and real-time PCR were performed as previously described (27). See Supplementary Methods for details.

Western blotting

Western blotting was performed according to standard methods as described previously (27), using anti-HOXB7 (Sigma-Aldrich), anti-phospho-ERK, anti-ERK, anti-phospho-AKT, anti-AKT, anti-phospho-GSK3β, anti-GSK3β, anti-Cyclin D1, and anti-p27 antibodies ((Bioworld Technology). A mouse monoclonal anti-α-Tubulin antibody (Sigma-Aldrich) was used as inner control to confirm equal loading of proteins.

Immunohistochemistry

Immunohistochemistry (IHC) staining and scoring were done as previously described (27). For details, please see Supplementary Methods.

Colony formation assays

Cells were trypsinized and plated on 6-well plates (200 cells/well) and cultured for 2 weeks. The colonies were stained with 1% crystal violet for 30s after fixation with 4% paraformaldehyde for 5 minutes. The number of colonies, defined as >50 cells/colony were counted. Three independent experiments were performed. The data was calculated using paired t test.

Soft agar assays

Cells (1 × 104) were resuspended in RPMI 1640 containing 10% fetal bovine serum with 0.3% agarose and layered on top of 0.6% agar in medium supplemented with 20% fetal bovine serum on 60-mm plates. The plates were incubated at 37°C in a humid atmosphere of 5% CO2. After 2 to 3 weeks, cell colony numbers were counted under microscope and cell colonies were photographed at an original magnification of 100×. Only cell colonies containing more than 50 cells were counted. The experiment was performed for 3 independent times for each cell line.

MTT assays and cell cycle analysis

See Supplementary Methods for details.

Tumorigenesis in nude mice

Xenograft tumors were generated by subcutaneous injection of cells (2 × 106 for SW480/Vector and SW480/HOXB7, 5 × 105 for SW620/Scramble and SW620/shHOXB7, n = 5) on the hindlimbs of each 4- to 6-week-old Balb/C athymic nude mouse (nu/nu) obtained from the Animal Center of Southern Medical University, Guangzhou, China. All mice were housed and maintained under specific pathogen-free conditions and used in accordance with institutional guidelines and approved by the Use Committee for Animal Care. Tumor size was measured by a slide caliper and tumor volume was determined by the formula 0.44 × A × B2 (A indicates tumor base diameter one direction and B the corresponding perpendicular value). The tumor were rapidly taken out and fixed in 10% neutral buffered formalin, embedded in paraffin. Sections of 4 μm were cut and stained with haematoxylin and eosin according to standard protocols. Sections were further under IHC staining using antibodies against HOXB7 and Ki-67.

Statistical analysis

All statistical analyses were performed using the SPSS 13.0 statistical software package. Comparisons between groups for statistical significance were performed with a 2-tailed paired Student's t test. The relationships between HOXB7 expression and clinicopathologic characteristics were tested using Chi-square test. Survival curves were plotted by Kaplan–Meier method and compared by log-rank test. The significance of various survival-related variables was assessed by Cox regression model in the multivariate analysis. P < 0.05 was considered statistically significant.

HOXB7 was frequently upregulated in CRC

Real-time PCR and western blotting analysis revealed that all 8 CRC cell lines, including Colo205, Caco2, Ls174t, DLD1, HT29, HCT116, SW480, and SW620, exhibited different levels of HOXB7 expression. HOXB7 expression was relatively lower in Ls174t and SW480 than that in other cell lines (Fig. 1A and B). Comparative analysis indicated that HOXB7 was significantly upregulated in 8 examined tumor samples paired with adjacent noncancerous tissues from the same patients (Fig. 1C and D). The tumor/normal (T/N) ratio of HOXB7 mRNA expression was >2-fold in all samples, and the highest ratio was up to 16.4-fold, as analysis by Real-time PCR (Fig. 1E).

Figure 1.

Expression of HOXB7 was elevated in CRC. A, expression of HOXB7 protein in CRC cell lines. Expression levels were normalized with α-Tubulin. B, expression of HOXB7 mRNA in CRC cell lines by Real-time PCR. Expression levels were normalized for GAPDH. Error bars represent mean ± SD calculated from 3 parallel experiments. C and D, expression of HOXB7 protein (C) and mRNA (D) in each of the primary CRC (T) and adjacent noncancerous tissues (N) paired from the same patient by western blotting (C) and RT-PCR (D). E, real-time PCR analysis of HOXB7 expression in each of the T and N tissues. GADPH was used as an internal control. Columns, mean from 3 parallel experiments; bars, SD.

Figure 1.

Expression of HOXB7 was elevated in CRC. A, expression of HOXB7 protein in CRC cell lines. Expression levels were normalized with α-Tubulin. B, expression of HOXB7 mRNA in CRC cell lines by Real-time PCR. Expression levels were normalized for GAPDH. Error bars represent mean ± SD calculated from 3 parallel experiments. C and D, expression of HOXB7 protein (C) and mRNA (D) in each of the primary CRC (T) and adjacent noncancerous tissues (N) paired from the same patient by western blotting (C) and RT-PCR (D). E, real-time PCR analysis of HOXB7 expression in each of the T and N tissues. GADPH was used as an internal control. Columns, mean from 3 parallel experiments; bars, SD.

Close modal

HOXB7 overexpression was associated with progression and poor survival in CRC

Expression of HOXB7 protein was determined by IHC in 224 paraffin-embedded, archived CRC tissues. HOXB7 protein was detected in 179 of 224 (79.9%) cases of tissue samples (Fig. 2A, e–h), whereas there was no or weak signal in adjacent noncancerous areas in all sections detected (Fig. 2A, a–d). In addition, HOXB7 was differently expressed in tumor stroma cells (mainly in fibroblasts, Fig. 2A f, A h, C f, arrows) in some samples.

Figure 2.

HOXB7 expression in paraffin-embedded CRC specimens. A, representative images of HOXB7 expression in normal intestinal epithelium and CRC specimens examined by IHC. HOXB7 was only negatively (a, b) or weakly (c, d) detected in normal intestinal epithelial cells, whereas it was positively detected in CRC cells (e and f display weak signal, whereas g and h display strong signals). B, Kaplan–Meier analysis of survival in patients with CRC. Green, patients with high HOXB7 expression (n = 121, 5-year survival rate 51.1%, median survival 57 months); blue, patients with low expression of HOXB7 (n = 103, 5-year survival rate 70.6%, median survival 64 months; P = 0.005, log-rank test). C, HOXB7 expression in CRC tissues was positively associated with the expression of Ki-67. IHC staining for HOXB7 and Ki-67 in a series of sections from paraffin blocks of CRC reveals weak expression of HOXB7 (a, b), weak expression of Ki-67 (c, d), strong expression of HOXB7 (e, f), and strong expression of Ki-67 (g, h). The arrows indicate the stroma cells positively stained with HOXB7.

Figure 2.

HOXB7 expression in paraffin-embedded CRC specimens. A, representative images of HOXB7 expression in normal intestinal epithelium and CRC specimens examined by IHC. HOXB7 was only negatively (a, b) or weakly (c, d) detected in normal intestinal epithelial cells, whereas it was positively detected in CRC cells (e and f display weak signal, whereas g and h display strong signals). B, Kaplan–Meier analysis of survival in patients with CRC. Green, patients with high HOXB7 expression (n = 121, 5-year survival rate 51.1%, median survival 57 months); blue, patients with low expression of HOXB7 (n = 103, 5-year survival rate 70.6%, median survival 64 months; P = 0.005, log-rank test). C, HOXB7 expression in CRC tissues was positively associated with the expression of Ki-67. IHC staining for HOXB7 and Ki-67 in a series of sections from paraffin blocks of CRC reveals weak expression of HOXB7 (a, b), weak expression of Ki-67 (c, d), strong expression of HOXB7 (e, f), and strong expression of Ki-67 (g, h). The arrows indicate the stroma cells positively stained with HOXB7.

Close modal

Chi-square test showed that the levels of HOXB7 protein significantly correlated with Dukes stage (P < 0.001), T stage (P = 0.012), distant metastasis (P = 0.042), and Ki-67 labeling index (P = 0.007, Supplementary Table S2). Kaplan–Meier survival analysis indicated that patients who had low HOXB7 expression levels had a better outcome (Fig. 2B). Multivariate survival analysis indicated that the HOXB7 expression level, T stage and Pathologic stage were 3 independent prognostic factors for outcomes in patients with CRC (Supplementary Table S3). Chi-square test also indicated a significant correlation between the Ki-67 labeling index and HOXB7 expression in CRC (P = 0.007, Supplementary Table S2). Samples that had lower level of HOXB7 expression also had a lower Ki-67 labeling index (Fig. 2C, a–d), whereas samples that had higher level of HOXB7 expression had a higher Ki-67 labeling index (Fig. 2C, e–h).

HOXB7 promoted human CRC cell growth and proliferation

To evaluate the possible role of HOXB7 in the proliferation of human CRC cells, stable HOXB7 expressed cell lines SW480/HOXB7 and Ls174t/HOXB7 were made (Fig. 3A). We chose SW480 and Ls174t because these 2 cell lines were detected to have relatively low endogenous HOXB7 expression (Fig. 1A). MTT assay showed that HOXB7 overexpression increased the proliferation of SW480 as compared with the control cells (Fig. 3B; P < 0.05). The population doubling time cells of SW480/HOXB7 are significantly longer as compared with control. This observation was further confirmed by a cell growth assay (data not shown). Colony formation assay revealed that SW480/HOXB7 cells formed much more and bigger colonies than that of control cells (Fig. 3C; P < 0.01). Similar results were observed in Ls174t cells (Fig. 3B and C; P < 0.01). To further investigate the impact of HOXB7 on CRC proliferation, we knockdown endogenous HOXB7 in SW620 and HCT116 CRC cells by expressing short hairpin RNAs (shRNA; Fig. 3D). MTT assay and colony formation assay (Fig. 3E and F; P < 0.05), and cell growth assay (data not shown) showed that knockdown of HOXB7 expression caused evident compromised viability in SW620 and DLD1 cells.

Figure 3.

HOXB7 promotes human CRC cell growth and proliferation. A, ectopic expression of HOXB7 in SW480 and Ls174t cells analyzed by western blotting. B, ectopic expression of HOXB7 stimulates SW480 and Ls174t cell proliferation as determined by MTT assays (B) and colony formation assays (C). D, Knockdown of endogenous HOXB7 in specific shRNA-transduced stable HCT116 and SW620 cells. E and F, knockdown of HOXB7 inhibits cell growth as determined by MTT assays (E) and colony formation assays (F). Error bars represent mean ± SD from 3 independent experiments. *, P < 0.01.

Figure 3.

HOXB7 promotes human CRC cell growth and proliferation. A, ectopic expression of HOXB7 in SW480 and Ls174t cells analyzed by western blotting. B, ectopic expression of HOXB7 stimulates SW480 and Ls174t cell proliferation as determined by MTT assays (B) and colony formation assays (C). D, Knockdown of endogenous HOXB7 in specific shRNA-transduced stable HCT116 and SW620 cells. E and F, knockdown of HOXB7 inhibits cell growth as determined by MTT assays (E) and colony formation assays (F). Error bars represent mean ± SD from 3 independent experiments. *, P < 0.01.

Close modal

HOXB7 promoted tumorigenesis of CRC in vitro and in vivo

We next examined the effect of HOXB7 on the tumorigenic activity of CRC cells using an anchorage-independent growth assay. The results showed that overexpression of HOXB7 in SW480 caused significant promotion of its anchorage-independent growth, as indicated by increasing in colony number and colony size on soft agar (Fig. 4A; P < 0.01). Although depletion of endogenous HOXB7 in SW620 cells caused significant reduction in colony number and colony size on soft agar (Fig. 4B; P < 0.01). Therefore, we determined that HOXB7 is essential for tumorigenesis of CRC cells.

Figure 4.

The impact of HOXB7 expression on tumorigenesis in vitro and in vivo. A and B, overexpression of HOXB7 promotes cell growth of SW480 (A) and silencing endogenous HOXB7 inhibited cell growth of SW620 (B) as determined by anchorage-independent growth ability assays. Only cell colonies containing more than 50 cells were counted. Error bars represent mean ± SD from 3 independent experiments. *, P < 0.01. C and E, SW480/Vector and SW480/HOXB7 cells (2 × 106), and SW620/Scramble and SW620/shHOXB7 cells (5 × 105) were injected in the hindlimbs of nude mice (n = 5). Tumor volumes were measured on the indicated days. Data points are presented as the mean tumor volume ± SD. D and F, histopathology of xenograft tumors. The tumor sections were under H&E staining and IHC staining using antibodies against HOXB7 and Ki-67.

Figure 4.

The impact of HOXB7 expression on tumorigenesis in vitro and in vivo. A and B, overexpression of HOXB7 promotes cell growth of SW480 (A) and silencing endogenous HOXB7 inhibited cell growth of SW620 (B) as determined by anchorage-independent growth ability assays. Only cell colonies containing more than 50 cells were counted. Error bars represent mean ± SD from 3 independent experiments. *, P < 0.01. C and E, SW480/Vector and SW480/HOXB7 cells (2 × 106), and SW620/Scramble and SW620/shHOXB7 cells (5 × 105) were injected in the hindlimbs of nude mice (n = 5). Tumor volumes were measured on the indicated days. Data points are presented as the mean tumor volume ± SD. D and F, histopathology of xenograft tumors. The tumor sections were under H&E staining and IHC staining using antibodies against HOXB7 and Ki-67.

Close modal

To confirm this effect in vivo, we performed tumorigenesis assays in nude mice. SW480/Vector, SW480/HOXB7, SW620/Scramble, and SW620/shHOXB7 cells were inoculated in nude mice. All mice developed Xenograft tumors at the injection site. As shown in Figure 4C, tumor growth in the SW480/HOXB7 group was significantly more rapid than that in the SW480/Vector group. The volumes of tumors formed by the SW480/HOXB7 cells were significantly larger than those of vector-control cells-formed tumors (n = 5; P < 0.05). The average final tumor volume in SW480/HOXB7 group was 712.7 ± 123.4 mm3, compared with 363.6 ± 203.5 mm3 in the SW480/Vector inoculating group (t-test, P < 0.05.). In addition to the difference of tumor volume, we also found that the tumors formed by SW480/HOXB7 cells displayed much stronger HOXB7 staining and higher Ki-67 index than that in tumors formed by SW480/Vector cells, as detected by IHC analysis of HOXB7 and Ki-67 (Fig. 4D). However, depletion of endogenous HOXB7 in SW620 cells caused significant inhibition of tumor growth in terms of tumor volume (Fig. 4E; n = 5; P<0.01). The average final tumor volume in control group was 115.6 ± 40.1 mm3, whereas it was only 41.5 ± 20.1 mm3 in the SW620/shHOXB7 inoculating group. Difference in the final tumor volume between these 2 groups was significant (t-test, P < 0.05). IHC staining showed that the tumors of control group displayed much stronger HOXB7 staining and higher Ki-67 index than that in SW620/shHOXB7 group (Fig. 4F).

HOXB7 accelerated cell cycle progression

We further measured the cell cycle distribution by flow cytometry to explore the possible mechanism of HOXB7 in controlling CRC cell proliferation. As shown in Figure 5, decrease in the cell number at the G1–G0 phase and increase in the cell number at S phase was observed in HOXB7 overexpressed cells. The percentage of cells reentering into S phase after serum starvation in SW480/HOXB7 (37.83% ± 3.42) was significantly higher than that in SW480/Vector cells (26.89% ± 0.12; Fig. 5A a and B a, P < 0.01). The percentage of S-phase cells in Ls174t/HOXB7 was 31.96% ± 2.15, whereas it was only 22.66% ± 2.11 in control cells (Fig. 5A b and B b, P < 0.01). On the contrary, increase in the cell number at the G1–G0 phase and decrease in the cell number at S phase was observed after endogenous HOXB7 was knocking down. The percentage of S-phase cells in HCT116/shHOXB7 (30.7% ± 1.95) and SW620/shHOXB7 (27.21% ± 4.47) were significantly less than in HCT116/Sramble (38.86% ± 3.65) and SW620/shHOXB7 (40.77% ± 2.17) cells, respectively (Fig. 5Ac-d and B c-d, P < 0.01). These results indicated that overexpression of HOXB7 accelerated the G1 to S-phase transition in CRC cell lines, which contributes to the growth promotion properties of HOXB7.

Figure 5.

The effect of HOXB7 on cell cycle distribution of CRC cells. A, representative histograms depicting cell cycle profiles of indicated cells. Cells were stained with PI and analyzed by flow cytometry. B, proportion of cells in various phases of the cell cycle. The results are means of 3 independent experiments ± SD from 3 independent experiments. *, P < 0.01.

Figure 5.

The effect of HOXB7 on cell cycle distribution of CRC cells. A, representative histograms depicting cell cycle profiles of indicated cells. Cells were stained with PI and analyzed by flow cytometry. B, proportion of cells in various phases of the cell cycle. The results are means of 3 independent experiments ± SD from 3 independent experiments. *, P < 0.01.

Close modal

HOXB7 regulated cell cycle factors cyclin D1 and p27Kip1: MAPK and PI3K/Akt activations in CRC cells were involved

To better understand the mechanisms that facilitate the G1 to S-cell cycle transition mediated by HOXB7, the expression levels of some of the cell cycle regulators, including CDK4, CDK2, cyclin D1, cyclin E, p21Cip1/WAF1, and p27Kip1 were detected. Overexpression of HOXB7 did not affect the expression of CDK4, CDK2, cyclin E, and p21Cip1/WAF1 (data not shown), whereas the expression cyclin D1 was upregulated and p27Kip1 was downregulated (Fig. 6A). In contrast, significant increases in the expression of p27Kip1 and decreases of cyclin D1 were shown in HOXB7 knockdown CRC cells (Fig. 6A). Moreover, the modulation of p27Kip1 and cyclin D1 by HOXB7 were regulated at the transcriptional level (Fig. 6B). Further more, phosphorylated levels of ERK, AKT and GSK3β were increased in HOXB7-overexpressed CRC cells, whereas they were significantly decreased in HOXB7-knockdown CRC cells than in control cells (Fig. 6A).

Figure 6.

HOXB7 regulates cell proliferation factors cyclin D1 and p27Kip1 through the MAPK and AKT/GSK3β pathways in CRC cells. A, Western blotting analysis of the expression of p-ERK, total ERK, phosphorylated AKT, total AKT, p-GSK-3β, total GSK-3β, cyclin D1and p27Kip1 proteins in indicated vector-infected and HOXB7 infected CRC cell lines, and vector-infected and HOXB7 shRNA-infected CRC cell lines. B, relative mRNA expression of p27Kip1 and cyclin D1 in indicated CRC cell lines were determined by real-time RT-PCR. Error bars represent mean ± SD from 3 independent experiments.

Figure 6.

HOXB7 regulates cell proliferation factors cyclin D1 and p27Kip1 through the MAPK and AKT/GSK3β pathways in CRC cells. A, Western blotting analysis of the expression of p-ERK, total ERK, phosphorylated AKT, total AKT, p-GSK-3β, total GSK-3β, cyclin D1and p27Kip1 proteins in indicated vector-infected and HOXB7 infected CRC cell lines, and vector-infected and HOXB7 shRNA-infected CRC cell lines. B, relative mRNA expression of p27Kip1 and cyclin D1 in indicated CRC cell lines were determined by real-time RT-PCR. Error bars represent mean ± SD from 3 independent experiments.

Close modal

Although altered HOXB7 mRNA level was observed in CRC (14), this study was the first that reported the upregulation of both HOXB7 protein and mRNA in this disease. The current study has revealed that expression of HOXB7 is significantly correlated with the invasive and aggressive characteristics of human CRC (high Dukes stage, T stage, distant metastasis-positive tumors, and high proliferation index) and with poor survival of patients as well. These implicate that overexpression of HOXB7 protein may be a common feature in CRC and can serve as an independent prognostic marker to identify patients with poor clinical outcome. Similar to our results, HOXB7 overexpression was reported in association with the clinical progression and poor outcome of patients with breast cancer and oral cancer (17, 18, 20). Upregulation of HOXB7 mRNA and/or protein level was also observed in melanoma, ovarian cancer, and esophageal squamous cell carcinoma (15, 16, 19). However, whether HOXB7 can be used as a universal biomarker or prognostic predictor for neoplasm needs further investigation.

There were 2 opposite functions of HOXB7 that were documented in different cellular contexts. Majority studies supported that HOXB7 might play a role in promotion of multistep process of tumor formation and progression, including transformation, proliferation, angiogenesis, invasion, and metastasis (17, 18, 20–25). On the other hand, some researchers observed a promoting role of HOXB7 in differentiation in hematopoietic stem cells and multipotent mesenchymal cells (24, 28). Our results suggested that elevated HOXB7 might be associated with higher proliferation activity in CRC cells, which contributed to malignant transforming and tumorigenesis. Thus, our data mainly support the tumorigenesis promotion function of HOXB7. Interestingly, we found that HOXB7 was not only expressed in cancerous epithelial cells, but also differently expressed in tumor stroma cells (mainly in fibroblasts, Fig. 2). Similarly, it has been reported that HOXB7 is expressed in fibroblasts (29, 30). These observations suggested that HOXB7 may be involved in a stroma-specific signaling pathway that promotes initiation and progression of CRC. Thus, the expression and function of HOXB7 might be tissue specific or individual specific.

Although HOXB7 has been linked to regulation of proliferation (and thus transformation), the molecular mechanisms remain poorly identified. Majority researches only reported that bFGF, one of direct targets of HOXB7, contributed to HOXB7-induced cellular proliferation and transformation (15, 16, 18, 25). Here, more specifically, we showed the molecular mechanisms might be the acceleration of G1–S transition, upregulation of cyclin D1 and downregulation of p27Kip1 under enforced expression of HOXB7. Previous studies revealed that PI3K/AKT and MAPK signal transduction cascades, required for cell cycle progression through G1 phase, were frequently involved in proliferation (31). In addition, activation of RAS and PI3K/AKT decreased the cellular levels of p27Kip1 and induced cyclin D1 mRNA and protein, thereby promoting cell proliferation (32). Moreover, HOXB7 was shown to activate the Ras-RAF-MAPK pathway in breast cancer cell lines (17). Here, we showed that PI3K/AKT and MAPK pathways were activated because p-ERK, p-AKT and p-GSK3-β were upregulated by HOXB7. Therefore, the regulation of p27Kip1 and cyclin D1 by HOXB7 probably resulted from enhanced PI3K/AKT and MAPK pathway activity. This thus explains the accelerating G1–S transition induced by HOXB7. Taken together, our observations link HOXB7 to the basic cell cycle regulation, which helps provide evidence for diverse molecular mechanisms by which HOXB7 promote cell growth and proliferation.

Both MAPK and PI3K/Akt pathways directly regulate p27Kip1 and cyclin D1 (31). The regulation occurs not only at transcriptional level but also at posttranslational level via ubiquitin-proteasome proteolysis (33–35). p27Kip1 promoter activity could be regulated by FOXO proteins (FOXO4, FOXO3a, and FOXO1) which, in turn, could be modulated by PI3K/AKT and MAPK pathways (32, 36). In this study we showed that HOXB7 overexpression could downregulate p27Kip1 expression both at mRNA and protein levels, with little difference between the 2 levels in the change fold of p27Kip1. Therefore, the effect of HOXB7 on p27Kip1 in CRC cells may be mediated via PI3K/AKT and MAPK pathways at transcriptional level. Similarly, cyclin D1 was regulated at both transcript and protein levels by HOXB7 in this study. Thus, the effect of HOXB7 on cyclin D1 in CRC cells may also be regulated mainly at transcriptional level. However, whether HOXB7 could directly promote transcription of cyclin D1 need further investigation.

In conclusion, our findings suggest that upregulation of HOXB7 might be a valuable prognostic marker of CRC progression. Altered expression of HOXB7 genes could be important for tumorigenesis and progression of CRC. Modulation of the tumor proliferation effect through inhibiting PI3K/AKT or MAPK activation mediated by HOXB7 overexpression might be used as a potential target for CRC prevention and therapy.

No potential conflicts of interest were disclosed.

This work was supported by the National Natural Science Foundation of China (No. 30901791, 30670967, 30770977, 81071735, 81090422/H1606), the Research Fund for the Doctoral Program of Higher Education of China (No. 2009443312009, 20094433110001), National Basic Research Program of China (973 Program, No. 2010CB529403) and Innovative Research Team Foundation in University (No. IRT0731), Universities in Guangdong Province 211 key construction projects, Guangdong Provincial Key Science and Technology Innovation Fund for Higher Education (No. GXZD1016), Guangdong Natural Science Foundation of China (2010B031500012).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Rupnarain
C
,
Dlamini
Z
,
Naicker
S
,
Bhoola
K
. 
Colon cancer: genomics and apoptotic events
.
Biol Chem
2004
;
385
:
449
64
.
2.
Calvert
PM
,
Frucht
H
. 
The genetics of colorectal cancer
.
Ann Intern Med
2002
;
137
:
603
12
.
3.
Weitz
J
,
Koch
M
,
Debus
J
,
Hohler
T
,
Galle
PR
,
Buchler
MW
. 
Colorectal cancer
.
Lancet
2005
;
365
:
153
65
.
4.
Pearson
JC
,
Lemons
D
,
McGinnis
W
. 
Modulating Hox gene functions during animal body patterning
.
Nat Rev Genet
2005
;
6
:
893
904
.
5.
Samuel
S
,
Naora
H
. 
Homeobox gene expression in cancer: insights from developmental regulation and deregulation
.
Eur J Cancer
2005
;
41
:
2428
37
.
6.
Krumlauf
R
. 
Hox genes in vertebrate development
.
Cell
1994
;
78
:
191
201
.
7.
Beck
F
,
Tata
F
,
Chawengsaksophak
K
. 
Homeobox genes and gut development
.
Bioessays
2000
;
22
:
431
41
8.
Yu
YY
,
Pan
YS
,
Zhu
ZG
. 
Homeobox genes and their functions on development and neoplasm in gastrointestinal tract
.
Eur J Surg Oncol
2007
;
33
:
129
32
.
9.
Mallo
GV
,
Rechreche
H
,
Frigerio
JM
,
Rocha
D
,
Zweibaum
A
,
Lacasa
M
, et al
Molecular cloning, sequencing and expression of the mRNA encoding human Cdx1 and Cdx2 homeobox. Down-regulation of Cdx1 and Cdx2 mRNA expression during colorectal carcinogenesis
.
Int J Cancer
1997
;
74
:
35
44
.
10.
Mallo
GV
,
Soubeyran
P
,
Lissitzky
JC
,
André
F
,
Farnarier
C
,
Marvaldi
J
, et al
Expression of the Cdx1 and Cdx2 homeotic genes leads to reduced malignancy in colon cancer-derived cells
.
J Biol Chem
1998
;
273
:
14030
6
.
11.
Guo
RJ
,
Huang
E
,
Ezaki
T
,
Patel
N
,
Sinclair
K
,
Wu
J
, et al
Cdx1 inhibits human colon cancer cell proliferation by reducing beta-catenin/T-cell factor transcriptional activity
.
J Biol Chem
2004
;
279
:
36865
75
.
12.
Dang
LH
,
Chen
F
,
Ying
C
,
Chun
SY
,
Knock
SA
,
Appelman
HD
, et al
CDX2 has tumorigenic potential in the human colon cancer cell lines LOVO and SW48
.
Oncogene
2006
;
25
:
2264
72
.
13.
Vider
BZ
,
Zimber
A
,
Chastre
E
,
Gespach
C
,
Halperin
M
,
Mashiah
P
, et al
Deregulated expression of homeobox-containing genes, HOXB6, B8, C8, C9, and Cdx-1, in human colon cancer cell lines
.
Biochem Biophys Res Commun
2000
;
272
:
513
8
.
14.
De Vita
G
,
Barba
P
,
Odartchenko
N
,
Givel
JC
,
Freschi
G
,
Bucciarelli
G
, et al
Expression of homeobox-containing genes in primary and metastatic colorectal cancer
.
Eur J Cancer
1993
;
29A
:
887
93
.
15.
Caré
A
,
Silvani
A
,
Meccia
E
,
Mattia
G
,
Stoppacciaro
A
,
Parmiani
G
, et al
HOXB7 constitutively activates basic fibroblast growth factor in melanomas
.
Mol Cell Biol
1996
;
16
:
4842
51
.
16.
Naora
H
,
Yang
YQ
,
Montz
FJ
,
Seidman
JD
,
Kurman
RJ
,
Roden
RB
. 
A serologically identified tumor antigen encoded by a homeobox gene promotes growth of ovarian epithelial cells
.
Proc Natl Acad Sci U S A
2001
;
98
:
4060
5
.
17.
Wu
X
,
Chen
H
,
Parker
B
,
Rubin
E
,
Zhu
T
,
Lee
JS
, et al
HOXB7, a homeodomain protein, is overexpressed in breast cancer and confers epithelial-mesenchymal transition
.
Cancer Res
2006
;
66
:
9527
34
.
18.
De Souza Setubal Destro
MF
,
Bitu
CC
,
Zecchin
KG
,
Graner
E
,
Lopes
MA
,
Kowalski
LP
, et al
Overexpression of HOXB7 homeobox gene in oral cancer induces cellular proliferation and is associated with poor prognosis
.
Int J Oncol
2010
;
36
:
141
9
.
19.
Chen
KN
,
Gu
ZD
,
Ke
Y
,
Li
JY
,
Shi
XT
,
Xu
GW
. 
Expression of 11 HOX genes is deregulated in esophageal squamous cell carcinoma
.
Clin Cancer Res
2005
;
11
:
1044
9
.
20.
Chen
H
,
Lee
JS
,
Liang
X
,
Zhang
H
,
Zhu
T
,
Zhang
Z
, et al
Hoxb7 inhibits transgenic HER-2/neu-induced mouse mammary tumor onset but promotes progression and lung metastasis
.
Cancer Res
2008
;
68
:
3637
44
.
21.
Maulbecker
CC
,
Gruss
P
. 
The oncogenic potential of deregulated homeobox genes
.
Cell Growth Differ
1993
;
4
:
431
41
.
22.
Rubin
E
,
Wu
X
,
Zhu
T
,
Cheung
JC
,
Chen
H
,
Lorincz
A
, et al
A role for the HOXB7 homeodomain protein in DNA repair
.
Cancer Res
2007
;
67
:
1527
35
.
23.
Carè
A
,
Felicetti
F
,
Meccia
E
,
Bottero
L
,
Parenza
M
,
Stoppacciaro
A
, et al
HOXB7: a key factor for tumor-associated angiogenic switch
.
Cancer Res
2001
;
61
:
6532
9
.
24.
Carè
A
,
Valtieri
M
,
Mattia
G
,
Meccia
E
,
Masella
B
,
Luchetti
L
, et al
Enforced expression of HOXB7 promotes hematopoietic stem cell proliferation and myeloid-restricted progenitor differentiation
.
Oncogene
1999
;
18
:
1993
2001
.
25.
Care
A
,
Silvani
A
,
Meccia
E
,
Mattia
G
,
Peschle
C
,
Colombo
MP
. 
Transduction of the SkBr3 breast carcinoma cell line with the HOXB7 gene induces bFGF expression, increases cell proliferation and reduces growth factor dependence
.
Oncogene
1998
;
16
:
3285
9
.
26.
Song
LB
,
Zeng
MS
,
Liao
WT
,
Zhang
L
,
Mo
HY
,
Liu
WL
, et al
Bmi-1 is a novel molecular marker of nasopharyngeal carcinoma progression and immortalizes primary human nasopharyngeal epithelial cells
.
Cancer Res
2006
;
66
:
6225
32
.
27.
Liao
WT
,
Wang
X
,
Xu
LH
,
Kong
QL
,
Yu
CP
,
Li
MZ
, et al
Centromere protein H is a novel prognostic marker for human nonsmall cell lung cancer progression and overall patient survival
.
Cancer
2009
;
115
:
1507
17
.
28.
Bostrom
K
,
Tintut
Y
,
Kao
SC
,
Stanford
WP
,
Demer
LL
. 
HOXB7 overexpression promotes differentiation of C3H10T1/2 cells to smooth muscle cells
.
J Cell Biochem
2000
;
78
:
210
21
.
29.
Rinn
JL
,
Bondre
C
,
Gladstone
HB
,
Brown
PO
,
Chang
HY
. 
Anatomic demarcation by positional variation in fibroblast gene expression programs
.
PLoS Genet
2006
;
2
:
e119
.
30.
Rinn
JL
,
Wang
JK
,
Allen
N
,
Brugmann
SA
,
Mikels
AJ
,
Liu
H
, et al
A dermal HOX transcriptional program regulates site-specific epidermal fate
.
Genes Dev
2008
;
22
:
303
7
.
31.
Massague
J
. 
G1 cell-cycle control and cancer
.
Nature
2004
;
432
:
298
306
.
32.
Medema
RH
,
Kops
GJ
,
Bos
JL
,
Burgering
BM
. 
AFX-like Forkhead transcription factors mediate cell-cycle regulation by Ras and PKB through p27kip1
.
Nature
2000
;
404
:
782
7
.
33.
Pruitt
K
,
Der
CJ
. 
Ras and Rho regulation of the cell cycle and oncogenesis
.
Cancer Lett
2001
;
171
:
1
10
.
34.
Tetsu
O
,
McCormick
F
. 
Beta-catenin regulates expression of cyclin D1 in colon carcinoma cells
.
Nature
1999
;
398
:
422
6
.
35.
Bashir
T
,
Dorrello
NV
,
Amador
V
,
Guardavaccaro
D
,
Pagano
M
. 
Control of the SCF(Skp2-Cks1) ubiquitin ligase by the APC/C(Cdh1) ubiquitin ligase
.
Nature
2004
;
428
:
190
3
.
36.
Roy
SK
,
Srivastava
RK
,
Shankar
S
. 
Inhibition of PI3K/AKT and MAPK/ERK pathways causes activation of FOXO transcription factor, leading to cell cycle arrest and apoptosis in pancreatic cancer
.
J Mol Signal
2010
;
5
:
10
.