Purpose: To determine the maximum tolerated dose (MTD), toxicity spectrum, clinical activity, and biological effects of the tropism-modified, infectivity-enhanced conditionally replicative adenovirus (CRAd), Ad5–Δ24–Arg-Gly-Asp (RGD), in patients with malignant gynecologic diseases.

Experimental Design: Cohorts of eligible patients were treated daily for 3 days through an i.p. catheter. Vector doses ranged from 1 × 109 to 1 × 1012 viral particles per day. Toxicity was evaluated using CTCv3.0. CA-125 and Response Evaluation Criteria in Solid Tumors (RECIST) criteria were used to determine clinical efficacy. Corollary biological studies included assessment of CRAd replication, wild-type virus generation, viral shedding, and neutralizing antibody response.

Results: Twenty-one patients were treated. Adverse clinical effects were limited to grade 1/2 fever, fatigue, or abdominal pain. No vector-related grade 3/4 toxicities were noted. No clinically significant laboratory abnormalities were noted. The maximum tolerated dose was not reached. Over a 1 month follow-up, 15 (71%) patients had stable disease and six (29%) had progressive disease. No partial or complete responses were noted. Seven patients had a decrease in CA-125; four had a >20% drop. RGD-specific PCR showed the presence of study vector in ascites of 16 patients. Seven revealed an increase in virus after day 3, suggesting replication of Ad5-Δ24-RGD. Minimal wild-type virus generation was detected. Viral shedding studies showed insignificant shedding in the serum, saliva, and urine. Anti-adenoviral neutralizing antibody effects were prevalent.

Conclusions: This study, the first to evaluate an infectivity-enhanced CRAd in human cancer, shows the feasibility, safety, potential antitumor response, and biological activity of this approach in ovarian cancer. Further evaluation of infectivity enhanced virotherapy approaches for malignant gynecologic diseases is warranted. Clin Cancer Res; 16(21); 5277–87. ©2010 AACR.

Translational Relevance

Novel treatment strategies are needed for patients with advanced or recurrent gynecologic cancers. One such novel therapeutic approach, oncolytic virotherapy, is a promising therapy for these malignant diseases. This study is the first to evaluate an infectivity-enhanced conditionally replicative adenovirus in the context of human cancer and shows the feasibility, safety, potential antitumor response, and biological activity of this virotherapy approach in malignant gynecologic diseases.

In recent years, advances in cancer therapy have brought about modest improvement in outcomes for patients with malignant gynecologic diseases. Although many patients with advanced ovarian, fallopian tube, or peritoneal carcinoma will initially respond to surgical debulking and cytotoxic chemotherapy, most will eventually recur and ultimately succumb to their disease. Likewise, only a few patients with advanced or recurrent endometrial will experience long term overall survival (1, 2). Clearly, novel treatment strategies are needed for patients affected with these devastating malignant gynecologic diseases.

One such novel approach, oncolytic virotherapy, involves the development of replication competent viruses that specifically infect targeted cancer cells, proliferate in and induce cancer cell oncolysis, and subsequently release progeny viral particles that will infect and lyse surrounding cancer cells. Adenoviruses are well suited to development as a virotherapy agent due to excellent stability, unparalleled infectivity, efficient gene transfer, and biological plasticity compared with other viruses (3). Conditionally replicating adenoviruses (CRAd) are rendered conditionally replicative by deleting viral genes that become extraneous in many tumor cells such as genes involved in replication through p53 and Rb pathways (4). In normal cells, p53 and Rb serve as tumor suppressor genes modulating cell cycle and inducing apoptosis if cellular DNA damage is incurred. However, many cancers, such as ovarian cancer, are known to have very low rates of functional p53 and Rb due to mutations in the aforementioned genes (5, 6). As such, these tumors lend themselves well to potential CRAd therapy.

One such CRAd, ONYX 015, has been used previously in clinical trials of gynecologic and other malignant diseases but with limited success (7, 8). Limited efficacy has been, in part, attributed to inefficient gene transfer due to a relative paucity of the primary adenovirus receptor, known as CAR, on cancer cells (9). Our group has previously shown that genetic manipulation of the adenoviral capsid proteins to incorporate an Arg-Gly-Asp (RGD) sequence in the HI loop of the fiber knob accomplishes enhanced infectivity of tumor cells through CAR independent pathways (10, 11). RGD modification had been shown to exhibit a degree of specificity for ovarian cancer cells over normal tissue because of the upregulation of ανβ integrins in ovarian cancer cells and infectivity enhancement was shown to dramatically improve antitumor potency of various gene therapy approaches in vitro and in animal models of ovarian cancer (11).

In keeping with these data, we constructed a novel infectivity-enhanced CRAd, designated Ad5-Δ24-RGD, that uses a 24-bp deletion in the E1A gene known to be necessary for host cell Rb protein binding, thereby conferring conditional replication only in cells that are deficient in the Rb/p16 pathway. Incorporation of the RGD capsid modification also allows Ad5-Δ24-RGD to achieve enhanced tumor cell infectivity through integrin binding and relative increased infection specificity. Preclinical studies on Ad5-Δ24-RGD have shown enhanced infectivity, oncolytic capacity, tumor specificity, and therapeutic efficacy in ovarian cancer cell lines, primary ovarian cancer cells, and in a well established murine model for ovarian cancer (12). In vivo biodistribution and toxicity studies noted appropriate viral clearance and no significant permanent pathologic or laboratory abnormalities associated with i.p. administration to cotton rats, which are permissive to adenovirus serotype 5 replication (13).

These preclinical efficacy and safety studies provided justification for a phase I clinical trial designed to determine the maximum tolerated dose (MTD) and spectrum of toxicities encountered with i.p. delivery of the tropism modified CRAd, Ad5-Δ24-RGD, in patients with recurrent ovarian and other select gynecologic cancers. Secondary objectives included determination of potential clinical activity, biological effects of, and the immunologic response to i.p. administration of Ad5-Δ24-RGD. Importantly, this infectivity enhanced adenovirus represents the first ever tropism-modified CRAd applied in the context of human cancer clinical trials.

Patient eligibility

This study was conducted by a 3 + 3 dose-escalation strategy at a single institution following Institutional Review Board, Institutional Biosafety Committee, Recombinant DNA Advisory Committee, and Food and Drug Administration approval. Participants were enrolled from July 2007 to April 2009. Eligible patients originally included histologically documented persistent or recurrent epithelial ovarian or primary peritoneal adenocarcinoma and eventually were expanded to include fallopian tube and endometrial carcinoma. All patients were required to have previous treatment with conventional surgery and chemotherapy and have evidence of intra-abdominal disease. Patients were required to have adequate organ laboratory function defined as white blood cells, >3,000 μL; granulocyte count, >1,500 μL; platelets, >100,000; creatinine clearance, >80 mg/dL; creatinine, <2.0; aspartate aminotransferase or alanine aminotransferase, <2.5×, the upper limit of the reference range; bilirubin, <2.0; and prothrombin time/partial thrombopastin time/international normalized ratio (PT/PTT/INR), <1.5×, the upper limit of the reference range. Patients were required to have an ejection fraction >55% on echocardiogram and an O2 saturation >92%. Patients were required to be ≥19 years of age, have a gynecologic oncology group performance status of 0 to 2, have a life expectancy of >3 months, and sign an informed consent document. Patients with low malignant potential epithelial, stromal, or germ cell ovarian tumors were excluded. Patients with active heart disease, pulmonary disease, or coagulation disorders were excluded.

Ad5-Δ24-RGD manufacturing

The Ad5-Δ24 mutant adenovirus containing the 24-nucleotide deletion from Ad5 bp 923 to 946 was originally provided by Dr. Juan Fueyo (MD Anderson Cancer Center, Houston, TX). An E1 fragment containing the 24-bp deletion from this plasmid was cloned through homologous recombination into a ClaI-digested plasmid pVK503 containing the RGD fiber as previously described (14). Following PacI digestion, the resulting genome was released from the plasmid backbone, transfected into A549 cells, and rescued. RGD presence and Δ24 absence were verified through PCR.

Ad5-Δ24-RGD was manufactured with the support of the National Cancer Institute (NCI) Rapid Access to Intervention Development program at the Cell and Gene Therapy Center at Baylor College of Medicine and at the Biopharmaceutical Development Program/SAIC at NCI-Frederick. All viral doses were administered in 250 mL of 0.9% sodium chloride and kept refrigerated until administration.

General treatment plan and Ad5-Δ24-RGD dose cohorts

Pretreatment evaluation consisted of: history and physical, toxicity grading, performance status assignment, complete blood count, chemistry panel, liver profile, coagulation profile, CA-125, determination of ejection fraction by echocardiogram, O2 saturation, and computed tomography of the abdomen and pelvis. Patients completing pretreatment evaluation and meeting all eligibility criteria were enrolled and had an i.p. Quinton Curl, 22.4-inch, double-cuffed, Tenchkhoff-type catheters (Tyco Healthcare) placed by interventional radiology at least 1 week before use.

Patients were then enrolled in successive escalating dose cohorts such that cohort 1 received 1 × 109 vp/d (viral particles per day) and each successive cohort dose increased by 1/2 log vp/d. The seventh and final cohort received 1 × 1012 vp/d. Assigned doses were instilled through the i.p. catheter daily for three consecutive days in an inpatient setting. On the 4th day, the patient was discharged. Dose escalation occurred 4 weeks after the final patient in the previous cohort was treated. No individual patient dose escalation was done.

On days 0 to 3, 7, 14, and 28, patients were evaluated through history and physical examination, performance status assignment, toxicity grading, complete blood count, and chemistry profile. Peritoneal aspirates for biological ancillary studies and urine, saliva, and serum specimens for viral shedding studies were obtained immediately preceding Ad5-Δ24-RGD administration on day 0, 3, 7, 14, and 28. Serum CA-125 and a computed tomography of the abdomen and pelvis were repeated on day 28. All samples were processed to assure anonymity; individuals doing the biological studies were blinded to patient identity.

Toxicity evaluation

Toxicity grading was done using NCI Common Toxicity Criteria v3.0. MTD was defined as the dose exceeded by the dose at which at least two patients experience dose-limiting toxicity (DLT). DLT was defined as any vector related grade 3 nonhematologic toxicity, not including nausea, vomiting, or fatigue. Dose-limiting hematologic toxicities were defined as any admission for neutropenic fever, absolute neutrophil count of <500 for >5 days, or platelet count of <20,000. Any patient experiencing vector related grade 3/4 toxicity before completion of scheduled treatment had subsequent days of treatment held until resolution of toxicity. If no resolution occurred within 72 hours or if a second dose interruption occurred, patients received no further study drug.

Evaluation of clinical efficacy

RECIST criteria version 1.0 was used to define patients' best radiographic response to treatment. Measurable disease was defined as at least one lesion that could be accurately measured in one dimension and >1 cm. Up to five lesions per organ or 10 lesions total were identified as target lesions. Complete response required disappearance of all target lesions and normalization of CA-125. Partial response was defined as >30% decrease in the sum of target lesions' recorded dimensions. Progressive disease was defined as >20% increase in sum of target lesions recorded dimensions. Stable disease was a condition that did not qualify for partial response or progressive disease.

Evaluation of viral infection, CRAd replication, generation of wild-type (WT) virus in peritoneal fluid cells

Genomic DNA of tumor cells in peritoneal fluid was isolated using a QIAamp DNA Mini Kit (QIAGEN) according to the manufacturer's protocols. Real-time quantitative PCR was used to evaluate gene transfer and CRAd replication. RGD copies in genomic DNA were determined by amplification of the RGD gene with forward primer CACACTAAACGGTACACAGGAAACA, reverse primer ATGCAGATGGGCAGAAACAGT, and probe 6-FAM-AGACACAACTTGTGACTGCCGCGG-BHQ-1. Resultant RGD copies were normalized to a human cellular housekeeping gene (human β-actin), which was amplified with forward primer CCAGCAGATGTGGATCAGCA, reverse primer CTAGAAGCATTT-GCGGTGGAC, and probe 6-HEX-AGGAGTATGACGAG-TCCGGCCCCTC-BHQ-1.

To determine whether potential contaminating WT adenovirus were replicating, the WT E1 gene was amplified from cells in the ascites fluid with forward primer TGCCAAACCTTGTACCGGA, reverse primer CGTCGTCACTGGGGTGGAAA, and probe 6-FAM-ATCGATCTTACCTGCCACGAGGCTGG-BHQ. Resultant WT E1 copies were normalized to housekeeping genes to allow for comparison between patients and at different time points and varying amount of cellular material.

All primers and probes were designed by the Primer Express 1.5 software and synthesized by Sigma-Aldrich. FastStart TaqMan Probe Master (Roche Applied Science) was used for duplexing the PCR on a LightCycler 480 (Roche Applied Science). Thermal cycling conditions began with 8 minutes at 95°C followed by 45 cycles of 10 seconds at 95°C and 40 seconds at 60°C. Data were analyzed with LightCycler 480 1.5.0 SP1 software. WT and RGD specific primers were confirmed to only amplify the virus being tested (data not shown).

Immunohistochemistry

After being transported to the laboratory, DMSO (Sigma Aldrich) was added to ascites specimens containing tumor cells to reach 5% and immediately frozen at −80°C until assays and analysis commenced. Upon thawing, cells were suspended in cell culture media (Sigma Aldrich). Cell suspensions of ascites were used to prepare at least two cytospin slides per sample using the ThermoShandon 3 Cytospin at 2,000 rpm for 10 minutes at room temperature. After the cytospin, slides were removed and fixed in 70% ethanol overnight (Sigma Aldrich). Slides were incubated with rabbit polyclonal anti-hexon antibody (Abcam) at a dilution of 1:2,000 and CC-49 anti-Tag72 antibody (provided by M.B. Khazaeli, PhD, University of Alabama at Birmingham) at a dilution of 5 μg/μL for 1 hour. CC-49 anti-Tag72 antibody is an antibody to a tumor associated glycoprotein known to be expressed by ovarian cancer cells (15). Anti-hexon is an anti-adenovirus antibody. Negative controls were done by omitting primary antibodies. Ascites cells from patients untreated with adenovirus were used to confirm that, in the absence of adenovirus, staining with anti-hexon is negative. Ascites cells from patients not in this trial were treated ex vivo with adenovirus and stained with anti-hexon antibody to confirm that anti-hexon will detect present adenovirus (supplementary data; Fig. 1). Secondary antibodies Alexafluor 488 (Invitrogen) and Alexafluor 594 (Invitrogen) were incubated at 1:100 for 1 hour in PBS. Slides were then mounted with 0.25% Propyl Gallate in a 9:1 (v/v) glycerol:PBS solution to prevent photobleaching (Sigma Aldrich). Fluorescence microscopy was done with an inverted IX-70 microscope (Olympus) equipped with a Magnifire digital CCD camera (Optronics) or a DP71 digital camera (Olympus). All images were at 40× magnification. The images of fluorescent signals for tumor cells and adenovirus were merged using Adobe Photoshop CS.

Fig. 1.

Quantification of Ad5-Δ24-RGD in ascites/peritoneal lavage samples (A) and immunohistochemical evidence of colocalization of Ad5-Δ24-RGD and ovarian cancer cells (B). A, using real-time quantitative PCR, Ad5-Δ24-RGD copy numbers were quantified in each patient's lavage samples (in triplicate) on days 0, 3, 7, 14, and 28. P, patient. B, representative immunohistochemical stains of ascites from selected patients are depicted. Original magnification, ×40. Top, localization of Tag72, an antibody to a tumor associated glycoprotein known to be expressed by ovarian cancer cells. Middle, localization of anti-hexon antibody, an anti-adenovirus antibody. Bottom, a digital overlay of the two previous images. On day 0, green fluorescence shows the presence of ovarian cancer cells, whereas the anti-adenovirus staining shows only background red fluorescence. Some red background fluorescence is present in adenovirus negative cells. Representative images shown after treatment contain cells that stain for the tumor marker and adenovirus.

Fig. 1.

Quantification of Ad5-Δ24-RGD in ascites/peritoneal lavage samples (A) and immunohistochemical evidence of colocalization of Ad5-Δ24-RGD and ovarian cancer cells (B). A, using real-time quantitative PCR, Ad5-Δ24-RGD copy numbers were quantified in each patient's lavage samples (in triplicate) on days 0, 3, 7, 14, and 28. P, patient. B, representative immunohistochemical stains of ascites from selected patients are depicted. Original magnification, ×40. Top, localization of Tag72, an antibody to a tumor associated glycoprotein known to be expressed by ovarian cancer cells. Middle, localization of anti-hexon antibody, an anti-adenovirus antibody. Bottom, a digital overlay of the two previous images. On day 0, green fluorescence shows the presence of ovarian cancer cells, whereas the anti-adenovirus staining shows only background red fluorescence. Some red background fluorescence is present in adenovirus negative cells. Representative images shown after treatment contain cells that stain for the tumor marker and adenovirus.

Close modal

Evaluation of viral shedding

Viral DNA from urine specimens was isolated with a QIAamp Viral RNA Mini Kit (QIAGEN) after being concentrated with Millipore Amicon Ultra-4 and Amicon Ultra-15 Centrifugal Filter Units. Viral DNA from saliva specimens was isolated using a QIAampMinElute Virus Spin Kit (QIAGEN), following the manufacturer's instructions. Viral DNA from sera specimens was isolated with the DNeasy Tissue Kit's blood protocol (QIAGEN). One microliter from resultant samples were used as a template for real-time quantitative PCR because many of these samples lacked genomic DNA for normalization of results. We amplified a fragment of RGD with forward primer CACACTAAACGGTACACAGGAAACA, reverse primer ATGCAGATGGGCAGAAACAGT, and probe 6-FAM-AGACACAACTTGTGACTGCCGCGG-BHQ-1 (Sigma Aldrich). Real-time quantitative PCR conditions were similar to those previously described to evaluate viral infection, CRAd replication, and generation of WT virus.

Evaluation of an anti-adenovirus neutralizing antibody response

For evaluation of induced anti-adenovirus neutralizing antibodies response in serum and ascites specimens after treatment, a nonreplicative luciferase expressing virus, Ad5-RGD-Luc1, was neutralized by either serum or ascites before infection of SKOV3.ip1 cells. SKOV3.ip1 cells are a cell line derived from the implantation of SKOV3 cells (American Type Culture Collection) in nude mice. These cells were last tested and authenticated for epithelial staining through pooled AE1/AE3 antibody in December 2009. These antibodies stain normal and neoplastic cells of epithelial origin.

Following neutralization in respective samples, Ad5-RGD-Luc1 transduction efficacy was determined by a luciferase assay. Triplicates of SKOV3.ip1 cells were plated into 96-well plates (10,000 per well) and allowed to grow overnight before infection. A 1:2 dilution of serum or ascites of each day point specimen was prepared in Opti-MEM (Media Preparation Shared Facility, University of Alabama at Birmingham) in a normalized volume. Nonreplicative Ad5-RGD-Luc1 at 100 plaque-forming unit per cell was mixed with each dilution for 30 minutes at room temperature before adding to appropriate wells. This infection was allowed to proceed for 48 hours. A luciferase assay was carried out using a luciferase assay system (Promega) on an Orion microplate luminometer (Berthold) reading Culturplate-96 (Research Parkway) according to manufacturer's protocols.

Statistical analysis

Demographic and baseline characteristics of the treated patients are summarized descriptively. The incidence of adverse events and laboratory tests are also briefly summarized respectively. For the analysis of biological effects, a repeated measures ANOVA was used to compare baseline values to the other study day values. The raw data were transformed into logarithms to the base 10 to meet the normality assumption before statistical testing.

Patient demographics

From 2007 to 2009, 26 patients were consented to participate. Five of these patients were not treated with Ad5-Δ24-RGD: three patients were ineligible due to leucopenia, thrombocytopenia, or abnormal liver function tests on screening, respectively. Two additional patients had i.p. catheter placement complications that did not allow for i.p. administration of the study CRAd. A total of 21 patients were successfully treated in seven dose levels per study guidelines.

Study demographics for treated patients are provided in Table 1. In summary, the median and mean age of the treated patients were 66 and 65.2 years, respectively (range, 47-83 y). Ninety percent were Caucasian, and 86% had recurrent ovarian cancer. The median and mean number of previous chemotherapy treatments was 3 and 3.4, respectively (range, 1-7).

Table 1.

Selected demographics of treated patients

Pt IDAgeRaceGOG scoreCancerOriginal stageHistologyPrevious regimens
65 Ovarian 3c Serous 
77 Ovarian 3c Serous 
54 Ovarian 3b Endometrioid 
52 Ovarian 3c Serous 
54 Ovarian 3c Serous 
70 Ovarian 3c Serous 
47 Ovarian 3c Serous 
71 Ovarian 3c Serous 
67 Ovarian 3c Serous 
10 72 Ovarian 3c Serous 
11 83 Ovarian 3c Serous 
12 75 Endometrial 3a Endometrioid 
13 64 Ovarian 3b clear cell 
14 57 Ovarian 2c Endometrioid 
15 65 Ovarian 3c Serous 
16 77 Ovarian 3c Serous 
17 68 Ovarian 3b Serous 
18 61 Ovarian Serous 
19 66 Ovarian 3c Serous 
20 53 Endometrial Endometrioid 
21 72 Peritoneal 3c Serous 
Pt IDAgeRaceGOG scoreCancerOriginal stageHistologyPrevious regimens
65 Ovarian 3c Serous 
77 Ovarian 3c Serous 
54 Ovarian 3b Endometrioid 
52 Ovarian 3c Serous 
54 Ovarian 3c Serous 
70 Ovarian 3c Serous 
47 Ovarian 3c Serous 
71 Ovarian 3c Serous 
67 Ovarian 3c Serous 
10 72 Ovarian 3c Serous 
11 83 Ovarian 3c Serous 
12 75 Endometrial 3a Endometrioid 
13 64 Ovarian 3b clear cell 
14 57 Ovarian 2c Endometrioid 
15 65 Ovarian 3c Serous 
16 77 Ovarian 3c Serous 
17 68 Ovarian 3b Serous 
18 61 Ovarian Serous 
19 66 Ovarian 3c Serous 
20 53 Endometrial Endometrioid 
21 72 Peritoneal 3c Serous 

NOTE: GOG score is a performance score system.

Abbreviations: Pt, patient; C, Caucasian, A, African American.

Toxicity associated with i.p. delivery of Ad5-Δ24-RGD

One consented patient experienced grade 3 abdominal pain and grade 3 infection related to her i.p. catheter but was not treated with Ad5-Δ24-RGD and not included in final analysis of reagent specific toxicities. Table 2 provides a summary of clinical and laboratory adverse events by severity as reported on scheduled study visits for patients treated with Ad5-Δ24-RGD. No Ad5-Δ24-RGD–related grade 3 or 4 clinical or laboratory toxicities were observed. The most common clinical toxicities listed as “possible,” “probable,” or “definitely” attributable to the Ad5-Δ24-RGD were limited to grade 1 or 2 constitutional symptoms (fever or fatigue) and gastrointestinal/pain symptoms (abdominal pain). The most common laboratory abnormalities included anemia and abnormalities of glucose not thought to be associated with viral administration. Four treated patients experienced a total of 10 grade 3 toxicities. One patient had grade 3 shortness of breath and grade 3 chest pain due to a disease related pleural effusion. Two patients experienced grade 3 nausea and vomiting, dehydration, and bowel obstruction symptoms related to their underlying disease. One patient experienced grade 3 hypokalemia related to nausea and vomiting. Listed grade 3 toxicities were “not” or “unlikely” to be attributed to the study vector. There were no grade 4 or 5 toxicities encountered. No vector-associated DLTs were noted and the MTD of Ad5-Δ24-RGD was not identified.

Table 2.

Clinical (A) and laboratory (B) toxicity in patients treated with Ad5-Δ24-RGD by category and grade

A
Toxicity grades (NCI CTC V.3)Total occurrences
1234
Body system 
    Gastrointestinal 61 34 101 
    Constitutional 18 24 
    Pain 10 19 
    Neurology 
    Infection 
    Dermatology/skin 
    Cardiac general 
    Lymphatics 
    Musculoskeletal 
    Allergy/immunology 
    Syndromes 
    Respiratory 
    Renal/genitourinary 
    Blood/bone marrow 
    Cardiac arrhythmia 
 
B 
Laboratory tests 
    Hemoglobin 42 49 
    Hematocrit 34 12 46 
    Glucose 24 29 
    Potassium 11 14 
    LDH 10 
    Creatinine 
    Gamma-glutamyl transpeptidase 
    WBC 
    Sodium 
    Alkaline phosphatase 
    Calcium 
    Phosphorous 
    Bicarbonate 
    Chloride 
    Blood urea nitrogen 
    Total bilirubin 
    Uric acid 
    Platelet 
A
Toxicity grades (NCI CTC V.3)Total occurrences
1234
Body system 
    Gastrointestinal 61 34 101 
    Constitutional 18 24 
    Pain 10 19 
    Neurology 
    Infection 
    Dermatology/skin 
    Cardiac general 
    Lymphatics 
    Musculoskeletal 
    Allergy/immunology 
    Syndromes 
    Respiratory 
    Renal/genitourinary 
    Blood/bone marrow 
    Cardiac arrhythmia 
 
B 
Laboratory tests 
    Hemoglobin 42 49 
    Hematocrit 34 12 46 
    Glucose 24 29 
    Potassium 11 14 
    LDH 10 
    Creatinine 
    Gamma-glutamyl transpeptidase 
    WBC 
    Sodium 
    Alkaline phosphatase 
    Calcium 
    Phosphorous 
    Bicarbonate 
    Chloride 
    Blood urea nitrogen 
    Total bilirubin 
    Uric acid 
    Platelet 

Abbreviations: LDH, lactate dehydrogenase; WBC, white blood cells.

Clinical efficacy associated with i.p. delivery of Ad5-Δ24-RGD

Of the 21 treated patients, 19 had measureable disease and were evaluable for best response using RECIST criteria one month following Ad5-Δ24-RGD treatment. Fourteen patients had stable disease, and five patients had progressive disease. There were no partial or complete responses noted. Two additional patients had evaluable but nonmeasurable disease; one had stable disease and one had progressive disease 1 month following Ad5-Δ24-RGD treatment (Table 3).

Table 3.

Best response by RECIST criteria and CA-125 values

Pt IDDose cohort (vp/d)Best responseCA-125 (units/mL) pre/postCA-125
1 × 109 SD 1390/1060 Decrease* 
1 × 109 SD 164/278 Increase 
1 × 109 SD 52/56 Increase 
5 × 109 PD 505/1148 Increase 
5 × 109 SD 1540/2261 Increase 
5 × 109 SD 914/424 Decrease* 
1 × 1010 PD 618/854 Increase 
1 × 1010 SD 112/231 Increase 
1 × 1010 PD 429/286 Decrease* 
10 5 × 1010 SD 11/24 Increase 
11 5 × 1010 PD 1103/1662 Increase 
12 5 × 1010 SD 1092/967 Decrease 
13 1 × 1011 PD 1339/1128 Decrease 
14 1 × 1011 PD 47/79 Increase 
15 1 × 1011 SD 187/131 Decrease* 
16 5 × 1011 SD 166/247 Increase 
17 5 × 1011 PD 3044/5774 Increase 
18 5 × 1011 SD 46/90 Increase 
19 1 × 1012 SD 64/153 Increase 
20 1 × 1012 SD 158/129 Decrease 
21 1 × 1012 SD 992/NA N/A 
Pt IDDose cohort (vp/d)Best responseCA-125 (units/mL) pre/postCA-125
1 × 109 SD 1390/1060 Decrease* 
1 × 109 SD 164/278 Increase 
1 × 109 SD 52/56 Increase 
5 × 109 PD 505/1148 Increase 
5 × 109 SD 1540/2261 Increase 
5 × 109 SD 914/424 Decrease* 
1 × 1010 PD 618/854 Increase 
1 × 1010 SD 112/231 Increase 
1 × 1010 PD 429/286 Decrease* 
10 5 × 1010 SD 11/24 Increase 
11 5 × 1010 PD 1103/1662 Increase 
12 5 × 1010 SD 1092/967 Decrease 
13 1 × 1011 PD 1339/1128 Decrease 
14 1 × 1011 PD 47/79 Increase 
15 1 × 1011 SD 187/131 Decrease* 
16 5 × 1011 SD 166/247 Increase 
17 5 × 1011 PD 3044/5774 Increase 
18 5 × 1011 SD 46/90 Increase 
19 1 × 1012 SD 64/153 Increase 
20 1 × 1012 SD 158/129 Decrease 
21 1 × 1012 SD 992/NA N/A 

Abbreviations: SD, stable disease; PD, progressive disease.

*>20% decrease in CA-125.

Nonmeasurable disease by RECIST criteria.

Seven of 20 evaluable patients had decrease in CA-125 from pretreatment values to day 29 values; one patient did not have a posttreatment CA-125 level drawn (Table 3). Four of these patients had a >20% drop in CA-125 levels. Five of these seven patients had stable disease by RECIST criteria; the other two patients were noted to have progressive disease.

Viral infection and replication

At time points specified in the methods, before and after Ad5-Δ24-RGD administration, peritoneal lavage samples were obtained from each patient and evaluated for the presence of Ad5-Δ24-RGD through real-time quantitative PCR. All patient specimens were positive for cellular DNA. Any value >1 RGD copy number per nanogram of cellular DNA was considered positive. By day 3 (after treatment), 16 of the 21 patients had RGD-specific DNA detected (Fig. 1A) after Ad5-Δ24-RGD treatment was completed. In seven patients (patients 5, 6, 7, 8, 9, 11, and 20), the detected copy number of RGD specific virus increased at time points after Ad5-Δ24RGD treatment. Although rigorous statistical evaluation was not feasible given the limited sample numbers, these data suggest that replication of Ad5-Δ24-RGD may have occurred in these patients. Qualitative evidence of viral localization within cancer cells is depicted in representative ascites samples using immunohistochemistry. Images of select patient samples depict the presence of Ad5-Δ24-RGD even at day 28 (Fig. 1B).

Generation of WT virus

In general, generation of replication competent WT adenovirus (RCA) was minimal. WT E1 was detected in ascites specimens of eight patients, four of which had detectable WT E1 before Ad5-Δ24-RGD administration. Only one patient had >25 copies of WT E1 DNA per nanogram of DNA following administration of Ad5-Δ24-RGD. Specifically, patient 20, in the highest dose cohort, had an elevated level of WT E1 DNA (62 copies per nanogram DNA) detected before administration of Ad5-Δ24-RGD and had 549 copies per nanogram DNA detected on day 28. Interestingly, this patient also reported upper respiratory symptoms before vector administration.

Viral shedding

At specified time points before and after Ad5-Δ24-RGD administration, serum, saliva, and urine were obtained from each patient to assess for viral shedding (Fig. 2). These data were normalized to day 0 RGD copies, and any value <1 copy RGD per microliter was considered negative. RGD-specific virus was detected in serum samples from 10 patients as shown in Fig. 2A. Figure 2B shows the presence of RGD copies in saliva samples from 10 patients. Viral shedding was detected in urine samples from nine patients (Fig. 2C). In general, viral shedding was noted more frequently and, to a greater extent, in patients in higher dose cohorts and in the saliva.

Fig. 2.

Quantification of Ad5-Δ24-RGD in serum (A), saliva (B), and urine (C). Using RT-PCR, Ad5-Δ24-RGD copy numbers were quantified in each patient's serum (A), saliva (B), and urine (C) samples on days 0, 3, 7, 14, and 28.

Fig. 2.

Quantification of Ad5-Δ24-RGD in serum (A), saliva (B), and urine (C). Using RT-PCR, Ad5-Δ24-RGD copy numbers were quantified in each patient's serum (A), saliva (B), and urine (C) samples on days 0, 3, 7, 14, and 28.

Close modal

Anti-adenovirus neutralizing antibody

At specified time points before and after Ad5-Δ24-RGD administration, an anti-adenoviral neutralizing antibody response was determined in serum and ascites (Fig. 3). Overall, neutralizing antibody effects in serum and ascites were consistent and dose dependent. Following exposure to day 14 sera and ascites samples, infection of Ad5-RGD-luc was, in general, significantly limited, and by day 28, evidence of transduction was minimal. Neutralizing antibody effects were present in all patients, and when all data points from all patients for days 0 and 3 were compared with all data points for all patients for days 14 and 28, the effects of neutralizing antibody were significantly higher by day 14 and beyond (P < 0.0001).

Fig. 3.

Assessment of anti-adenoviral neutralizing antibody response in serum (A) and ascites (B). Assessment of induced anti-adenovirus neutralizing antibody response after treatment was carried by exposing a nonreplicative luciferase expressing virus, Ad5-RGD-Luc1, to either patient serum (A) or ascites (B) before infection of SKOV3.ip1 cells. Following neutralization in respective samples, Ad5-RGD-Luc1 transduction efficacy was determined by a luciferase assay. Each treatment cohort's mean response is documented here in addition to a negative control represented by “No sera” or “No ascites.” RLU, relative light units.

Fig. 3.

Assessment of anti-adenoviral neutralizing antibody response in serum (A) and ascites (B). Assessment of induced anti-adenovirus neutralizing antibody response after treatment was carried by exposing a nonreplicative luciferase expressing virus, Ad5-RGD-Luc1, to either patient serum (A) or ascites (B) before infection of SKOV3.ip1 cells. Following neutralization in respective samples, Ad5-RGD-Luc1 transduction efficacy was determined by a luciferase assay. Each treatment cohort's mean response is documented here in addition to a negative control represented by “No sera” or “No ascites.” RLU, relative light units.

Close modal

This report serves as one of the first published reports evaluating an infectivity enhanced virotherapy approach for the treatment of patients with cancer. Specifically, this study evaluated i.p. administration of the infectivity enhanced CRAd Ad5-Δ24-RGD in a previously heavily treated cohort of patients with recurrent ovarian or endometrial cancer. A single 3-day cycle of Ad5-Δ24-RGD in dosages ranging from 1 × 109 to 1 × 1012 vp/d was administered to treated patients. The most commonly noted Ad5-Δ24-RGD–related toxicity consisted of primarily grade 1 and 2 constitutional and gastrointestinal symptoms. Most grade 3 toxicities noted were in general disease related and not associated with Ad5-Δ24-RGD treatment. No grade 4 toxicities were reported. Manufacturing constraints limited the ability to administer higher dosages of Ad5-Δ24-RGD. Thus, the MTD was not identified and the maximum feasible dose in this study was identified to be 1 × 1012 vp/d for 3 days.

Although not a primary aim of this study, there was some suggestion of potential antitumor activity associated with Ad5-Δ24-RGD treatment. Specifically, 14 of the 21 patients were noted to have stable disease by RECIST criteria over the month of observation following administration of Ad5-Δ24-RGD. Of note, four patients experienced a >20% decline in CA-125 levels, a common marker of overall disease burden for advanced ovarian and endometrial cancers. There did not seem to be a dose related response.

Our ancillary studies provided potential evidence of Ad5-Δ24-RGD replication and other important insights about the biological effects of i.p. administration of Ad5-Δ24-RGD. Specifically, Ad5-Δ24-RGD specific DNA was detected at various time points after treatment in 16 of the 21 patients. In seven of these patients, higher quantities of Ad5-Δ24-RGD specific DNA was noted after day 3 of Ad5-Δ24-RGD treatment and could potentially be attributed to replication of the virus within the abdominal cavity. Ad5-Δ24-RGD specific viral shedding was noted in serum, urine, and saliva. Shedding was highest in saliva and seemed to be dose dependant. This noted level of shedding and tropism for the upper respiratory tract is not inconsistent with what has been documented in other adenoviral-based, gene therapy-based trials (1517). In addition, the generation of WT adenovirus (>25 copies per nanogram DNA) was minimal and was not detected in Ad5-Δ24-RGD–treated patients at a dose of <5 × 1010 vp/d. One patient had elevated levels of WT adenovirus (>50 copies before administration and on day 28); this patient was noted to have clinical evidence of an upper respiratory tract infection at the time. Lastly, anti-adenovirus neutralizing antibodies were uniformly present in serum and ascites samples from most patients and noted to be significant 14 days after Ad5-Δ24-RGD treatment. This neutralizing anti-adenoviral antibody response is similar to what has been noted in other adenoviral based trials (18, 19). However, evidence of potential Ad5-Δ24-RGD replication noted in this study and in previous preclinical studies may point toward diminished interaction of neutralizing antibodies with RGD-modified adenoviruses. These findings may also show the potential ability of this infectivity-enhanced modified CRAd to abrogate immunologic interactions that would mitigate potential antitumor activity (20). Additional studies evaluating the effect of Ad5-Δ24-RGD on other immunologic variables are planned and a clinical trial evaluating intracranial administration of Ad5-Δ24-RGD in patients with malignant glioblastoma is currently in progress.

Two other virotherapy approaches have been evaluated in the context of recurrent ovarian cancer. ONYX-015, the first CRAd to be evaluated in this disease context, has a E1B gene deletion that allows for conditional replication in p53 deficient tumor cells but does not have any modification that allow for improved ovarian cancer cell transfection (7). In this phase I study, patients were treated through IP ONYX-015 in dose cohorts up to 1 × 1011 plaque-forming unit daily for 5 days every 4 weeks. A total of 35 cycles was administered to 16 treated patients with a median of two cycles per patient. Only one DLT (grade 3 abdominal pain and diarrhea) was noted, and the MTD was not identified. Four of the 16 patients exhibited stable disease as a best response and one patient exhibited a significant drop in her serum CA-125. Five of eight evaluable patients had PCR detectable ONYX-015 DNA in peritoneal lavage specimens 10 days following the last administration. Interestingly, one patient had specific DNA detectable 354 days following her last treatment. Despite this unique finding, the capacity to document any evidence of replication was limited because of the inability to quantitatively show increased ONYX-015–specific DNA remote from administration. All eight tested patients had undetectable levels of ONYX-015 DNA in their serum. As noted in the current study, nearly all patients had very high levels of neutralizing antibodies develop over the course of the evaluation period (7).

In a similar approach, Galanis et al. (21) evaluated a replicative-competent Edmonston B measles vaccine strain, MV-CEA, in a phase I trial for patients with recurrent ovarian cancer. MV-CEA capitalizes on the overexpression of the measles virus receptor CD46 in tumor cells and is modified to express the soluble marker peptide carcinoembryonic antigen (CEA). Eligible ovarian cancer patients were treated i.p. with MV-CEA monthly for up to six doses in dosages ranging from 103 to 109 TCID50 (median tissue culture infective dose). A total of 126 cycles were administered to a total of 21 patients with a median number of six cycles per patient. Minimal toxicities were noted, and the MTD was not identified. Fourteen of the 21 patients experienced durable stable disease as a best response. An apparent dose dependant response was noted with higher dose cohorts having higher rates of stable disease. CA-125 levels were noted to have decreased >30% in 5 of 21 patients. CEA elevation was detected in the peritoneal fluid of one patient and in the serum of three patients in the highest dose cohort. Evidence of MV-CEA viral DNA in the serum was detected in four patients by quantitative RT-PCR. No MV-CEA specific shedding was noted in urine or saliva. No development of anti-measles or anti-CEA antibodies was detected (21).

The results of these previous studies show the feasibility to deliver relatively high dosages of conditionally replicative viruses i.p. in patients with recurrent ovarian cancer with good tolerance. The current study shows for the first time the ability to deliver an infectivity enhanced CRAd (Ad5-Δ24-RGD) at high dosages in a similar cohort. Clinical trials evaluating Ad5-Δ24-RGD in the context of multiple cycles of Ad5-Δ24-RGD at the maximum feasible dose (1 × 1012 vp/d × 3 d) and evaluating Ad5-Δ24-RGD in combination with chemotherapy in patients with recurrent ovarian cancer are in development. Preclinical studies (22) and ongoing clinical trials support the feasibility of a combination virotherapy and chemotherapy approach (23).

The importance of the rationale for the use of infectivity enhancement and the consequent improvement in overall antitumor potential cannot be understated because we strive to forward the utility of adenoviral virotherapy. The culmination of rigorous preclinical work (912) in a RAC-guided preclinical safety trial (13) led to a fully vetted tropism-modified and conditionally replicative virus for use in this unique clinical trial. Hopefully, this previous research, in concert with the findings of the current trial, serves to establish a precedent for the safety of tropism-modified adenoviral vectors and will open the door for clinical use of future enhancements in CRAd therapy.

Other strategies designed to improve the potential therapeutic index of adenoviral based virotherapy have been evaluated in vitro and in vivo. These include, for example, the arming of CRAds (24), incorporation of tissue specific promoters (25), novel means to assess virus trafficking (26), the development of new serotype chimeric modifications to further enhance infectivity (27, 28), and the assessment of stem cell delivery mechanisms for CRAds (29). Clinical translation of several of these approaches into early phase clinical trials is ongoing or in development.

In summary, this study serves as the first clinical trial to evaluate an infectivity-enhanced CRAd in patients with recurrent ovarian and other selected gynecologic cancers and provides guidance for the future development of Ad5-Δ24-RGD and other infectivity-enhanced virotherapeutics intended for the treatment of cancer.

D.T. Curiel has ownership interests and consultative roles in VectorLogics, Inc.

We thank Jolane Gable, RN; Michael Ann Markiewicz, PharmD; and the staff of the Participant and Clinical Interactions Resources unit of the Center for Clinical and Translational Science at the University of Alabama at Birmingham for their care of patients with malignant gynecologic diseases and support of this research.

Grant Support: Federal funds from the NCI, NIH, under contract no. N01-CO-12400 and the Developmental Therapeutics Program in the Division of Cancer Treatment and Diagnosis of the NCI (R.D. Harris); NIH grants 5R01CA121187, NCI R21 CA128222, and NCI P50-CA83591 (D.T. Curiel); and NIH grants NCI R21 CA128222 and NCI P50-CA83591 (R.D. Alvarez).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Brinton
LA
,
Lacey
JV
,
Sherman
ME
. 
Epidemiology of gynecologic cancers
. In:
Hoskins
WJ
,
Perez
CJ
,
Young
RC
, et al
, editors.
Principles and practice of gynecologic oncology
. 4th ed
Philadelphia (PA)
:
Lippincott-Raven
; 
2005
, p.
3
32
.
2
Liu
TC
,
Galanis
E
,
Kirn
D
. 
Clinical trial results with oncolytic virotherapy: a century of promise, a decade of progress
.
Nat Clin Pract
2007
;
4
:
101
17
.
3
Kimball
KJ
,
Numnum
TM
,
Rocconi
RP
,
Alvarez
RD
. 
Gene therapy for ovarian cancer
.
Curr Oncol Rep
2006
;
6
:
441
7
.
4
Alemany
R
,
Balague
C
,
Curiel
D
. 
Replicative adenovirus for cancer therapy
.
Nat Biotechnol
2000
;
18
:
723
7
.
5
Agarwal
R
,
Linch
M
,
Kaye
SB
. 
Novel therapeutic agents in ovarian cancer
.
Eur J Surg Oncol
2006
;
32
:
875
86
.
6
Niederacher
D
,
Yan
HY
,
An
HX
,
Bender
HG
,
Beckman
MW
. 
CDKN2 gene inactivation in epithelial sporadic ovarian cancer
.
Br J Cancer
1999
;
80
:
1920
6
.
7
Vasey
PA
,
Schulman
LN
,
Campos
S
, et al
. 
Phase I trial of intraperitoneal injection of the E1-55kd-gene deleted adenovirus ONYX-015 (dl1520) given on days 1 through 5 every 3 weeks in patients with recurrent/refractory epithelial ovarian cancer
.
J Clin Oncol
2002
;
20
:
1562
9
.
8
Neumunaitis
J
,
Cunningham
C
,
Buchanan
A
, et al
. 
Intravenous infusion of a replication-selective adenovirus (ONYX-015) in cancer patients: safety, feasibility, and biological activity
.
Gene Ther
2001
;
8
:
746
59
.
9
Douglas
JT
,
Kim
M
,
Sumerel
LA
,
Carey
DE
,
Curiel
DT
. 
Efficient oncolysis by a replicating adenovirus (ad) in vivo is critically dependant on tumor expression of primary Ad receptors
.
Ca Res
2001
;
61
:
813
7
.
10
Dmitriev
I
,
Krasnykh
V
,
Miller
CR
, et al
. 
An adenovirus vector with genetically modified fibers demonstrates expanded tropism via utilization of a coxsackievirus and adenovirus receptor-independent cell entry mechanism
.
Virol
1999
;
72
:
9706
13
.
11
Vanderkwaak
T
,
Wang
M
,
Navarro
J
, et al
. 
An advanced generation of adenoviral vectors selectively enhances gene transfer for ovarian cancer gene therapy approaches
.
Gynecol Oncol
1999
;
74
:
227
34
.
12
Bauerschmitz
G
,
Lam
J
,
Kanerva
A
, et al
. 
Treatment of ovarian cancer with a tropism modified oncolytic adenovirus
.
CA Res
2002
;
62
:
1266
9
.
13
Page
JG
,
Tian
B
,
Schweikart
K
, et al
. 
Identifying the safety profile of a novel infectivity-enhanced conditionally replicative adenovirus, Ad5-24-RGD, in anticipation of a phase I trial for recurrent ovarian cancer
.
Am J Obstet Gynecol
2007
;
196
:
389e1
10
.
14
Suzuki
K
,
Alemany
R
,
Yamamoto
M
,
Curiel
DT
. 
The presence of the adenovirus E3 region improves the oncolytic potency of conditionally replicative adenoviruses
.
Clin Cancer Res
2002
;
8
:
3348
59
.
15
Ponnusamy
MP
,
Venkatraman
G
,
Singh
AP
, et al
. 
Expression of TAG-72 in ovarian cancer and its correlation with tumor stage and patient prognosis
.
Cancer Lett
2007
;
251
:
247
57
.
16
Schenk-Braat
EA
,
van Mierlo
MM
,
Wagemaker
G
,
Bangma
CH
,
Kaptein
LC
. 
An inventory of shedding data from clinical gene therapy trials
.
J Gene Med
2007
;
9
:
910
21
.
17
Kawahira
H
,
Matsushita
K
,
Shiratori
T
, et al
. 
Viral shedding after p53 adenoviral gene therapy in 10 cases of esophageal cancer
.
Cancer Sci
2010
;
101
:
289
91
.
18
Alvarez
RD
,
Barnes
MN
,
Gomez-Navarro
J
, et al
. 
A cancer gene therapy approach utilizing an anti-erbB-2 single-chain antibody-encoding adenovirus (AD21): a phase I trial
.
Clin Can Res
2000
;
6
:
3081
7
.
19
Barnett
BG
,
Crews
CJ
,
Douglas
JT
. 
Targeted adenoviral vectors
.
Biochim Biophys Acta
2002
;
1575
:
1
14
.
20
Blackwell
J
,
Li
H
,
Navarro
J
, et al
. 
Circumventing inhibitory factors in ascites fluid using a tropism modified adenoviral vector
.
Hum Gene Ther
2000
;
11
:
1657
69
.
21
Galanis
E
,
Hartmann
LC
,
Cliby
WA
, et al
. 
Phase I trial of intraperitoneal administration of an engineered strain of measles virus, modified to express carcinoembryonic antigen for recurrent ovarian cancer
.
Can Res
2010
;
70
:
875
82
.
22
Hemminki
A
,
Belousova
N
,
Zinn
K
, et al
. 
An adenovirus with enhanced infectivity mediates molecular chemotherapy of ovarian cancer cells and allows imaging of gene expression
.
Mol Ther
2001
;
4
:
223
31
.
23
Opyrchal
M
,
Aderca
I
,
Galanis
E
. 
Phase I clinical trial of locoregional administration of the oncolytic adenovirus ONYX-015 in combination with mitomycin-C, doxorubicin, and cisplatin chemotherapy in patients with advanced sarcomas
.
Methods Mol Biol
2009
;
542
:
705
17
.
24
Cody
JJ
,
Douglas
JT
. 
Armed replicating adenoviruses for cancer virotherapy
.
Cancer Gene Ther
2009
;
16
:
473
88
.
25
Rocconi
RP
,
Zhu
ZB
,
Stoff-Khalili
M
, et al
.
Gynecol Oncol
2007
;
105
:
113
21
.
26
Kimball
KJ
,
Rivera
AA
,
Zinn
KR
, et al
. 
Novel infectivity-enhanced oncolytic adenovirus with a capsid-incorporated dual-imaging moiety for monitoring virotherapy in ovarian cancer
.
Mol Imaging
2009
;
8
:
264
77
.
27
Bauerschmitz
GJ
,
Guse
K
,
Kanerva
A
, et al
. 
Triple-targeted oncolytic adenoviruses featuring the Cox2 promoter, E1A transcomplementation, and serotype chimerism for enhanced selectivity for ovarian cancer cells
.
Mol Ther
2006
;
14
:
164
74
.
28
Stoff-Khalili
MA
,
Rivera
AA
,
Glascow
JN
, et al
. 
A human adenoviral vector with a chimeric fiber from a canine adenovirus type 1 results in novel expanded tropism for cancer therapy
.
Gene Ther
2005
;
12
:
1696
706
.
29
Yong
RL
,
Shinojima
N
,
Fueyo
J
, et al
. 
Human bone marrow-derived mesenchymal stem cells for intravascular delivery of oncolytic adenovirus Delta24-RGD to human gliomas
.
Cancer Res
2009
;
69
:
8932
40
.