Blocking Vascular Endothelial Growth Factor-A Inhibits the Growth of Pituitary Adenomas and Lowers Serum Prolactin Level in a Mouse Model of Multiple Endocrine Neoplasia Type 1

Angiogenesis, the formation of a refined vascular network by endothelial cell sprouting from preexisting vessels, is essential for embryonic development and for the growth of normal adult tissues (1, 2). Angiogenesis is also required for wound healing and reproductive function. It is now well established that angiogenesis also plays an important role in the pathogenesis of several disorders (3, 4). Endocrine glands are highly vascularized organs, reflecting the need to rapidly deliver hormones in the bloodstream and respond to regulatory feedbacks, and several angiogenic factors have been described in normal and neoplastic glands (reviewed in ref. 5). These include members of the vascular endothelial growth factor (VEGF) and fibroblast growth factor families (5) and the recently described EG-VEGF (6–8). One of the best characterized positive regulators of angiogenesis is VEGF-A (9). In mammals, VEGF-A belongs to a gene family also including VEGF-B, VEGF-C, VEGF-D, and PlGF (10). VEGF-A primarily binds to two high-affinity receptor tyrosine kinases, VEGF receptor (VEGFR)-1 (Flt-1) and VEGFR-2 (Flk-1/KDR), the latter being the major transmitter of vascular endothelial cell mitogenic signals of VEGF-A (11, 12).

Multiple endocrine neoplasia (MEN) is a disorder characterized by the incidence of tumors involving two or more endocrine glands (13). A patient is classified with MEN type 1 (MEN1) when a combined occurrence of tumors in the parathyroid glands, the pancreatic islet cells, and the anterior pituitary is identified (14). Mutations in MEN1 gene were discovered to underlie the disorder (15), which commonly result in a truncation or absence of the protein menin (reviewed in ref. 16). With the added finding of a frequent loss of the remaining allele in the tumors (17–19), MEN1 has been classified as a tumor suppressor gene. Whereas MEN1 is largely inherited as an autosomal dominant disorder, de novo mutations of MEN1 gene have been identified as the cause of sporadic cases of MEN1.

The function of menin remains unclear. The ubiquitously expressed, predominantly nuclear 610-amino-acid protein has been suggested to be involved in transcriptional regulation, DNA processing and repair, and cytoskeletal organization through its in vitro interactions with proteins that are part of the pathways mentioned above (reviewed in ref. 20). None of the protein interactions identified thus far, however, provide an explanation to the tumorigenicity in MEN1.

Current standard of treatment for neuroendocrine pancreatic tumors (in some clinical series, >50% are gastrinomas and 10-30% are insulinomas) is reduction of basal acid output in the case of gastrinomas, whereas surgery is seen as the optimal treatment for insulinomas. The treatment for pituitary tumors consists of selective surgery with varying medical therapy depending on the hormonal profile, whereas the definitive treatment for parathyroid tumors is a surgical removal of the overactive gland. However, there is variability to the degree and timing of the parathyroidectomy (21). The latest developments on the generation of new approaches to the diagnosis and treatment of MEN1 have recently been reviewed elsewhere (22).

Through homologous recombination, exons 3 to 8 of the mouse gene Men1 have been targeted for deletion (23). By 9 months of age, heterozygous Men1 mice were reported to develop pancreatic islet lesions with additional frequent observations of parathyroid adenomas. Larger, more numerous tumors in pancreatic islets, parathyroids, thyroid, adrenal cortex, and pituitary were seen by 16 months of age (23), features remarkably similar to the human disorder.

Ample evidence exists indicating that blocking VEGF-A–mediated angiogenesis results in tumor suppression (24–28), and anti–VEGF-A approaches have been used in treatment of various preclinical models of human malignant cancer cell lines. Tumor xenografts, however, poorly recapitulate tumor development in a natural setting. Furthermore, there are as yet few examples of successful long-term use of anti-VEGF mAbs in preclinical models of benign tumors (29).

To investigate the role of VEGF-A in the development of endocrine tissue–specific adenomas, we took advantage of recently described cross-reactive neutralizing anti–VEGF-A monoclonal antibodies (mAb; ref. 30). We tested the effects of VEGF-A neutralization in a naturally occurring nonmalignant tumor model, the Men1^+/− mouse model of MEN1. Tumor volume of pituitary adenomas in Men1^+/− mice as well as s.c. pituitary tumor transplants in BALB/c nude mice was analyzed after treatment with anti–VEGF-A mAb. Finally, we asked whether treatment with anti–VEGF-A mAb could lower the elevated hormone levels associated with MEN1.

Animal husbandry.Men1^+/− mice (23) were obtained from The Jackson Laboratory and BALB/c nude mice from Charles River Laboratories, Inc. Experimental Men1^+/− female mice of mixed 129-FVB background were obtained by intercrossing Men1^+/− males and females. Mice were housed in microisolator cages in a barrier facility and fed ad libitum. Maintenance of animals and experimental protocols were conducted following federal regulations and approved by Institutional Animal Care and Use Committee.

Grafting of pituitary tumors to dorsal flank. S.c. pituitary adenoma transplants were established in 6- to 8-week-old female BALB/c nude mice according to the following procedure. A single in situ pituitary adenoma from a Men1^+/− mouse was extracted and minced into ∼1-mm³ pieces, mixed with BD Matrigel Matrix Basement Membrane, and inoculated s.c. in 200-μL volume to the dorsal flank of BALB/c nude mice. Four months later, a single s.c. tumor (approximate volume, 900 mm³) was extracted, minced, mixed with Matrigel, and inoculated as described above to establish a cohort of mice with pituitary adenoma transplants.

Treatment of mice with mAb G6-31 and control IgG antibodies. The cross-reactive anti–VEGF-A mAb G6-31 was derived from human Fab phage libraries (30). To generate a mAb suitable for long-term administration in immunocompetent mice, the variable domains were grafted into murine IgG2a constant domain. I.p. injection at 5 mg/kg of mAb G6-31 or isotype-matched control IgG (anti-GP120) was given once a week in a 100- to 200-μL volume in PBS. Treatment of Men1^+/− mice harboring pituitary adenomas in situ with mAb G6-31 (n = 8) or control IgG (n = 9) was started at 13.5 to 14.5 months of age and continued for 67 days or until mice were found moribund. BALB/c nude mice with a s.c. pituitary adenoma transplant were treated with control IgG (n = 23) or mAb G6-31 (n = 35), starting 4 months after grafting. The treatment continued for 35 days or until mice were found moribund or tumor volume had reached 3,000 mm³.

Magnetic resonance imaging of primary pituitary tumors. Magnetic resonance images were acquired on a 9.4T horizontal bore magnet (Oxford Instruments Ltd.) and controlled by a Varian Inova console (Varian, Inc.) using a 3-cm volume coil for transmission and reception (Varian). A fast spin echo imaging sequence was used with a repetition time of 4 s, echo train length of 8, echo spacing of 12 ms, effective echo time of 48 ms, and six averages. The image matrix was 128², with a field of view of (20 mm)² and slice thickness of 0.5 mm. Mice were restrained in the prone position with 2% isoflurane in medical air, whereas body temperature was monitored with a rectal probe and maintained at 37°C with warm air for the duration of the 15-min image acquisition. After imaging, animals were allowed to recover on a heated surface followed by returning them to the housing facility.

Analysis of tumor volumes. Primary pituitary tumor volumes were calculated from magnetic resonance imaging data using three-dimensional regions of interest drawn in Analyze software (AnalyzeDirect, Inc.).

Tumor size of s.c. pituitary adenoma transplants was estimated with a caliper tool (Fred V. Fowler Co., Inc.) by measuring the largest tumor diameter and the diameter perpendicular to that. Tumor volume was calculated using the following formula: V = πab²/6, where a is the largest tumor diameter and b is the perpendicular diameter.

RNA sample preparation and quantitative PCR analysis. Total DNA-free RNA was prepared from flash-frozen pituitary adenomas or normal pituitary glands with RNeasy kit (Qiagen) according to the manufacturer's protocol. One-step quantitative reverse transcription-PCR was done in a total volume of 50 μL with SuperScript III Platinum One-Step qRT-PCR Kit (Invitrogen), 100 ng of total RNA, 45 nmol/L of each PCR primer, and 12.5 nmol/L TaqMan probe. To detect expression of the genes of interest, the following TaqMan Gene Expression Assay primers and probe mixes (Applied Biosystems) were used: VEGF-A (assay ID: Mm00437304_m1), VEGFR-1 (assay ID: Mm00438980_m1), VEGFR-2 (assay ID: Mm00440099_m1), CD31 (assay ID: Mm00476702_m1), and Tie-2 (assay ID: Mm01256900_m1). GAPDH expression was detected using primers and TaqMan probe synthesized in in-house facility (forward primer, ATGTTCCAGTATGACTCCACTCACG; reverse primer, GAAGACACCAGTAGACTCCACGACA; TaqMan probe, AAGCCCATCACCATCTTCCAGGAGCGAGA).

Reactions were carried out using Applied Biosystems 7500 Real-time PCR System with the following conditions: a reverse transcription step (15 min at 48°C) followed by denaturation step (2 min 95°C) and 40 cycles of 15 s at 95°C and 1 min at 60°C. Levels of gene expression in each sample were determined with the relative quantification method using GAPDH mRNA as an endogenous control.

Histologic analysis. Formalin-fixed tissue was dehydrated and embedded in paraffin, sectioned, and stained with H&E for histologic analysis following standard protocols.

Immunohistochemistry. Formalin-fixed, paraffin-embedded tissue sections were deparaffinized before quenching of endogenous peroxidase activity and blocking of endogenous biotin (Vector). Sections were further blocked for 30 min with 10% normal rabbit serum in PBS with 3% bovine serum albumin. Tissue sections were then incubated with primary antibodies for 60 min, with biotinylated secondary antibodies for 30 min, and with avidin-biotin complex reagent (Vector) for 30 min, followed by a 5-min incubation in Metal Enhanced DAB (Pierce). Sections were then counterstained with Mayer's hematoxylin. Primary antibodies used were goat anti-mouse prolactin at 0.10 μg/mL (R&D Systems) and rat anti-mouse pan-endothelial cell antigen, clone MECA-32, at 2 μg/mL (BD Biosciences). Secondary antibodies used were biotinylated rabbit anti-goat at 7.5 μg/mL (Vector) and biotinylated rabbit anti-rat at 2.5 μg/mL (Vector). MECA-32 staining required pretreatment with Target Retrieval (DAKO) at 99°C for 20 min. All other steps were done at room temperature.

For detection of mouse growth hormone, paraffin sections were treated as above except as noted: avidin-biotin and normal rabbit serum blocking steps were omitted; primary antibody, a rabbit polyclonal (Chemicon), was applied at a 1:2,000 dilution in DAKO antibody diluent; and secondary detection was with DAKO Envision antirabbit horseradish peroxidase polymer. Positive and negative prolactin and growth hormone staining controls were sections of anterior and posterior pituitary, respectively, from normal mouse (see Supplementary Fig. S1).

For quantitation of vascular density, MECA-32-stained sections were analyzed with an Ariol SL-50 slide scanning platform (Applied Imaging) using a 10× objective. Pituitary tumor regions were identified and outlined manually. Pixel colors corresponding to MECA-32 staining were defined and the vascular area was measured accordingly. Tumor cell nuclei were identified by pixel color and object shape. Vascular area was then normalized to pituitary tumor cell number. Pancreatic islets were analyzed similarly, except that MECA-32 staining area was normalized to islet tumor area.

Analysis of serum prolactin and insulin levels. Serum prolactin amount was analyzed by National Hormone & Peptide Program at Harbor University of California at Los Angeles. Serum insulin amount was analyzed using an Ultrasensitive Mouse Insulin ELISA kit according to the manufacturer's instructions (Mercodia).

Treatment with mAb G6-31 inhibits the growth of Men1^+/− pituitary adenomas in situ. To investigate whether anti–VEGF-A therapy would be effective in inhibiting the growth of pituitary adenomas, 125 eleven- to thirteen-month-old female Men1^+/− mice were subjected to magnetic resonance imaging to identify mice with pituitary tumors. Tumor-bearing mice were subjected to imaging again 14 and 28 days later to establish the growth rate of the adenomas. A cohort of nine mice with 12.4% mean tumor growth per day and 15.58 ± 4.0 (SE) mm³ mean tumor volume were assigned to receive control IgG, and a cohort of eight mice with 10.2% mean tumor growth per day and 16.70 ± 5.7 mm³ mean tumor volume received an anti–VEGF-A mAb G6-31 for 67 days or until mice were found moribund. During the treatment period, animals were imaged with magnetic resonance imaging every 2 weeks to follow up pituitary adenoma growth in vivo. At 39 days of treatment, a statistically significant decrease of the mean pituitary tumor volume was observed in the mAb G6-31–treated group compared with the control IgG–treated group (Fig. 1A). At the study end point (67 days), there was a statistically significant 72% (or 3.7-fold) reduction in mean tumor volume on mAb G6-31 treatment (P < 0.016). Whereas most (six of nine) control IgG–treated Men1^+/− tumors continued to grow robustly throughout the treatment period, the growth of seven of eight mAb G6-31–treated pituitary adenomas slowed down considerably (Fig. 1B). Four mice treated with control IgG and three mice treated with mAb G6-31 were euthanized before the study's end point due to ill health, including one control IgG–treated mouse, before imaging at treatment day 25.

Tumor doubling-free survival was significantly increased in the mAb G6-31–treated group (log-rank P < 0.019; Fig. 1C), suggesting that the inhibition of pituitary tumor growth resulted in health improvement compared with the mice treated with control IgG. The tumor volume of two mice in mAb G6-31 treatment group had not doubled by day 67 of treatment. Graphs of a coronal section of the brain with a representative adenoma from one control IgG–treated and one mAb G6-31–treated Men1^+/− mouse are shown in Fig. 2, taken 9, 39, and 67 days after treatment onset.

Anti–VEGF-A antibody inhibits the growth of s.c. pituitary adenoma transplants. To test the efficacy of anti–VEGF-A antibody treatment on a Men1^+/− pituitary adenoma transplant model, s.c. tumors were established in the flank of BALB/c nude mice. A cohort of 35 mice with a 515 ± 42 mm³ mean tumor volume at treatment onset received mAb G6-31, and a cohort of 23 mice with a 527 ± 64 mm³ mean tumor volume at treatment onset received control IgG for 35 days. At treatment end point, tumors from mice treated with control IgG had nearly quadrupled their volumes (mean of 2,071 ± 152 mm³) whereas tumor growth in mice treated with mAb G6-31 had essentially stopped; the mean tumor volume was 556 ± 89 mm³ at day 35 (Fig. 1D). There was a statistically significant 73% (or 3.7-fold) reduction in mean tumor volume on mAb G6-31 treatment (P < 0.0001).

These data establish that anti–VEGF-A mAb G6-31 is effective in inhibiting the growth of both primary pituitary adenomas and s.c. pituitary adenoma transplants predisposed by heterozygosity of Men1.

Expression of VEGF-A, VEGFR-1, VEGFR-2, CD31, and Tie-2 in pituitary tumor tissue. To investigate whether the expression levels of VEGF-A, VEGFR-1, VEGFR-2, CD31, and Tie-2 were affected by mAb G6-31, we measured the mean relative expression of VEGF-A, VEGFR-1, VEGFR-2, CD31, and Tie-2 by quantitative reverse transcription-PCR in five in situ pituitary adenomas from mice treated with control IgG (mean volume, 96.2 ± 8.7 mm³) and five in situ pituitary adenomas from mice treated with mAb G6-31 (35.2 ± 4.0 mm³).

Notably, the mean relative expression of VEGF-A was significantly elevated in in situ adenomas from mice treated with mAb G6-31 compared with those from mice treated with control IgG (Fig. 3). In contrast, the mean expression levels of VEGFR-1, VEGFR-2, CD31, and Tie-2 were significantly lower in the in situ tumor samples from mice treated with mAb G6-31 compared with those found in mice treated with control IgG (Fig. 3).

Histology of pituitary and pancreatic tumors.Men1^+/− pituitary gland adenomas appeared histologically similar in untreated (eight animals examined histologically), mAb G6-31–treated, and control IgG–treated mice (six animals in each group examined histologically; representative images in Fig. 4A and B). Typically, tumor cells were small (∼10 μm in diameter), with a high nuclear/cytoplasmic ratio, often mitotically active, with up to 40 mitotic figures per ten 625-μm-diameter fields. Tumors were variably solid or cystic, with multiple endothelial cell–lined vessels, acutely hemorrhagic areas (intact RBC in non–endothelial-lined spaces, with absence of fibrin or cellular organization), and scattered hemosiderin-laden macrophages, consistent with previous hemorrhage. Tumor vessels were irregularly spaced, typically 5 to 10 μm in diameter although rarely, as large as 50 μm, with few apparent nontumor perivascular stromal cells (Fig. 4C and D). Vessel density was significantly reduced by mAb G6-31 treatment to 46% that of control IgG–treated tumors (P = 0.009; Fig. 4E). Notably, in both treatment groups, tumor vascularity was less than in normal adjacent anterior pituitary (data not shown). Pituitary tumors were immunostained for VEGF in both control IgG– and anti-VEGF–treated animals. In control animals, no detectable VEGF was present in tumor cells (Fig. 5A), but rare finely granular signal was localized to tumor endothelium, presumably representing clustered and/or internalized receptor-ligand complexes (Fig. 5C). In tumors treated with anti–VEGF, there were focal areas of VEGF immunostaining in tumor cells (Fig. 5B), which were associated with increased endothelial and stromal VEGF signals (Fig. 5D). The latter may represent VEGF ligand/antibody or ligand/receptor complexes internalized by macrophages, VEGF expression by stromal cells, or both.

Pancreatic islet tumors (reviewed in ref. 31), usually multiple, were invariably identified in 15- to 16-month-old Men1^+/− mice. Endocrine neoplasms (defined here as being >10⁵ μm² in the plane of section) were up to 3 mm in diameter in the plane of section, typically solid, occasionally cribriform, generally with minimal mitotic activity, although rare neoplasms had up to 7 mitoses per single high-power field, associated with increased nuclear polymorphism (representative images in Supplementary Fig. S2). Some neoplasms showed stromal hemosiderin-laden macrophages, but there was generally minimal hemorrhage and necrosis (Supplementary Fig. S3). Tumors from six animals treated with anti–VEGF-A mAb G6-31 (n = 32 tumors) averaged only 39% the area of those from the five animals treated with control IgG (n = 45 tumors; P = 0.026). Vascular density in neuroendocrine tumors was significantly reduced by G6-31 treatment to 56% that of control IgG–treated tumors (P < 0.0001; Fig. 4F and Supplementary Fig. S3C and D). In addition, “normal” islets (<10⁵ μm² in the plane of section) from mAb G6-31–treated mice had a vascular density reduced, by a smaller magnitude, to 76% that of control IgG–treated animals (P < 0.0001; Fig. 4F). Pancreatic neuroendocrine tumors in control IgG– and anti-VEGF–treated animals were immunostained for VEGF protein (Supplementary Fig. S4). Moderate VEGF signal was present in essentially all cells in normal islets and in islets expanded by neuroendocrine tumors; a minority of tumors had notably stronger VEGF signal than normal islets. Animals treated with anti-VEGF showed no apparent changes in tumor cell VEGF signal, although they did show increased stromal and endothelial VEGF signals, as was noted for pituitary tumors in the same treatment group. A single male animal, treated with control IgG, had a solitary 12-mm-diameter adrenal cortical tumor, a recognized tumor type in the MEN1 syndrome glands (13). Thyroid and parathyroid glands were not examined microscopically.

Histology of the s.c. pituitary adenoma transplants (see Supplementary Fig. S5) was comparable to that of the pituitary tumors in situ, indicating a successful recapitulation of endocrine tumor growth at distant loci.

MEN1 pituitary adenomas are prolactinomas. Approximately 60% of pituitary adenomas in MEN1 patients secrete prolactin (PRL), fewer than 25% growth hormone and 5% adrenocorticotropic hormone (14). To investigate whether the pituitary adenomas of Men1^+/− mice secrete PRL, immunohistochemical staining with anti-PRL antibodies was done on in situ pituitary adenomas as well as pituitary tumor transplants from mice treated with control IgG or mAb G6-31. Six of six adenomas from control IgG and five of five from mice treated with mAb G6-31 showed a specific, positive staining for prolactin in ∼50% to 95% of the cells, establishing them as prolactinomas (Supplementary Fig. S6A and B). In line with this result, Crabtree et al. (23) reported that Men1^TSM/+ pituitary tumors were positive for PRL in an immunohistochemical staining. Prolactin staining was also positive in the pituitary adenoma transplants with either treatment (Supplementary Fig. S5). Consistent with functional prolactin secretion from these tumors, mammary tissue in female mice bearing transplanted pituitary adenomas invariably showed moderate to marked lactational change in both control IgG– and anti–VEGF-A–treated animals (Supplementary Fig. S5A and B).

As assessed by immunohistochemical staining, 6 of 11 nontreated primary pituitary tumors were focally and weakly positive for growth hormone, whereas only one of four transplanted pituitary tumors showed focal weak staining (not shown). Growth hormone expression was present in both G6-31– and control IgG–treated in situ pituitary tumors (Supplementary Fig. S6). Normal anterior pituitary showed strong reactivity in ∼20% to 30% of cells (Supplementary Fig. S1).

Serum prolactin level correlates with pituitary tumor volume in untreated and control IgG–treated mice and is decreased by mAb G6-31 treatment. Given that all pituitary adenomas examined from Men1^+/− mice treated with control IgG or mAb G6-31 were positive for prolactin by immunohistochemical analysis, we investigated whether serum PRL levels were elevated in Men1^+/− pituitary adenoma–bearing mice. To this end, we initially analyzed 46 nontreated female Men1^+/− mice for their pituitary tumor status and serum PRL level and five female wild-type littermate controls for serum PRL level. The age range of these mice was 10.5 to 15.6 months, with an average age of 13.3 months.

The mean serum PRL level in the wild-type mice was 44 ± 25 (SE) ng/mL. Twenty-seven of the 46 Men1^+/− mice did not have a detectable pituitary tumor in magnetic resonance imaging analysis. The mean serum PRL level in these mice was 69 ± 24 ng/mL. Ten mice had a small pituitary tumor with a mean volume of 1.7 ± 0.6 mm³. Serum PRL level in these mice was elevated to a mean of 188 ± 61 ng/mL. Nine mice that had a large pituitary tumor (mean volume, 83 ± 23 mm³) had a mean serum PRL of 13,239 ± 3,466 ng/mL. These data establish that there is a positive correlation between serum PRL levels and pituitary tumor volume in the Men1^+/− mice (Fig. 6A) with Pearson's correlation coefficient r = 0.94, suggesting that serum PRL level could be useful as a diagnostic tool in establishing an estimate of pituitary tumor status.

To examine whether anti–VEGF-A treatment had an effect on serum PRL level, we analyzed the serum of seven control IgG– and seven mAb G6-31–treated Men1^+/− mice with a pituitary adenoma in situ at study end point (day 67). In mice treated with control IgG, the mean serum PRL level was elevated to 12,566 ± 3,047 ng/mL and was generally increased with increasing tumor volume (mean of 116.2 ± 18.5 mm³; r = 0.80, P < 0.03). In mAb G6-31–treated Men1^+/− mice analyzed, the serum PRL level remained lower, at 5,163.7 ± 1,608.9 ng/mL. However, no obvious correlation to tumor volume was apparent (mean tumor volume, 35.3 ± 6.5 mm³; r = −0.12 with P < 0.80; Fig. 6B). Nonetheless, these data indicate that whereas mAb G6-31 inhibits the pituitary adenoma growth, it also leads to a decreased mean serum PRL compared with control IgG–treated mice (P < 0.05).

Treatment with anti–VEGF-A lowers serum PRL in mice with s.c. pituitary tumor transplants. Whereas the above data indicate that anti–VEGF-A antibody treatment lowers the serum level of PRL in tumor-bearing Men1^+/− mice, we further investigated serum PRL level in the context of the s.c. pituitary adenoma transplants in BALB/c nude mice. Serum PRL was measured from samples originating from 23 control IgG– and 35 mAb G6-31–treated mice, harvested at treatment onset (day 1) and at study end point (day 35). Whereas the mean serum PRL at day 1 was comparable between the two treatments, at day 35, mAb G6-31 treatment had significantly reduced the serum PRL (Fig. 6C).

Because the current treatment of MEN1 prolactinomas includes medical therapy or selective hypophysectomy followed by radiotherapy, our data indicating that mAb G6-31 treatment leads to lower PRL serum level with a prominent inhibition of tumor growth provide a potential new therapeutic approach to MEN1 patients.

Serum insulin levels are elevated in Men1^+/− mice. To examine whether the serum insulin levels were elevated in the Men1^+/− mice, serum samples were analyzed from six nonfasted mice treated with control IgG and six nonfasted mice treated with mAb G6-31, all identified with pancreatic lesions in histologic analysis. Serum insulin levels were also analyzed from five nonfasted, age-matched wild-type mice. No correlation with treatment was observed. However, we observed a trend of elevated mean serum insulin in Men1^+/− mice (control IgG, 3.8 ± 2.6 ng/mL; mAb G6-31, 3.7 ± 2.4 ng/mL) compared with wild-type mice [1.4 ± 0.7 (SE) ng/mL; P = 0.13 and P = 0.16, respectively], in agreement with previous data.

VEGF-A is necessary for the development of vascularization of pancreatic islets and for the angiogenic switching and carcinogenesis of insulinomas in the RIP-Tag model of islet carcinoma (32). Our data indicate that VEGF-A is also required for the growth of benign pituitary gland adenomas in the mouse model of MEN1 because a monotherapy with a monoclonal antibody targeting VEGF-A was shown to result in substantial tumor growth inhibition. Additionally, we have been able to establish a transplantable model of MEN-1 pituitary tumor, which produces high levels of prolactin and is fully responsive to anti–VEGF-A therapy. Considering the incomplete penetrance and the length of time required for the establishment of the phenotype in mice, the availability of a transplantable model might significantly facilitate the investigation of the mechanisms of MEN1 tumorigenesis and regulation of hormone secretion.

It is conceivable that much of the observed antitumor effects of mAb G6-31 are mediated by suppression of VEGFR-2–dependent angiogenesis. In addition to the observation that the mean expression of VEGFR-2 mRNA in large pituitary adenomas was significantly affected by anti–VEGF-A treatment (Fig. 3), immunohistochemical staining for MECA-32 showed highly significant decreases in vascularity (∼50% reduction) in both pituitary and pancreatic neuroendocrine tumors treated with mAb G6-31 (Fig. 4). A corresponding reduction in anti–VEGF-A–treated tumor growth was noted in both pituitary and pancreatic tumors. Vascular density in normal pancreatic islets was also significantly decreased by anti–VEGF-A treatment, although the magnitude of the change (25% reduction from control IgG treated) was less than that seen in pancreatic adenomas.

The observed high level of VEGF-A transcript in mAb G6-31–treated tumors is potentially a result of a compensatory mechanism to the systemic sequestering of VEGF-A by mAb G6-31. However, it seemed that such elevated VEGF-A was not sufficient to drive the tumor growth.

In addition to showing that a monotherapy with an anti–VEGF-A mAb significantly lowered the pituitary tumor burden of the Men1^+/− mice by effectively inhibiting adenoma growth, we show that the serum prolactin levels were significantly lowered. Thus, our data suggest the possibility that VEGF-A blockade may represent a nonsurgical treatment for benign tumors of the endocrine system, possibly in combination with dopamine agonists (in the case of prolactin-secreting adenomas; refs. 33, 34) or other pharmacologic agents.

It is tempting to speculate that VEGF-A inhibition will prove particularly effective in the treatment/prevention of benign tumors. Interestingly, previous studies have shown that anti–VEGF-A mAb G6-31 and AZD2171, a small-molecule inhibitor of VEGFR and fibroblast growth factor receptor signaling (35, 36), inhibit growth of polyps in the Apc^+/min model of familial adenomatous polyposis (29, 37). However, because a systemic VEGF-A blockade can be associated with some significant side effects in some patients, further understanding of the mechanism of such side effects will be helpful to design clinical trials with VEGF-A inhibitors in benign tumors (38).