Purpose: Although there is considerable information on the molecular aberrations associated with endometrial cancer, very little is known of the changes in gene expression associated with endometrial hyperplasia.

Experimental Design: To address this, we have compared the level of expression of estrogen-regulated genes and components of the insulin-like growth factor I (IGF-I) signaling pathway in endometrial biopsies from subjects with normal endometrium, complex atypical endometrial hyperplasia, and endometrial adenocarcinoma (type I).

Results: There was a significant increase in the expression of the IGF-I receptor (IGF-IR) in biopsies from hyperplastic endometrium and endometrial carcinoma compared with the proliferative endometrium. The receptor was also activated, as judged by increased tyrosine phosphorylation. In addition, in endometrial hyperplasia and carcinoma, the downstream components of the IGF-IR pathway are activated, as reflected in increased Akt phosphorylation. Loss of phosphatase and tensin homologue deleted on chromosome 10 (PTEN) expression in endometrial hyperplasia did not correlate with increased activation of IGF-IR. However, the simultaneous loss of PTEN expression and increased IGF-IR activation in hyperplasia was associated with an increased incidence of endometrial carcinoma.

Conclusions: These results suggest that up-regulation of IGF-IR and loss of PTEN may be independent events that give rise to complementary activation of the IGF-I pathway and increase the probability of the development of cancer. These studies suggest that increased expression of IGF-IR may be an important contributor to the risk of endometrial hyperplasia and cancer.

The clinicopathologic progression from normal endometrium to endometrial adenocarcinoma (EC) is thought to progress through an intermediary state of abnormal proliferation, complex atypical hyperplasia (CAH; ref. 1). The progression from CAH to EC has been estimated to occur in 23% of cases (2). Epidemiologic evidence suggests that in postmenopausal women, unopposed estrogen exposure, either endogenous or exogenous, is associated with an increased risk for the development of endometrial hyperplasia and endometrial adenocarcinoma, endometrioid type (36). Elevated serum estrogen levels as a result of obesity, polycystic ovarian disease, or ovarian tumors are associated with a 5-fold increased risk of EC (79). The molecular mechanism linking estrogen exposure and increased risk of development of CAH and EC has not yet been defined.

The action of estrogen is mediated through the estrogen receptors (ERα and ERβ). Estrogen directly activates estrogen target gene transcription through the nuclear receptor (10). In the uterus, target genes whose transcription are regulated by estrogen include insulin-like growth factor I (IGF-I), progesterone receptor, and a number of transcription factors (1113). The increased expression and activation of these intermediary molecules enhance the transcription of genes such as cyclin D1 that facilitate the entry of the cell into the cell cycle (14). Estrogen-induced increases in IGF-I expression result in the activation of the phosphoinositide-3-kinase pathway and Akt, thereby promoting cell survival through inhibition of downstream apoptotic pathways (15).

Cyclic changes in IGF-I expression and signaling play an important role in regulating the transition of the premenopausal endometrium through proliferative, secretory, and menstrual phases of the menstrual cycle (16, 17). The IGF's and their binding proteins, IGFBP's, regulate local endometrial differentiation and endometrial cyclic activity. Estrogen stimulates IGF-I gene expression in the uterus and has been shown to induce endometrial proliferation in mouse uterine epithelial cells (11, 18). IGF-I is produced in a cell cycle–dependent manner and increases in its transcription occur in the proliferative phase as compared with the secretory phase (17). The IGF-I pathway components are thought to regulate stromal-epithelial growth and differentiation in both an autocrine and paracrine manner (11).

The effects of IGF-I on endometrial cell proliferation are mediated by the activation of the IGF-I receptor (IGF-IR), a tyrosine kinase receptor that signals via the activation of the phosphoinositide-3-kinase/Akt pathway (11). IGF-IR is localized to the luminal and glandular epithelium as well as the stroma, and its expression is down-regulated by progesterone (19, 20). In endometrial cells, the activity of the phosphoinositide-3-kinase/Akt pathway is also critically regulated by the activity of phosphatase and tensin homologue deleted on chromosome 10 (PTEN), a lipid phosphatase that negatively regulates phosphoinositide-3-kinase activity by the dephosphorylation of phosphoinositol(3,4,5) triphosphate (21). PTEN activity has been found to be suppressed in 55% of CAH, and in up to 83% of EC (22). Decreased PTEN expression has been proposed to facilitate an increase in the activation of Akt, thereby stimulating survival signaling in the endometrium and contributing to the development of CAH and EC (22). However, the molecular link between estrogenization of the endometrium and changes in PTEN expression are not well understood.

In order to gain further insight into the role of estrogen and the IGF-I pathway in the development of CAH and carcinoma, we investigated the expression and activation of estrogen-responsive genes and IGF-I pathway components. Surprisingly, our results provide evidence that the endometrium of postmenopausal women with CAH is not highly “estrogenized”, as indicated by the lack of significant change in the expression of estrogen-responsive genes. We have, however, identified overexpression and activation of IGF-IR independent of changes in PTEN expression in CAH.

Endometrial tissue samples. Formalin-fixed, paraffin-embedded sections of human endometrial biopsies were obtained from the Department of Pathology, University of Texas M.D. Anderson Cancer Center (Houston, TX) from 10 women with proliferative phase endometrium, 7 women with secretory phase endometrium, and 17 postmenopausal women with endometrial CAH. Proliferative and secretory phase tissues were obtained from premenopausal women who underwent biopsy for the clinical evaluation of abnormal vaginal bleeding. Formalin-fixed, paraffin-embedded sections of endometrial endometrioid adenocarcinoma grade 1 (EEC grade 1, n = 27) were derived from hysterectomy surgical specimens submitted to the Department of Pathology, University of Texas M.D. Anderson Cancer Center. H&E-stained slides were microscopically evaluated by a gynecologic pathologist (R.R. Broaddus) to confirm the diagnosis. For the CAH and EEC grade 1 samples, H&E-stained slides were microscopically reviewed to ensure the lack of contaminating normal endometrium. Cases with contaminating normal endometrium were not used.

Patient characteristics. Height and weight information for each patient was obtained from the medical record and was used to calculate patient basal metabolic index (BMI) using the formula, BMI = [weight (kg) / height (cm)2] × 104. A BMI of ≥30 kg/m2 was categorized as obese (23). Patient characteristics including age, BMI, and findings at hysterectomy are listed in Table 1.

Table 1.

Patient characteristics

CharacteristicsCAHEEC grade 1
N 17 18 
Age (y)   
    Mean 56.0 50.5 
    Median 60.0 47.0 
    Range (28.0-74.0) (21.0-91.2) 
BMI   
    Mean 55.1 34.8 
    Median 33.0 35.1 
    Range (17.5-285.7) (19.4-54.5) 
    No. of obese patients (BMI >30) 12/17 11/18 
    No. of patients not obese (BMI <30) 3/17 7/18 
    No clinical information available 2/17 0/18 
Clinical follow-up after hysterectomy   
    CAH associated with EEC grade 1 5/17 N/A 
    CAH only 8/17 N/A 
    No follow-up information available 4/17 N/A 
CharacteristicsCAHEEC grade 1
N 17 18 
Age (y)   
    Mean 56.0 50.5 
    Median 60.0 47.0 
    Range (28.0-74.0) (21.0-91.2) 
BMI   
    Mean 55.1 34.8 
    Median 33.0 35.1 
    Range (17.5-285.7) (19.4-54.5) 
    No. of obese patients (BMI >30) 12/17 11/18 
    No. of patients not obese (BMI <30) 3/17 7/18 
    No clinical information available 2/17 0/18 
Clinical follow-up after hysterectomy   
    CAH associated with EEC grade 1 5/17 N/A 
    CAH only 8/17 N/A 
    No follow-up information available 4/17 N/A 

RNA isolation. Five 10-μmol/L sections were cut from the paraffin-embedded blocks using a T35 microtome (Microm, Walldorf, Germany). Tissue sections were deparaffinized using two xylene washes. RNA was extracted using the MasterPure Reagent Kit (Epicenter, Madison WI). Proteinase K digestion was done for 4 hours at 65°C in a SDS-containing lysis solution followed by isopropanol precipitation and two ethanol washes. DNA was digested by incubation with RNase-free DNase I with RNase Inhibitor for 15 minutes at 37°C. DNase I was heat-inactivated at 75°C for 10 minutes.

Reverse transcription and quantitative real-time PCR. Reverse transcription and quantitative real-time PCR were done as previously described (24). The sequences of forward and reverse primers and TaqMan probes for each specific assay are listed in Table 2.

Table 2.

Quantitative real-time PCR primer/probe sequences

Gene namePrimer/TaqMan probe sequencesGenBank accession no.
Estrogen receptor α 1394(+) 5′-TACTGACCAACCTGGCAGACAG NM_000125 
 1490(−) 5′-TGGACCTGATCATGGAGGGT  
 1466(+) 5′-(FAM)TCCACAAAGCCTGGCACCCTCTTC(TAMRA)  
Progesterone receptor* 2689(+) 5′-GAGCACTGGATGCTGTTGCT NM_000926.2 
 2754(−) 5′-GGCTTAGGGCTTGGCTTTC  
 2710(+) 5′-(FAM)TCCCACAGCCATTGGGCGTTC(TAMRA)  
Cyclin D1 651(+) 5′-AGAGGCGGAGGAGAACAAAC NM_001758 
 714(−) 5′-GGCACAAGAGGCAACGAAG  
 674(+) 5′-(FAM)TCATCCGCAAACACGCGCAG(TAMRA)  
IGF-I 146(+) 5′-GCAATGGGAAAAATCAGCAG NM_27544 
 237(−) 5′-GAGGAGGACATGGTGTGCA  
 217(−) 5′-(FAM)CTTCACCTTCAAGAAATCACAAAAGCAGCA(TAMRA)  
IGF-II 742(+) 5′-CGTGGCATCGTTGAGGAGT NM_000612 
 809(−) 5′-GTAGCACAGTACGTCTCCAGGAG  
 766(+) 5′-(FAM)TTCCGCAGCTGTGACCTGGCC(TAMRA)  
IGF-IR 163(+) 5′-CGCAACGACTATCAGCAGCT NM_000875 
 238(−) 5′-AGATGAGCAGGATGTGGAGGT  
 189(+) 5′-(FAM)CCTGGAGAACTGCACGGTGATCGA(TAMRA)  
IGFBP-3 546(+) 5′-CAGCCAGCGCTACAAAGTTG NM_000598 
 628(−) 5′-ATTCTGTCTCCCGCTTGGAC  
 569(+) 5′-(FAM)ACGAGTCTCAGAGCACAGATACCCAGAACTT(TAMRA)  
IGFBP-5 1452(+) 5′-AGAAAGCAGTGCAAACCTTCC NM_000599 
 1515(−) 5′-CGTACTTGTCCACGCACCA  
 1475(+) 5′-(FAM)TGGCCGCAAACGTGGCATC(TAMRA)  
Mammalian 18S rRNA 535(+) 5′-GAGGGAGCCTGAGAAACGG NM_10098 
 602(−) 5′-GTCGGGAGTGGGTAATTTGC  
 555(+) 5′-(FAM)TACCACATCCAAGGAAGGCAGCAGG(TAMRA)  
Gene namePrimer/TaqMan probe sequencesGenBank accession no.
Estrogen receptor α 1394(+) 5′-TACTGACCAACCTGGCAGACAG NM_000125 
 1490(−) 5′-TGGACCTGATCATGGAGGGT  
 1466(+) 5′-(FAM)TCCACAAAGCCTGGCACCCTCTTC(TAMRA)  
Progesterone receptor* 2689(+) 5′-GAGCACTGGATGCTGTTGCT NM_000926.2 
 2754(−) 5′-GGCTTAGGGCTTGGCTTTC  
 2710(+) 5′-(FAM)TCCCACAGCCATTGGGCGTTC(TAMRA)  
Cyclin D1 651(+) 5′-AGAGGCGGAGGAGAACAAAC NM_001758 
 714(−) 5′-GGCACAAGAGGCAACGAAG  
 674(+) 5′-(FAM)TCATCCGCAAACACGCGCAG(TAMRA)  
IGF-I 146(+) 5′-GCAATGGGAAAAATCAGCAG NM_27544 
 237(−) 5′-GAGGAGGACATGGTGTGCA  
 217(−) 5′-(FAM)CTTCACCTTCAAGAAATCACAAAAGCAGCA(TAMRA)  
IGF-II 742(+) 5′-CGTGGCATCGTTGAGGAGT NM_000612 
 809(−) 5′-GTAGCACAGTACGTCTCCAGGAG  
 766(+) 5′-(FAM)TTCCGCAGCTGTGACCTGGCC(TAMRA)  
IGF-IR 163(+) 5′-CGCAACGACTATCAGCAGCT NM_000875 
 238(−) 5′-AGATGAGCAGGATGTGGAGGT  
 189(+) 5′-(FAM)CCTGGAGAACTGCACGGTGATCGA(TAMRA)  
IGFBP-3 546(+) 5′-CAGCCAGCGCTACAAAGTTG NM_000598 
 628(−) 5′-ATTCTGTCTCCCGCTTGGAC  
 569(+) 5′-(FAM)ACGAGTCTCAGAGCACAGATACCCAGAACTT(TAMRA)  
IGFBP-5 1452(+) 5′-AGAAAGCAGTGCAAACCTTCC NM_000599 
 1515(−) 5′-CGTACTTGTCCACGCACCA  
 1475(+) 5′-(FAM)TGGCCGCAAACGTGGCATC(TAMRA)  
Mammalian 18S rRNA 535(+) 5′-GAGGGAGCCTGAGAAACGG NM_10098 
 602(−) 5′-GTCGGGAGTGGGTAATTTGC  
 555(+) 5′-(FAM)TACCACATCCAAGGAAGGCAGCAGG(TAMRA)  
*

Progesterone receptor transcript accounts for both PRA and PRB isoforms.

Immunohistochemistry. Immunohistochemistry was done for a subset of the formalin-fixed, paraffin-embedded biopsies used for real-time PCR transcript analysis, from proliferative phase endometrium (n = 6), endometrial CAH (n = 14), and EEC grade 1 (n = 18). Tissue sections were deparaffinized and endogenous peroxidases were quenched by incubation in 1% H2O2. Antigen retrieval was done by microwave in 10 mmol/L citrate buffer (pH 6.0). Slides were incubated with primary antibody (1:50) in PBS containing 10% normal serum overnight at 4°C. Primary antibodies were specific to phosphorylated (Tyr1131) IGF-IR, or the α-subunit of the IGF-IR, or phosphorylated (Ser473) Akt or total Akt (all from Cell Signaling Technology, Beverly, MA), or PTEN (clone 6H2.1; Cascade Biosciences, Winchester, MA). A biotin-labeled secondary antibody was conjugated for 30 minutes at 37°C. Sections were stained using avidin-biotinylated horseradish peroxidase complex from the Vectastain Elite ABC kit (Vector Laboratories, Burlingame, CA) according to the manufacturer's instructions. Diaminobenzidine reagent (Vector Laboratories) was incubated with sections to visualize peroxidases for up to 30 minutes. Sections were counterstained with hematoxylin or methyl green, dehydrated, and mounted. Controls that lacked primary antibody were incubated in 1× PBS with 10% normal serum in each experiment. Controls that contained the corresponding blocking peptide in combination with the primary antibody were done for each experiment. Immunostained sections were examined by light microscopy and evaluated and scored semiquantitatively according to the intensity of staining on a scale of 0 (no staining) to 3+ (strong staining). Tissues with 2+ or 3+ staining in >10% of cells were considered positive for protein expression.

Statistical analyses. Significant differences in population means were calculated by unpaired Student's t tests, ANOVA, or nonparametric Mann-Whitney test. χ2 test was used to evaluate the frequency of immunostaining by group. Any correlations were evaluated by Pearson correlation analysis and confirmed by Spearman's and Kendal's tests. Statistical significance was defined as P < 0.05.

Expression of estrogen-regulated genes in normal proliferative endometrium and CAH. Epidemiologic studies link estrogen exposure to the development of endometrial CAH and carcinoma (3, 4). We therefore measured the level of transcript expression of the estrogen receptor α and a panel of genes well-known to be regulated by estrogen, including progesterone receptor, cyclin D1, and IGF-I, using quantitative real-time PCR in formalin-fixed, paraffin-embedded biopsies from proliferative endometrium and CAH (Table 3). The transcript levels of estrogen receptor α were not significantly different between the proliferative phase and CAH. Similarly, there was no significant difference in the levels of transcripts of the estrogen-regulated genes, progesterone receptor, IGF-I, or cyclin D1. The lack of difference between the expression of estrogen-regulated genes in CAH and proliferative endometrium suggests that the abnormal proliferative state of CAH is not due to excessive chronic estrogenization of the endometrium.

Table 3.

Levels of transcripts from proliferative phase endometrium and endometrial hyperplasia (CAH)

Pathway or familyTranscriptProliferativeCAH
Steroid receptors Estrogen receptor α (4.87 ± 1.24) × 10−5 (9.50 ± 1.92) × 10−5 
 Progesterone receptor (5.27 + 0.79) × 10−5 (8.12 ± 1.17) × 10−5 
Cell cycle Cyclin D1 (3.55 ± 0.81) × 10−5 (3.97 ± 1.27) × 10−5 
IGF pathway IGF-I (3.40 ± 0.44) × 10−5 (6.11 ± 1.30) × 10−5 
 IGF-II (4.64 ± 1.27) × 10−4 (1.10 ± 0.23) × 10−3 
 IGFBP-3 (3.21 ± 0.82) × 10−5 (1.19 ± 0.20) × 10−4 
 IGFBP-5 (1.01 ± 0.23) × 10−2 (6.80 ± 1.73) × 10−3 
 IGF-IR (1.03 ± 0.47) × 10−5 (5.76 ± 8.66) × 10−5
Pathway or familyTranscriptProliferativeCAH
Steroid receptors Estrogen receptor α (4.87 ± 1.24) × 10−5 (9.50 ± 1.92) × 10−5 
 Progesterone receptor (5.27 + 0.79) × 10−5 (8.12 ± 1.17) × 10−5 
Cell cycle Cyclin D1 (3.55 ± 0.81) × 10−5 (3.97 ± 1.27) × 10−5 
IGF pathway IGF-I (3.40 ± 0.44) × 10−5 (6.11 ± 1.30) × 10−5 
 IGF-II (4.64 ± 1.27) × 10−4 (1.10 ± 0.23) × 10−3 
 IGFBP-3 (3.21 ± 0.82) × 10−5 (1.19 ± 0.20) × 10−4 
 IGFBP-5 (1.01 ± 0.23) × 10−2 (6.80 ± 1.73) × 10−3 
 IGF-IR (1.03 ± 0.47) × 10−5 (5.76 ± 8.66) × 10−5
*

Significant at the P < 0.001 level.

IGF-I pathway transcripts. Because of the critical role of IGF-I in regulating the proliferation of the normal endometrium, we evaluated the level of transcript expression of the IGF-I pathway components (IGF-I, IGF-II, IGF-IR, IGFBP-3, and IGFBP-5) in proliferative endometrium and CAH (Table 3). There was no significant difference in the expression of IGF-I, IGF-II, IGFBP-3, or IGFBP-5 transcript levels. However, the IGF-IR transcript level was ∼6-fold higher in CAH compared with the proliferative endometrium (P < 0.001). Figure 1 shows the individual transcript levels of IGF-IR for endometrial biopsies of proliferative or secretory phase endometrium, CAH, and EEC grade 1. IGF-IR transcripts were significantly elevated in both CAH and EEC grade 1 compared with normal endometrium.

Fig. 1.

IGF-IR transcript levels in individual endometrial samples. The levels of IGF-IR transcript were measured by quantitative real-time PCR in formalin-fixed paraffin-embedded proliferative (n = 10) and secretory (n = 7) phase endometria, endometrial CAH (n = 17), and grade 1 endometrioid carcinoma (n = 27). The values of IGF-IR transcript molecules were normalized to the 18S rRNA. Bars, mean population values.

Fig. 1.

IGF-IR transcript levels in individual endometrial samples. The levels of IGF-IR transcript were measured by quantitative real-time PCR in formalin-fixed paraffin-embedded proliferative (n = 10) and secretory (n = 7) phase endometria, endometrial CAH (n = 17), and grade 1 endometrioid carcinoma (n = 27). The values of IGF-IR transcript molecules were normalized to the 18S rRNA. Bars, mean population values.

Close modal

IGF-IR expression and phosphorylation in the proliferative endometrium, CAH, and EEC grade 1. In order to evaluate whether the increase in IGF-IR transcript levels resulted in increased expression of the IGF-IR protein, we assessed IGF-IR immunohistochemically (Fig. 2). There was a low level (1+) of IGF-IR expression in the cytosol of the stroma and glandular epithelium of all (6 of 6) of the proliferative endometria (Fig. 2A). However, IGF-IR expression was high (3+) in the cytosol of the glandular epithelium in the majority (5 of 6) of CAH and all (18 of 18) of the carcinomas (Fig. 2B and C). Although the IGF-IR expression was increased in both stromal and epithelial cells, the level of expression was highest in the epithelial cells.

Fig. 2.

Immunostaining for IGF-IR, phosphorylated IGF-IR, Akt and phosphorylated Akt in the endometrium. IGF-IR immunoreactivity in the proliferative endometrium (A), CAH (B), and EEC grade 1 (C). Phospho-IGF-IR immunoreactivity in the proliferative endometrium (D), CAH (E), and EEC grade 1 (F). Akt immunoreactivity in the proliferative endometrium (G), CAH (H), and EEC grade 1 (I). Phospho-Akt immunoreactivity in the proliferative phase (J), CAH (K), and EEC grade 1 (L). Inset, the appropriate peptide blocked controls for the individual antibodies.

Fig. 2.

Immunostaining for IGF-IR, phosphorylated IGF-IR, Akt and phosphorylated Akt in the endometrium. IGF-IR immunoreactivity in the proliferative endometrium (A), CAH (B), and EEC grade 1 (C). Phospho-IGF-IR immunoreactivity in the proliferative endometrium (D), CAH (E), and EEC grade 1 (F). Akt immunoreactivity in the proliferative endometrium (G), CAH (H), and EEC grade 1 (I). Phospho-Akt immunoreactivity in the proliferative phase (J), CAH (K), and EEC grade 1 (L). Inset, the appropriate peptide blocked controls for the individual antibodies.

Close modal

Increased expression of IGF-IR might or might not result in activation of the IGF-I signaling pathway. To determine whether the receptor is activated, we measured tyrosine phosphorylation (P-Tyr1131) of the activation domain of the IGF-IR in biopsies from the proliferative endometrium, CAH, and EEC grade 1 (Table 4; Fig. 2). IGF-I and IGF-II activate the IGF-IR by triggering autophosphorylation of a triple tyrosine cluster within the kinase domain (25). The level of IGF-IR phosphorylation was undetectable (0) in all (6 of 6) of the proliferative endometria (Fig. 2D). The phosphorylation of the IGF-IR was uniformly increased in the majority (12 of 14) of CAH. Phosphorylated IGF-IR was present in the cytosol of both the glandular epithelium and stroma of CAH and the majority (14 of 18) of EEC grade 1 (Table 4; Fig. 2E and F). In summary, there is a consistent pattern of increased expression and activation of the IGF-IR in endometrial CAH as compared with the proliferative endometrium.

Table 4.

Immunohistochemical expression of IGF-IR, phosphorylated IGF-IR, Akt, phosphorylated Akt, and PTEN in the proliferative phase endometrium, CAH, and EEC grade 1

GroupIGF-IRPhospho-IGF-IRAktPhospo-AktPTEN
Proliferative phase (%) 83 83 N/A 
CAH (%) 83 86 100 93 36 
Endometrial carcinoma, grade 1 (%) 100 78 100 89 
P value* 0.236 <0.001* 0.069 <0.001* 0.091 
GroupIGF-IRPhospho-IGF-IRAktPhospo-AktPTEN
Proliferative phase (%) 83 83 N/A 
CAH (%) 83 86 100 93 36 
Endometrial carcinoma, grade 1 (%) 100 78 100 89 
P value* 0.236 <0.001* 0.069 <0.001* 0.091 

NOTE: Results are expressed as the percentage of cases with 2+ or 3+ staining.

*

Significance was evaluated between groups (proliferative, CAH, and EEC grade 1) by χ2 analysis at the P < 0.001 level.

Phosphorylation of Akt. Signaling through the IGF-IR can lead to phosphorylation of Akt. In order to evaluate the degree of downstream activation of the IGF-I signaling pathway, we examined the immunohistochemical expression of Akt and its activation by phosphorylation of Ser473 (Table 4; Fig. 2). The level of Akt was much higher in EEC grade 1; however, Akt expression was similar in the proliferative endometrium and CAH. Akt expression was high (3+) in the cytosol of all (18 of 18) of the carcinomas (Fig. 2I). The expression of Akt was moderate (2+) in the cytosol of the stroma and glandular epithelium of the proliferative endometrium (5 of 6) and CAH (6 of 6; Fig. 2G and H). The level of Akt phosphorylation was high in CAH and EEC grade 1 as compared with a very low level of expression in the proliferative endometrium. The level of phosphorylation of Akt was high (3+) in the cytosol of the glandular epithelium and stromal cells of the majority (13 of 14) of CAH and the majority (16 of 18) of EEC grade 1 (Fig. 2K and L). The level of phosphorylation of Akt was undetectable (0) in all (6 of 6) of the proliferative endometria (Fig. 2J). Our results suggest that Akt is activated in a majority of CAH and grade 1 carcinoma. In summary, both overexpression of IGF-IR and downstream activation of Akt are present in endometrial hyperplasia and carcinoma.

PTEN expression. The lipid phosphatase PTEN is a negative regulator of the IGF-I/Akt signaling pathway (21). Loss of PTEN expression due to mutation is very common in CAH and EC (22). In order to determine if loss of PTEN was correlated with the activation of IGF-IR and Akt, we evaluated the pattern of protein expression of PTEN in CAH and EEC grade 1 previously used to characterize the expression of IGF-IR and Akt (Table 4; Fig. 3). The loss of expression of PTEN in the cytosol of the glandular epithelium of multiple glands occurred in the majority (9 of 14) of CAH (Fig. 3B). Loss of expression of PTEN occurred in all (18 of 18) endometrial carcinomas (Fig. 3C). Overall, there was no correlation between the loss of PTEN expression and activation of IGF-IR in CAH (Pearson's correlation, 0.41; P < 0.20) and EEC grade 1 (Pearson's correlation, 0.00; P < 1.0), suggesting that these two events are independent of each other.

Fig. 3.

PTEN immunoreactivity in hyperplastic endometrium with intact expression of PTEN (A), hyperplastic endometrium with loss of PTEN expression (B), and EEC grade 1 with loss of PTEN expression (C). B and C, PTEN expression is retained in the nonneoplastic stromal cells, but not in the glandular epithelial cells.

Fig. 3.

PTEN immunoreactivity in hyperplastic endometrium with intact expression of PTEN (A), hyperplastic endometrium with loss of PTEN expression (B), and EEC grade 1 with loss of PTEN expression (C). B and C, PTEN expression is retained in the nonneoplastic stromal cells, but not in the glandular epithelial cells.

Close modal

Evaluation of IGF-IR activation status and PTEN expression status in CAH associated with EC. For the 14 patients with CAH biopsies in which we evaluated IGF-IR activation and PTEN expression, 10 ultimately had hysterectomies at M.D. Anderson Cancer Center. Five of these had EEC grade 1 arising in association with CAH, whereas five had CAH only. Although our sample size is limited, the majority (5 of 6) of endometrial CAH with activated IGF-IR and loss of PTEN expression ultimately had EEC grade 1 in the uterus at hysterectomy (Fig. 4). This was very similar to the profile of EEC grade 1 tumors, in which concurrent activated IGF-IR and PTEN loss of expression was present in the majority (14 of 18) of cases (Fig. 4). These results suggest that, in endometrial CAH, concurrent loss of PTEN expression and activation of the IGF-IR may be associated with a higher risk of either concurrent endometrial carcinoma or the development of carcinoma.

Fig. 4.

IGF-IR activation status and PTEN expression status in (A) CAH without associated endometrial cancer (EEC gr1; n = 5), (B) CAH with associated endometrial cancer (EEC gr1; n = 5), or (C) endometrial cancer tumors (n = 18). Patients with an initial biopsy diagnosis of complex atypical endometrial hyperplasia were subsequently treated with hysterectomy. The entire endometrium was then microscopically examined by a gynecologic pathologist to determine the presence of endometrial carcinoma in the uterus. Endometrial hyperplasia biopsies for which IGF-IR and PTEN immunoreactivity were determined, were segregated according to the absence (n = 5; A) or presence (n = 5; B) of endometrial carcinoma in the hysterectomy specimen. A separate set of EEC grade 1 cases (n = 18; C) was also examined for comparison. Statistical significance was not determined due to the small sample size.

Fig. 4.

IGF-IR activation status and PTEN expression status in (A) CAH without associated endometrial cancer (EEC gr1; n = 5), (B) CAH with associated endometrial cancer (EEC gr1; n = 5), or (C) endometrial cancer tumors (n = 18). Patients with an initial biopsy diagnosis of complex atypical endometrial hyperplasia were subsequently treated with hysterectomy. The entire endometrium was then microscopically examined by a gynecologic pathologist to determine the presence of endometrial carcinoma in the uterus. Endometrial hyperplasia biopsies for which IGF-IR and PTEN immunoreactivity were determined, were segregated according to the absence (n = 5; A) or presence (n = 5; B) of endometrial carcinoma in the hysterectomy specimen. A separate set of EEC grade 1 cases (n = 18; C) was also examined for comparison. Statistical significance was not determined due to the small sample size.

Close modal

There is a great deal of evidence that the IGF-I pathway plays an important role in normal endometrial proliferation. In premenopausal or normal cycling endometrium, increased IGF-I has been implicated in normal proliferation of the glandular epithelium and stromal cells (16, 19). The IGF-I signaling pathway can also be activated by decreased levels of PTEN expression because PTEN is a phosphatase that normally suppresses the activity of the phosphoinositide-3-kinase pathway (21, 26). In our analysis of endometrial CAH, we did not find evidence of increased IGF-I, but we did find marked up-regulation of IGF-IR (Fig. 1) and phosphorylation of IGF-IR (Fig. 2E). The intensity of immunohistochemical staining of IGF-IR in CAH is comparable to that of EEC grade 1 (Fig. 2B and C).

Increased expression of IGF-IR has been reported in cancers of the colon, prostate, and breast, often in association with an increased expression of IGF-I or IGF-II (2731). Increased expression of IGF-IR has been identified to be an early event in colon and prostate cancer progression, occurring in the corresponding premalignant lesions. Overexpression of IGF-IR protein has been reported in prostatic intraepithelial neoplasia and colonic adenoma; accompanied by an increase in IGF-I or IGF-II expression (3133). For endometrial CAH and EEC grade 1, it seems that only the receptor is increased. This is one of the few reports of increased IGF-IR expression in a premalignant condition, and is the only report of increased activation, as measured by phosphorylation of IGF-IR.

We do not know the molecular factors that account for the up-regulation of the expression of IGF-IR. Estrogen itself does not increase IGF-IR gene expression (34). IGF-IR is a target of transcriptional regulation by Akt (35). Tanno et al. identified that Akt activation up-regulates protein expression of the IGF-IR in human pancreatic cell lines, PANC-1 and AsPC-1. In addition, AKT inhibition by PTEN suppressed the expression of IGF-IR (35). This presents the possibility of a feed forward loop, in which loss of PTEN expression due to mutation and the overexpression of IGF-IR may be driven by activated Akt. Our studies indicate that the global activation of IGF-IR is associated with the activation of Akt independent of the focal loss of PTEN. This presents the possibility that in endometrial CAH, IGF-IR activation may precede PTEN loss in the molecular hierarchy of events.

Recent studies have shown that the distinction between CAH and EEC grade 1 can be quite difficult following the microscopic examination of an endometrial biopsy (36). Furthermore, the rate of concurrent EC at the time of hysterectomy in patients with a biopsy diagnosis of CAH is quite high (42.6%; ref. 37). These issues are important, as many premenopausal women with a biopsy diagnosis of hyperplasia are reluctant to consent to hysterectomy, and may seek hormonal therapy with high dose progestins instead. Therefore, molecular markers of cancer risk in endometrial biopsies with hyperplasia would be useful at the clinical level. Unfortunately, such molecular markers do not exist at this time. In the present study, we found that CAH biopsy cases in which there was both loss of PTEN, and increased levels of IGF-IR, were associated with the presence of EEC grade 1 in the subsequent hysterectomy specimen (Fig. 4). The majority (14 of 18, 78%) of the EEC grade 1 cases examined in the present study showed a concurrent profile of PTEN loss and elevated activated IGF-IR. Although the numbers in the present study are small, a prospective study in which PTEN and IGF-IR are assessed in endometrial biopsies with CAH would be helpful in determining if these markers are predictive of concurrent/subsequent development of endometrial carcinoma in the hysterectomy specimen. Pharmacologic suppression of IGF-I signaling by small molecule inhibitors or monoclonal antibodies to the IGF-IR, may be a good target for the prevention of endometrial cancer (3841).

Grant support: NIH Uterine Cancer Specialized Programs of Research Excellence (1P50CA098258-01).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Widra EA, Dunton CJ, McHugh M, Palazzo JP. Endometrial hyperplasia and the risk of carcinoma.
Int J Gynecol Cancer
1995
;
5
:
233
–5.
2
Kurman RJ, Kaminski PF, Norris HJ. The behavior of endometrial hyperplasia. A long-term study of “untreated” hyperplasia in 170 patients.
Cancer
1985
;
56
:
403
–12.
3
Antunes CM, Strolley PD, Rosenshein NB, et al. Endometrial cancer and estrogen use. Report of a large case-control study.
N Engl J Med
1979
;
300
:
9
–13.
4
Ettinger B, Golditch IM, Friedman G. Gynecologic consequences of long-term, unopposed estrogen replacement therapy.
Maturitas
1988
;
10
:
271
–82.
5
Gambrell RD, Jr. Estrogens, progestogens and endometrial cancer.
J Reprod Med
1977
;
18
:
301
–6.
6
Kreiger N, Marrett LD, Clarke EA, Hilditch S, Woolever CA. Risk factors for adenomatous endometrial hyperplasia: a case-control study.
Am J Epidemiol
1986
;
123
:
291
–301.
7
Kistner RW, Krantz KE, Lebherz TB, et al. Endometrial cancer: rising incidence, detection and treatment.
J Reprod Med
1973
;
10
:
53
–74.
8
Judd HL, Davidson BJ, Frumar AM, Shamonki IM, Lagasse LD, Ballon SC. Serum androgens and estrogens in postmenopausal women with and without endometrial cancer.
Am J Obstet Gynecol
1980
;
136
:
859
–71.
9
Knab DR. Estrogen and endometrial carcinoma.
Obstet Gynecol Surv
1977
;
32
:
267
–81.
10
Truss M, Beato M. Steroid hormone receptors: interaction with deoxyribonucleic acid and transcription factors.
Endocr Rev
1993
;
14
:
459
–79.
11
Rutanen EM. Insulin-like growth factors in endometrial function.
Gynecol Endocrinol
1998
;
12
:
399
–406.
12
O'Toole SA, Dunn E, Sheppard BL, et al. Oestrogen regulated gene expression in normal and malignant endometrial tissue.
Maturitas
2005
;
51
:
187
–98.
13
Glass CK, Rosenfeld MG. The coregulator exchange in transcriptional functions of nuclear receptors.
Genes Dev
2000
;
14
:
121
–41.
14
Shiozawa T, Miyamoto T, Kashima H, Nakayama K, Nikaido T, Konishi I. Estrogen-induced proliferation of normal endometrial glandular cells is initiated by transcriptional activation of cyclin D1 via binding of c-Jun to an AP-1 sequence.
Oncogene
2004
;
23
:
8603
–10.
15
Lee YR, Park J, Yu HN, Kim JS, Youn HJ, Jung SH. Up-regulation of PI3K/Akt signaling by 17β-estradiol through activation of estrogen receptor-α, but not estrogen receptor-β, and stimulates cell growth in breast cancer cells.
Biochem Biophys Res Commun
2005
;
336
:
1221
–6.
16
Irwin JC, de las Fuentes L, Dsupin BA, Giudice LC. Insulin-like growth factor regulation of human endometrial stromal cell function: coordinate effects on insulin-like growth factor binding protein-1, cell proliferation and prolactin secretion.
Regul Pept
1993
;
48
:
165
–77.
17
Irwin JC, de las Fuentes L, Giudice LC. Growth factors and decidualization in vitro.
Ann N Y Acad Sci
1994
;
734
:
7
–18.
18
Shiraga M, Takahashi S, Miyake T, Takeuchi S, Fukamachi H. Insulin-like growth factor-I stimulates proliferation of mouse uterine epithelial cells in primary culture.
Proc Soc Exp Biol Med
1997
;
215
:
412
–7.
19
Tang XM, Rossi MJ, Masterson BJ, Chegini N. Insulin-like growth factor I (IGF-I), IGF-I receptors, and IGF binding proteins 1–4 in human uterine tissue: tissue localization and IGF-I action in endometrial stromal and myometrial smooth muscle cells in vitro.
Biol Reprod
1994
;
50
:
1113
–25.
20
Strowitzki T, Singer GA, Rettig I, Capp E. Characterization of receptors for insulin-like growth factor type I on cultured human endometrial stromal cells: downregulation by progesterone.
Gynecol Endocrinol
1996
;
10
:
229
–40.
21
Wu X, Senechal K, Neshat MS, Whang YE, Sawyers CL. The PTEN/MMAC1 tumor suppressor phosphatase functions as a negative regulator of the phosphoinositide 3-kinase/Akt pathway.
Proc Natl Acad Sci U S A
1998
;
95
:
15587
–91.
22
Mutter GL, Lin MC, Fitzgerald JT, et al. Altered PTEN expression as a diagnostic marker for the earliest endometrial precancers.
J Natl Cancer Inst
2000
;
92
:
924
–30.
23
Physical Status: The use and interpretation of anthropometry. WHO Technical Report. Geneva: WHO; 1995.
24
Deng L, Shipley GL, Loose-Mitchell DS, et al. Coordinate regulation of the production and signaling of retinoic acid by estrogen in the human endometrium.
J Clin Endocrinol Metab
2003
;
88
:
2157
–63.
25
Kato H, Faria TN, Stannard B, Roberts CT, Jr., LeRoith D. Essential role of tyrosine residues 1131, 1135, and 1136 of the insulin-like growth factor-I (IGF-I) receptor in IGF-I action.
Mol Endocrinol
1994
;
8
:
40
–50.
26
Brader S, Eccles SA. Phosphoinositide 3-kinase signalling pathways in tumor progression, invasion and angiogenesis.
Tumori
2004
;
90
:
2
–8.
27
Roy RN, Gerulath AH, Cecutti A, Bhavnani BR. Discordant expression of insulin-like growth factors and their receptor messenger ribonucleic acids in endometrial carcinomas relative to normal endometrium.
Mol Cell Endocrinol
1999
;
153
:
19
–27.
28
Ouban A, Muraca P, Yeatman T, Coppola D. Expression and distribution of insulin-like growth factor-1 receptor in human carcinomas.
Hum Pathol
2003
;
34
:
803
–8.
29
Weber MM, Fottner C, Liu SB, Jung MC, Engelhardt D, Baretton GB. Overexpression of the insulin-like growth factor I receptor in human colon carcinomas.
Cancer
2002
;
95
:
2086
–95.
30
Mishra L, Bass B, Ooi BS, Sidawy A, Korman L. Role of insulin-like growth factor-I (IGF-I) receptor, IGF-I, and IGF binding protein-2 in human colorectal cancers.
Growth Horm IGF Res
1998
;
8
:
473
–9.
31
Cardillo MR, Monti S, Di Silverio F, Gentile V, Sciarra F, Toscano V. Insulin-like growth factor (IGF)-I, IGF-II and IGF type I receptor (IGFR-I) expression in prostatic cancer.
Anticancer Res
2003
;
23
:
3825
–35.
32
Liao Y, Abel U, Grobholz R, et al. Up-regulation of insulin-like growth factor axis components in human primary prostate cancer correlates with tumor grade.
Hum Pathol
2005
;
36
:
1186
–96.
33
Freier S, Weiss O, Eran M, et al. Expression of the insulin-like growth factors and their receptors in adenocarcinoma of the colon.
Gut
1999
;
44
:
704
–8.
34
Konopka B, Skasko E, Kluska A, et al. Changes in the concentrations of receptors of insulin-like growth factor-I, epithelial growth factor, oestrogens and progestagens in adenomyosis foci, endometrium and myometrium of women during menstrual cycle.
Eur J Gynaecol Oncol
1998
;
19
:
93
–7.
35
Tanno S, Tanno S, Mitsuuchi Y, Altomare DA, Xiao GH, Testa JR. AKT activation up-regulates insulin-like growth factor I receptor expression and promotes invasiveness of human pancreatic cancer cells.
Cancer Res
2001
;
61
:
589
–93.
36
Zaino RJ, Kauderer J, Trimble CL, et al. Reproducibility of the diagnosis of atypical endometrial hyperplasia: a Gynecologic Oncology Group Study.
Cancer
2006
;
106
:
804
–11.
37
Trimble CL, Kauderer J, Zaino R, et al. Concurrent endometrial carcinoma in women with a biopsy diagnosis of atypical endometrial hyperplasia: a Gynecologic Oncology Group study.
Cancer
2006
;
106
:
812
–9.
38
Wittman M, Carboni J, Attar R, et al. Discovery of a (1H-benzoimidazol-2-yl)-1H-pyridin-2-one (BMS-536924) inhibitor of insulin-like growth factor I receptor kinase with in vivo antitumor activity.
J Med Chem
2005
;
48
:
5639
–43.
39
Garcia-Echeverria C, Pearson MA, Marti A, et al. In vivo antitumor activity of NVP-AEW541-A novel, potent, and selective inhibitor of the IGF-IR kinase.
Cancer Cell
2004
;
5
:
231
–9.
40
Maloney EK, McLaughlin JL, Dagdigian NE, et al. An anti-insulin-like growth factor I receptor antibody that is a potent inhibitor of cancer cell proliferation.
Cancer Res
2003
;
63
:
5073
–83.
41
Wang Y, Hailey J, Williams D, et al. Inhibition of insulin-like growth factor-I receptor (IGF-IR) signaling and tumor cell growth by a fully human neutralizing anti-IGF-IR antibody.
Mol Cancer Ther
2005
;
4
:
1214
–21.