Purpose: Chondrosarcoma is a malignant cartilaginous matrix–producing tumor that can be lethal in 10% to 50% of the patients. Surgery is the only effective treatment known as these tumors are notorious refractory to all types of conventional chemotherapy or radiotherapy. To identify a target for therapy, we want to determine whether estrogen signaling is active in chondrosarcoma because estrogen is important in the regulation of longitudinal growth that is initiated by chondrocyte proliferation and differentiation in the epiphyseal growth plate of long bones.

Experimental Design: We studied protein expression of the estrogen receptor in 35 cartilaginous tumors as well as mRNA levels for the estrogen receptor and for aromatase, an enzyme for estrogen synthesis and another potential therapeutic target. Furthermore, the activity of aromatase was determined in vitro by the tritiated water release assay. Dose-response experiments with chondrosarcoma cultured cells were done with estrogen, androstenedione, and exemestane.

Results: All chondrosarcomas tested showed mRNA and nuclear protein expression of the estrogen receptor. Also, aromatase mRNA was detected. The aromatase activity assay showed a functional aromatase enzyme in primary chondrosarcoma cultures and in a cell line. Growth of chondrosarcoma cell cultures can be stimulated by adding estrogen or androstenedione, which can be inhibited by exemestane.

Conclusions: These results show, on the RNA, protein, and cell biological levels, that the ligand and the receptor are active in estrogen-mediated signal transduction. This observation implicates potential use of targeted drugs that interfere with estrogen signaling, such as those applied for treating breast cancer.

Chondrosarcoma is a malignant cartilaginous matrix–producing tumor, which, depending on the site of occurrence and histologic grade, can be lethal in 10% to 50% of the patients. Different clinical and histologic subtypes are discerned of which conventional chondrosarcoma is the most frequent, subclassified in central (originating in the medulla of bone) and peripheral (at the surface of bone) secondary to a benign osteochondroma (1). Enchondroma is a benign lesion that may be the precursor of central chondrosarcoma. Chondrosarcoma is further stratified by histologic grade, and, especially, patients with grade 2 and 3 tumors have a dismal 5-year survival of ∼53% due to irresectible recurrences or metastases (2). Often, surgery is the only effective treatment known. These tumors are refractory to conventional chemotherapy or radiotherapy (2, 3).

Sex steroids, especially estrogen, are important in the regulation of longitudinal skeletal growth that results from chondrocyte proliferation and differentiation in the epiphyseal growth plate of long bones. Both the initiation of the pubertal growth spurt and the closure of the growth plate that finalizes longitudinal growth at the end of puberty are regulated by estrogen (4). It is now clear that estrogen exerts these effects in both sexes through the identification of male patients with deficiencies in either aromatase p450 or the estrogen receptor (ER) α (5).

Estrogen plays a role in skeletal maturation, which involves the progressive ossification of the epiphyseal growth plate through vascular and osteoblastic invasion, proteolysis of the mineralized cartilage matrix, and bone formation. The mechanism of this process is as yet unknown. Estrogen may be involved in vascular invasion because it was shown to stimulate vascular endothelial growth factor (6) and angiogenesis in breast cancer cells (7). In this respect, it is of interest that progression of chondrosarcoma is characterized by neovascularization as identified by fast contrast magnetic resonance imaging (8). Also, degradation of the matrix may be stimulated by estrogen because it was shown to induce heparanase (9).

Aromatase p450 converts androstenedione into estrone, which is converted to the active compound estradiol by 17β-hydroxysteroid dehydrogenase. Estradiol production takes place primarily in the gonads but there is also extraglandular production, mostly through adrenal androstenedione, which is converted to estrone in the periphery. Aromatase expression and estrogen synthesis take place in the ovaries, adipose tissue, brain, placenta, bone, fetal liver, smooth muscle cells, and chondrocytes in the epiphyseal growth plate (10). Increased aromatase expression is shown in breast tumors both in stromal and tumor cells (11).

Binding of estradiol to the cytoplasmic ER causes release of ER from heat shock proteins and dimerization. Dimerized ER is subsequently translocated to the nucleus where it activates genes with an estrogen responsive element. Genes with proved regulation by estrogen are available from the estrogen responsive gene database (12). Two forms of estradiol receptor have been identified, α and β, which form homodimers or heterodimers.

Estrogen is believed to initiate and promote the process of breast carcinogenesis by enhancing the rate of cell division and reducing time available for DNA repair. Drugs that interfere with estrogen signaling have been applied successfully for treatment of breast cancer (13). Two different strategies have been developed for treatment of hormone-dependent breast cancer: antagonizing the ER (e.g., tamoxifen; ref. 14) and inhibition of estradiol biosynthesis by aromatase inhibitors (15). Much effort has been put into the development of hormone therapy for breast cancer and these drugs may also be efficient in eradicating other estrogen-dependent tumors, like ovarian and endometrial cancer.

Because estrogen-mediated signaling plays a role in cartilaginous proliferation and differentiation, we hypothesized that antiestrogen or aromatase inhibitors could potentially have an inhibitory effect on proliferation of chondrosarcomas. In this report, we show that the estrogen pathway is indeed active in chondrosarcoma both on the level of the production of the ligand through aromatase activity and the level of its receptor through the presence of nuclear protein expression of ERα. This implies a rationale for drugs interfering with this pathway like aromatase and tamoxifen for the treatment of metastasized or irresectable chondrosarcoma.

Patients. For this study, cartilaginous tumor samples were used from 35 patients as well as from three normal growth plate samples. Paraffin-embedded formalin-fixed, and fresh frozen tissues were obtained from the archives of the Department of Pathology at Leiden University Medical Center. Tumors were reviewed histopathologically by an expert bone pathologist (P.C.W. Hogendoorn). Patient samples and their characteristics are listed in Table 1. The tumor series consists of 4 enchondromas, 7 osteochondromas, and 24 chondrosarcomas. All samples were obtained and handled according to the ethical rules for the use of human material as defined by the Dutch Association of Medical Sciences.

Table 1.

Cartilaginous tissue samples, ERα immunuhistochemical staining, and quantitative PCR for ESR1 and CYP19

No.L-nrDiagnosisGenderERα staining
RNA expression
Aromatase activity
NuclearCytoplasmicESR1CYP19
205 EC ± −    
206 EC −    
895 EC − −    
1,251 EC ± 1.8 −0.2  
202 OC −    
726 OC    
841 OC −    
1,070 OC −    
1,094 OC −    
10 1,173 OC −    
12 1,260 OC −    
13 43 CSI-C ± − 1.7  
14 163 CSI-P ± −    
15 821 CSI-C ±    
16 875 CSI-C    
17 172 CSII-C NA NA 0.9 1.7  
18 286 CSII-C ± − 1.3  
19 654 CSII-C ± − 0.2 −0.3  
20 784 CSII-C ± −   − 
21 813 CSII-C 0.2 −0.3  
22 869 CSII-C 0.6 
23 908 CSII-C ± 1.3 1.1  
24 1,081 CSII −    
25 1,101 CSII-P    
26 1,154 CSII-P ± − 0.5 0.5  
27 1,176 CSII-C 1.1 1.2  
28 H01-7424 CSII    
29 728 CSIII-P    
30 795 CSIII-C − 1.1 0.1  
31 835 CSIII-C 0.4 0.4 
32 900 CSIII-C −   
33 903 CSIII-C ± 1.2  
34 1,066 CSIII-C − 0.3  
35 1,158 CSIII −    
36 1,243 CSIII-C ± 0.8 0.5  
37 867 GP − 1.7 0.7  
38 1,163 GP NA − 0.1 0.6  
39 1,185 GP NA NA NA 0.9 1.6  
No.L-nrDiagnosisGenderERα staining
RNA expression
Aromatase activity
NuclearCytoplasmicESR1CYP19
205 EC ± −    
206 EC −    
895 EC − −    
1,251 EC ± 1.8 −0.2  
202 OC −    
726 OC    
841 OC −    
1,070 OC −    
1,094 OC −    
10 1,173 OC −    
12 1,260 OC −    
13 43 CSI-C ± − 1.7  
14 163 CSI-P ± −    
15 821 CSI-C ±    
16 875 CSI-C    
17 172 CSII-C NA NA 0.9 1.7  
18 286 CSII-C ± − 1.3  
19 654 CSII-C ± − 0.2 −0.3  
20 784 CSII-C ± −   − 
21 813 CSII-C 0.2 −0.3  
22 869 CSII-C 0.6 
23 908 CSII-C ± 1.3 1.1  
24 1,081 CSII −    
25 1,101 CSII-P    
26 1,154 CSII-P ± − 0.5 0.5  
27 1,176 CSII-C 1.1 1.2  
28 H01-7424 CSII    
29 728 CSIII-P    
30 795 CSIII-C − 1.1 0.1  
31 835 CSIII-C 0.4 0.4 
32 900 CSIII-C −   
33 903 CSIII-C ± 1.2  
34 1,066 CSIII-C − 0.3  
35 1,158 CSIII −    
36 1,243 CSIII-C ± 0.8 0.5  
37 867 GP − 1.7 0.7  
38 1,163 GP NA − 0.1 0.6  
39 1,185 GP NA NA NA 0.9 1.6  

Abbreviations: L-nr, anonimized patient number; GP, growth plate; EC, enchondroma; OC, osteochondroma; CS, chondrosarcoma; I, II, and III, grades I, II, and III; C, central; P, peripheral; F, female; M, male; U, unknown; NA, not available.

RNA expression. To establish the cartilaginous nature of the primary chondrosarcoma cell cultures, mRNA expression for a number of cartilage-specific genes was done using reverse transcription-PCR. Primers for the detection of Collagen 10A1, Aggrecan, and SOX 9 were designed using the Primer3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and span at least one exon-intron boundary and are listed in Table 2. Collagen 1A1 and hypoxanthine phosphoribosyltransferase expression are not specific for cartilage and are a control for integrity of the cDNA. RNA was extracted from the cultured cells using TRIzol (Invitrogen, Carlsbad, CA). cDNA was generated in 20 μL reaction containing 2 μg total RNA, 100 ng oligo(dT) primer, 500 ng random hexamer (Invitrogen), avian myeloblastosis virus–reverse transcriptase buffer and 5 units avian myeloblastosis virus–reverse transcriptase (Roche, Mannheim, Germany), 20 units Rnasin (Promega, Leiden, the Netherlands), and 1 mmol/L deoxynucleotide triphosphate. Reactions were incubated for 1 hour at 42°C. PCR reactions were done in a GeneAmp PCR system 9700 (Applied Biosystems, Foster City, CA) on 1 μL cDNA in a 25 μL reaction containing 10 pmol of each primer, 1.5 μmol/L MgCl2, 1 × PCR buffer II, and 0.5 unit AmpliTaq (Roche). PCR products were analyzed on 1.5% agarose gels.

Table 2.

Primers for RT PCR

GeneForward primerReverse primerProduct sizeAnnealing temperature (°C)
HPRT ACCGGCTTCCTCCTCCTGAGCAGT AGGACTCCAGATGTTTCCAAACTCAAC 747 68 
COL1A1 GGGTCTAGACATGTTCAGCTTTG GGTCTCGTCACAGATCACGTC 244 57 
COL10A1 TTTTGCTGCTAGTATCCTTGAACTT AGGAGTACCTTGCTCTCCTCTTACT 167 60 
SOX9 ATCTGAAGAAGGAGAGCGAGGAG GTACTTGTAATCCGGGTGGTCCT 347 60 
Aggrecan ATGCCCAAGACTACCAGTGG CAGGGAATTGATCTCATACCG 305 60 
TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC 89 60 
ESR1 TGATTGGTCTCGTCTGGCG CATGCCCTCTACACATTTTCCC 101 60 
CYP19 AAAGAATGTTCCTTATAGGTACTTTCAGC CATGGCGATGTACTTTCCTGC 76 60 
GeneForward primerReverse primerProduct sizeAnnealing temperature (°C)
HPRT ACCGGCTTCCTCCTCCTGAGCAGT AGGACTCCAGATGTTTCCAAACTCAAC 747 68 
COL1A1 GGGTCTAGACATGTTCAGCTTTG GGTCTCGTCACAGATCACGTC 244 57 
COL10A1 TTTTGCTGCTAGTATCCTTGAACTT AGGAGTACCTTGCTCTCCTCTTACT 167 60 
SOX9 ATCTGAAGAAGGAGAGCGAGGAG GTACTTGTAATCCGGGTGGTCCT 347 60 
Aggrecan ATGCCCAAGACTACCAGTGG CAGGGAATTGATCTCATACCG 305 60 
TBP CACGAACCACGGCACTGATT TTTTCTTGCTGCCAGTCTGGAC 89 60 
ESR1 TGATTGGTCTCGTCTGGCG CATGCCCTCTACACATTTTCCC 101 60 
CYP19 AAAGAATGTTCCTTATAGGTACTTTCAGC CATGGCGATGTACTTTCCTGC 76 60 

The level of mRNA expression for ERα (ESR1) and aromatase (CYP19) genes was determined using quantitative real-time PCR. cDNA was synthesized as described above. Primers were designed using Beacon Designer 2.0 software (Biosoft International, Palo Alto, CA). PCR was done with the quantitative PCR core kit for SYBR green I supplemented with fluorescin (Eurogentec, Seraing, Belgium) on 0.2 μL cDNA per reaction in an iCycler iQ Real-time Detection system (Bio-Rad Laboratories, Hercules, CA). PCR was done for 40 cycles.

To calculate the relative mRNA levels, we measured the threshold cycle values of a standard curve with a known amount of total RNA. The relative gene expression level of for each sample was normalized for the amount of cDNA input using TATA-binding protein (TBP), a housekeeping gene whose expression is rather constant in chondrosarcoma. The expression level of ESR1 and CYP19 was calculated by dividing the relative value of the gene by the value of the TBP gene. All primer sequences and the annealing temperatures are listed in Table 1.

Immunohistochemistry. Immunohistochemistry for ERα was done with a rabbit anti-human ER polyclonal antibody (Zymed, San Francisco, CA) at a dilution of 1:150. Staining was done as described (16). An ER-positive breast cancer was used as positive control. ER positivity for this breast cancer sample was determined biochemically as described (17). Corresponding species- and isotype-specific IgGs were used as negative controls. Immunohistochemical results were scored negative (−), intermediate (±), or positive (+). Nuclear staining is considered as active ER signaling.

Primary cultures of chondrosarcoma. A sample of surgically removed tumor was collected using sterile forceps and knife and cut into small pieces using a surgical blade. The tumor was incubated overnight at room temperature in dissociation medium containing 0.1% collagenase (Sigma, Zwijndrecht, the Netherlands), 0.1% dispase (Life Technologies, Breda, the Netherlands), 100 IU/mL penicillin, and 100 μg/mL streptomycin (ICN Biomedicals, Inc., Zoetermeer, the Netherlands) to facilitate dissociation of the cells. Tumor cells were washed thrice with RPMI 1640 and placed in a T25 culture flask containing 10 mL RPMI with 10% FCS, 50 IU/mL penicillin, and 50 μg/mL streptomycin. A subset of the chondrosarcomas collected started cell division in vitro after a few weeks and underwent several passages.

Analysis of aromatase activity by tritiated water release assay. Aromatase bioactivity was determined using the tritiated water release assay as described (18) with small modifications.

In short, chondrosarcoma primary cultures of four passages or more were cultured in T75 flasks until 70% confluence and incubated with 2 μCi [1β-3H]androstenedione (specific activity = 25.9 Ci/mmol; NEN Life Science Products, Boston, MA) overnight in 1.5 mL of serum-free and phenol red–free MEM supplemented with 0.1% bovine serum albumin and 100 units/mL aprotinin. In addition, two established chondrosarcoma cell lines were included, SW1353 from the American Type Culture Collection (Manassas, VA) and OUMS27 kindly provided by Dr. M. Namba (Department of Cell Biology, Institute of Molecular and Cellular Biology, Okayama University Medical School, Shikata, Japan; 19). Cells were cultured in duplicate and for each cell line one flask was incubated with exemestane from Aromasin tablets (Pfizer, Uppsala, Sweden). On SW1353 cells, using increasing concentrations of exemestane, the inhibition of the total amount of tritiated water release gradually decreased and reached a maximum of 83% reduction at 30 μmol/L. This inhibition was within the same range as established previously (18). This concentration of 30 μmol/L exemestane was used in the other measurements to correct for aspecific tritiated water release. The next day, an equal volume of lysis buffer [100 mmol/L NaCl, 10 mmol/L Tris (pH 8.0), 25 mmol/L EDTA, 0.05% SDS, and 50 μg/mL proteinase K] was added and samples were incubated for 1 hour at 56°C. Part of this solution was used for total DNA determination using the Hoechst assay (ICN Biomedicals). Three extractions with chloroform were done and the water phase was assayed for tritium radioactivity. The chloroform fractions were pooled and counted. 3H radioactivity was measured in a Packard 1600 TR liquid scintillation analyzer (Canberra Packard, Zellik, Belgium). Results were corrected for blanks (incubation without cells), recovery loss, and DNA content. The average activity and the SE were calculated. The amount of tritiated water released was expressed in fentomoles per microgram DNA.

Cell growth assay. Cells were grown on phenol red–free RPMI medium with 10% FCS, which was depleted for steroids by charcoal absorption. Cells were seeded in six-well plates (10−4 cells per well) and 4-androstene-3,17-dione (Sigma) was added in concentrations ranging from 10−6 to 10−10 mol/L. Cells were cultured for 7 days and subsequently counted using a CASY1 Cell Counter (Schärfe System GmbH, Reutlingen, Germany). To test the toxicity of exemestane on the chondrosarcoma cells, the cells were cultured for 7 days in the presence of exemestane ranging from 100 to 0.01 μmol/L and subsequently counted. Estrogen was added to these cells in a physiologic concentration (10−7 mol/L) to be sure that the inhibition of cell growth is a result of the toxicity of exemestane and not a result of the absence of steroids, which are necessary for a normal proliferation. For the inhibition experiments, exemestane was added to the most optimal stimulating 4-androstene-3,17-dione concentration (10−7 mol/L) in doses ranging from 10−5 to 10−8 mol/L and the cells were counted after 7 days.

ESR1 and CYP19 RNA expression. The expressions of two important genes involved in estrogen signaling, ESR1 and CYP19, were determined using quantitative real-time PCR on two chondrosarcoma cell lines, SW1353 and OUMS-27, and five primary cultures of chondrosarcoma. RNA expression was also tested in primary tissues, derived from 3 normal growth plate samples, 2 enchondromas, and 13 chondrosarcomas. For ESR1, RNA from MCF7 breast cancer cell line was used as a positive control. RNA from placenta was used as a positive control for CYP19 expression. The samples used and their nature are listed in Table 1. Figure 1 and Table 1 show the result for RNA expression for CYP19 and ESR1 after normalization of the real-time PCR data to correct for different RNA input. RNA expression values are expressed as a ratio of relative mRNA values for the test gene and the TBP housekeeping gene. For a better visualization, the values were log transformed. All samples expressed ESR1 and CYP19 albeit at rather varying levels. All cDNAs tested in the real-time PCR assay showed a band on agarose gel, indicating that all samples were positive for expression of both genes.

Fig. 1.

Quantitative reverse transcription-PCR for ESR1 (black columns) and CYP19 (gray columns). Normalized expression levels were log transformed. Clinical data on tissue samples are shown in Table 1. The last seven samples in this graph are results from in vitro cultures, two established cell lines (OUMS27 and SW 1353), and five primary chondrosarcoma cell cultures.

Fig. 1.

Quantitative reverse transcription-PCR for ESR1 (black columns) and CYP19 (gray columns). Normalized expression levels were log transformed. Clinical data on tissue samples are shown in Table 1. The last seven samples in this graph are results from in vitro cultures, two established cell lines (OUMS27 and SW 1353), and five primary chondrosarcoma cell cultures.

Close modal

Estrogen receptor nuclear protein expression. Protein expression of ERα was determined in 3 normal growth plates, 4 enchondromas, 7 osteochondromas, and 24 chondrosarcomas by immunohistochemistry using an antibody, which was previously reported to reliably detect ERα in cartilaginous tissue (20). Table 1 shows the protein expression for all samples tested. No difference in staining pattern between central or peripheral chondrosarcomas is observed. Figure 2 shows an example of a grade 2 secondary peripheral chondrosarcoma with positive staining for ERα in the nucleus. All but one cartilaginous tumors stained positive for ERα. This negative tumor was an enchondroma. However, three other enchondromas showed positive nuclear staining. Cytoplasmic in addition to nuclear staining was observed in 41% of the tumors.

Fig. 2.

Light micrograph showing immunohistochemical staining for ERα on a grade 2 chondrosarcoma. Magnification, ×75.

Fig. 2.

Light micrograph showing immunohistochemical staining for ERα on a grade 2 chondrosarcoma. Magnification, ×75.

Close modal

Aromatase activity in chondrosarcoma. Aromatase activity was determined in six primary cultures of chondrosarcomas and in two established chondrosarcoma cell lines. Table 3 and Fig. 3 show the results of the tritiated water release assay. Inhibition by exemestane of the aromatase activity is a measure for specific activity of the enzyme. The maximum inhibition of aromatase activity was previously reported to be 72% in growth plate chondrocytes from rats (18). One established cell line, SW1353, and five of six primary chondrosarcoma cultures all showed inhibition of aromatase activity in the same range (i.e., 60% to 83%). Established chondrosarcoma cell line OUMS27 showed 24% inhibition and one primary culture, L784, showed only 5% inhibition by exemestane. Also, the absolute values of aromatase activity were low in these two cases. Therefore, these two cases were considered as negative for aromatase activity. For five of eight samples, quantitative PCR data were available for CYP19 expression. OUMS27 and L784 both show very low CYP19 mRNA expression, whereas SW1353, L835, and L869 all show CYP19 RNA expression in the same range as most samples (Fig. 2), indicating that CYP19 RNA expression was in concordance with the enzymatic activity of aromatase.

Table 3.

Aromatase activity assay and characterization of the primary cultures used

GenderAge at diagnosisLocationGradeSOX 9Col10A1AggrecanCol1A1HPRTPercentage exemestane inhibition (%)
SW1353 72 Humerus − 83 
OUMS 27 Humerus − 24 
L784 40 Tibia − 
L853 55 Humerus − 79 
L869 52 Tibia − 90 
L877 56 Femur − 63 
L900 42 Scapula ± ± 76 
L1177 39 Femur − 60 
GenderAge at diagnosisLocationGradeSOX 9Col10A1AggrecanCol1A1HPRTPercentage exemestane inhibition (%)
SW1353 72 Humerus − 83 
OUMS 27 Humerus − 24 
L784 40 Tibia − 
L853 55 Humerus − 79 
L869 52 Tibia − 90 
L877 56 Femur − 63 
L900 42 Scapula ± ± 76 
L1177 39 Femur − 60 

Abbreviations: Col10A1, Collagen 10A1; Col1A1, Collagen 1A1; HPRT, hypoxanthine phosphoribosyltransferase; U, unknown.

Fig. 3.

Aromatase activity assay on two established cell lines and six primary chondrosarcoma cell cultures. Black columns, aromatase activity without exemestane; white columns, activity upon inhibition with exemestane.

Fig. 3.

Aromatase activity assay on two established cell lines and six primary chondrosarcoma cell cultures. Black columns, aromatase activity without exemestane; white columns, activity upon inhibition with exemestane.

Close modal

Stimulation of growth by 4-androstene-3,17-dione and inhibition by exemestane. Three primary chondrosarcoma cell cultures were tested for growth stimulation by estrogen and by androstenedione, the precursor of estrogen that is converted by aromatase. A dose-response curve for estrogen-mediated growth stimulation is shown for the primary chondrosarcoma culture L869 and cell line SW1353 (Fig. 4A) and shows stimulation of growth. Growth stimulation was detectable at physiologic concentrations of 10−9 to 10−10 and at maximum at pharmacologic concentrations of 10−7 (21). Androstenedione was shown to enhance cell growth in the two primary cultures that were shown to have aromatase activity in the tritiated water release assay in a dose-response like manner as shown in Fig. 4B. Primary culture L784 could not be stimulated by androstenedione, compliant with its lack of aromatase activity.

Fig. 4.

A, growth stimulation of a primary chondrosarcoma cell culture (C-L869) and an established cell line (SW1353) by 17β estradiol. X axis, molar concentrations of estradiol; Y axis, number of cells counted. A concentration of 10−7 mol/L shows the most optimal growth stimulation. B, growth stimulation of C-L869 by androstenedione (AS) and lack of stimulation in C-L784, an aromatase-negative chondrosarcoma culture. X axis, molar concentrations of androstenedione; Y axis, number of cells counted. A concentration of 10−7 mol/L shows the most optimal growth stimulation. C, exemestane inhibition of androstenedione-induced growth. Black columns, cells grown in the presence of 10−7 mol/L androstenedione with decreasing concentrations of exemestane. Gray columns, cells grown without exemestane and androstenedione (no AS).

Fig. 4.

A, growth stimulation of a primary chondrosarcoma cell culture (C-L869) and an established cell line (SW1353) by 17β estradiol. X axis, molar concentrations of estradiol; Y axis, number of cells counted. A concentration of 10−7 mol/L shows the most optimal growth stimulation. B, growth stimulation of C-L869 by androstenedione (AS) and lack of stimulation in C-L784, an aromatase-negative chondrosarcoma culture. X axis, molar concentrations of androstenedione; Y axis, number of cells counted. A concentration of 10−7 mol/L shows the most optimal growth stimulation. C, exemestane inhibition of androstenedione-induced growth. Black columns, cells grown in the presence of 10−7 mol/L androstenedione with decreasing concentrations of exemestane. Gray columns, cells grown without exemestane and androstenedione (no AS).

Close modal

This androstenedione-mediated growth stimulation could be inhibited by exemestane, again depending on the dose of exemestane administered. Exemestane was shown to be toxic in chondrosarcoma cells and caused growth inhibition ranging from 26% to 61% at a concentration of 100 μmol/L. Also, 10 μmol/L is slightly toxic. At 1 μmol/L, there is no inhibition of estrogen-mediated growth by exemestane. Figure 4C shows a dose-dependent inhibition by exemestane of the growth stimulation in L869 cells grown in the presence of 10−7 mol/L androstenedione, an effect that could not be observed in L784. Growth of L869 at 1 μmol/L exemestane, the nontoxic dose, showed a similar level as cells cultured without androstenedione.

This comprehensive study shows, on the RNA, protein, and cell biological levels, that the estrogen signal transduction pathway is active in cartilaginous tumors and plays an important role in cell proliferation. The expression of CYP19 mRNA, the gene encoding aromatase, was shown in cartilaginous tissue, both normal and neoplastic. For six primary chondrosarcoma samples, growing cells were available in which the aromatase activity was tested. Only one sample, C-L784, was negative in this assay, corresponding to low mRNA as shown by the quantitative reverse transcription-PCR (Fig. 1). Also, for the established cell line OUMS 27, the quantitative PCR and the aromatase activity assay were concordant. For two primary cultures, C-L835 and C-L869, and established cell line, SW1353, that were positive for aromatase activity, the CYP19 RNA expression was about six times higher than in the cells that were negative for aromatase activity. This indicates that aromatase activity is present in the majority of chondrosarcomas.

Protein expression for ERα was shown in 97% of cartilaginous tumors tested (n = 35). One enchondroma was negative for nuclear ERα staining. The series contained three other enchondromas, of which one showed expression in only 25% of the cells. All other lesions (i.e., 24 chondrosarcomas and 7 osteochondromas) showed strong positive staining in the majority of the cells. This indicates that ERα expression is a common phenomenon in chondrosarcomas and osteochondromas. ERα staining showed predominantly nuclear staining in chondrosarcoma; however, in a few cases, cytoplasmic staining was seen focally. Nuclear staining indicates that estrogen-mediated signaling is active because estrogen translocates ER to the nucleus where it activates transcription of ER-responsive genes. There is, however, also a nongenomic activity of ER, operable in the cytoplasm and acting through mitogen-activated protein kinase signaling. Genomic and nongenomic estrogen signaling in the rat growth plate was reported previously (22). The identification of cells with ERα cytoplasmic staining in some chondrosarcomas may suggest, albeit focally, a role for nongenomic estrogen signal transduction. For this staining, we used an antibody that had been reported previously to be suitable for staining cartilaginous tissue (20). This study showed positive nuclear ERα staining and occasionally cytoplasmic staining in the growth plate, restricted to the zone of hypertrophic chondrocytes and the osteoblasts.

Recently, we have reported an association between the occurrence of breast cancer and cartilaginous tumors in the same patient (23). Breast tumors of patients with a cartilaginous tumor were significantly more often positive for ERα protein expression (24), thereby providing another potential link between estrogen signaling and chondrosarcoma.

The data presented here suggest that estrogen signaling in chondrosarcoma is intracrine, which is in line with data on human and rat growth plates (4). This is in contrast to breast cancer where some authors claim that the expression of aromatase is only by the intratumoral stromal cells although others claim expression in both epithelial tumor cells and the stroma (25).

Estrogen signaling is not unique for chondrocytes and has been identified in a host of musculoskeletal tissues. Especially desmoid tumors indeed seem to be sensitive for antiestrogen therapy (26). Previous reports are contradictory about the role of estrogen signaling in chondrocytes (27, 28), which could be attributed to different species, age-specific variations, and different methods for determining estrogen activity. Our study shows the presence of components of the pathway both on the mRNA and the protein level as well as biological activity in vitro.

A very important growth regulatory circuit in the cartilaginous growth plate is the Indian Hedgehog–parathyroid hormone–related receptor feedback loop (29). Studies on parathyroid hormone–related receptor in epithelial tissues, especially uterus and breast (27, 30), indicate that expression of this peptide can be regulated by estrogen signaling. There is no conclusive evidence for a similar connection in cartilage; thus, this remains a subject for further study. We have shown that Indian Hedgehog is absent, whereas parathyroid hormone–related receptor is retained in chondrosarcoma, which may indeed point to a role for estrogen in regulation of parathyroid hormone–related receptor (31).

Chondrosarcoma bears phenotypic resemblance to normal cartilage, where estrogen-mediated signaling is complex. In the pubertal growth plate, it is not specifically aimed at proliferation of chondrocytes but at maturation. Therefore, antiestrogen treatment is now being considered to inhibit maturation of longitudinal growth in adolescents with short stature by delaying estrogen-mediated closure of the growth plate (32). This is in contrast with our findings on in vitro cultured cells of chondrosarcoma and nuclear ERα staining in clinical tumor samples. Therefore, the in vivo effect of interference with estrogen signaling will have to be further investigated in animal model systems and carefully designed phase II/III trials to monitor any effects on tumor growth. The effect of estrogen on terminating longitudinal growth is opposite to the growth stimulatory effect that we show on in vitro cultures of chondrosarcoma primary and established cell cultures because these cells are stimulated by estrogen and by androstenedione, the precursor of estrogen at physiologic concentrations. Furthermore, the effect of androstenedione can be specifically inhibited by aromatase, at concentrations that are nontoxic in vitro. These observations suggest that estrogen signaling in cartilaginous tumor cells is an aberrant expression of the pathway, showing growth promotion, at least in vitro. It may imply that interference with this pathway may have a growth-inhibiting effect on chondrosarcoma, corresponding with endocrine breast cancer therapy. Care should be taken by application of such therapy during puberty to avoid interference with longitudinal growth or unwanted complications with pubertal development. Because chondrosarcoma usually presents at adult age, this will not be a point of concern.

Two types of endocrine therapy are available for breast cancer, aromatase inhibition and selective ER modulation. Aromatase is a good target for inhibition because it mediates the last in the series of steps for estrogen synthesis and is the rate-limiting factor (33). Several aromatase inhibitors are available, both steroidal and reversible nonsteroidal inhibitors, and these targeted drugs have been developed because of the pursuit of pharmaceutical industries, motivated to invest in drugs for the most frequent cancer in women.

Chondrosarcoma is a rare tumor type and has therefore not elicited widespread targeted drug development programs. Other potential drug targets have been suggested, e.g., antibodies that interfere with parathyroid hormone–like hormone activity or BCL2 antisense oligonucleotides (3436). Furthermore, molecular genetic investigations have implicated several genetic loci in chondrosarcoma tumorigenesis (37, 38).4

4

L.B. Rozeman, et al. Array-CGH of central chondrosarcoma: identification of RPS6 and CDK4 as candidate target genes, submitted for publication.

Here, we show that estrogen-mediated signaling results in chondrosarcoma cell proliferation in vitro and can be specifically inhibited by exemestane. For this tumorigenic pathway, targeted drugs are already developed and approved, implying a potential for pharmacologically approved systemic drugs to treat metastatic or irresectable chondrosarcoma.

Grant support: Optimix Foundation for Fundamental Research.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

We thank A. Yavas for expert technical assistance and Drs. J.J. Gelderblom, Prof. J.W.R. Nortier, and B.J. van der Eerden for valuable advice.

1
Bertoni F, Bacchini P, Hogendoorn PCW. Chondrosarcoma. In: Fletcher CDM, Unni KK, Mertens F, editors. World Health Organization classification of tumours. Pathology and genetics of tumours of soft tissue and bone. Lyon (France): IARC Press; 2002. p. 247–51.
2
Evans HL, Ayala AG, Romsdahl MM. Prognostic factors in chondrosarcoma of bone. A clinicopathologic analysis with emphasis on histologic grading.
Cancer
1977
;
40
:
818
–31.
3
Lee FY, Mankin HJ, Fondren G, et al. Chondrosarcoma of bone: an assessment of outcome.
J Bone Joint Surg Am
1999
;
81
:
326
–38.
4
Van der Eerden BCJ, Karperien M, Wit JM. The estrogen receptor in the growth plate: implications for pubertal growth.
J Pediatr Endocrinol Metab
2001
;
14
Suppl 6:
1527
–33.
5
Grumbach MM. Estrogen, bone, growth and sex: a sea change in conventional wisdom.
J Pediatr Endocrinol Metab
2000
;
13
Suppl 6:
1439
–55.
6
Mueller MD, Vigne JL, Minchenko A, Lebovic DI, Leitman DC, Taylor RN. Regulation of vascular endothelial growth factor (VEGF) gene transcription by estrogen receptors α and β.
Proc Natl Acad Sci U S A
2000
;
97
:
10972
–7.
7
Elkin M, Orgel A, Kleinman HK. An angiogenic switch in breast cancer involves estrogen and soluble vascular endothelial growth factor receptor 1.
J Natl Cancer Inst
2004
;
96
:
875
–8.
8
Geirnaerdt MJ, Hogendoorn PCW, Bloem JL, Taminiau AHM, Van der Woude HJ. Cartilaginous tumors: fast contrast-enhanced MR imaging.
Radiology
2000
;
214
:
539
–46.
9
Elkin M, Cohen I, Zcharia E, et al. Regulation of heparanase gene expression by estrogen in breast cancer.
Cancer Res
2003
;
63
:
8821
–6.
10
Simpson ER. Sources of estrogen and their importance.
J Steroid Biochem Mol Biol
2003
;
86
:
225
–30.
11
Bulun SE, Simpson ER. Regulation of aromatase expression in human tissues.
Breast Cancer Res Treat
1994
;
30
:
19
–29.
12
Tang S, Han H, Bajic VB. ERGDB: estrogen responsive genes database.
Nucleic Acids Res
2004
;
32
Database issue:
D533
–6.
13
Santen RJ, Harvey HA. Use of aromatase inhibitors in breast carcinoma.
Endocr Relat Cancer
1999
;
6
:
75
–92.
14
Osborne CK, Zhao H, Fuqua SA. Selective estrogen receptor modulators: structure, function, and clinical use.
J Clin Oncol
2000
;
18
:
3172
–86.
15
Simpson ER, Clyne C, Rubin G, et al. Aromatase—a brief overview.
Annu Rev Physiol
2002
;
64
:
93
–127.
16
Bovée JVMG, Van den Broek LJCM, De Boer WI, Hogendoorn PCW. Expression of growth factors and their receptors in adamantinoma of long bones and the implications for its histogenesis.
J Pathol
1998
;
184
:
24
–30.
17
Grill HJ, Manz B, Belovsky O, Pollow K. Criteria for the establishment of a double-labeling assay for simultaneous determination of estrogen and progesterone receptors.
Oncology
1984
;
41
:
25
–32.
18
Van der Eerden BCJ, Van DV, Lowik CW, Wit JM, Karperien M. Sex steroid metabolism in the tibial growth plate of the rat.
Endocrinology
2002
;
143
:
4048
–55.
19
Kunisada T, Miyazaki M, Mihara K, et al. A new human chondrosarcoma cell line (OUMS-27) that maintains chondrocytic differentiation.
Int J Cancer
1998
;
77
:
854
–9.
20
Egerbacher M, Helmreich M, Rossmanith W, Haeusler G. Estrogen receptor-α and estrogen receptor-β are present in the human growth plate in childhood and adolescence, in identical distribution.
Horm Res
2002
;
58
:
99
–103.
21
Rodd C, Jourdain N, Alini M. Action of estradiol on epiphyseal growth plate chondrocytes.
Calcif Tissue Int
2004
;
75
:
214
–24.
22
Van der Eerden BCJ, Emons J, Ahmed S, et al. Evidence for genomic and nongenomic actions of estrogen in growth plate regulation in female and male rats at the onset of sexual maturation.
J Endocrinol
2002
;
175
:
277
–88.
23
Odink AE, van Asperen CJ, Vandenbroucke JP, Cleton-Jansen AM, Hogendoorn PC. An association between cartilaginous tumours and breast cancer in the national pathology registration in The Netherlands points towards a possible genetic trait.
J Pathol
2001
;
193
:
190
–2.
24
Cleton-Jansen AM, Timmerman MC, Van de Vijver MJ, et al. A distinct phenotype characterizes tumors from a putative genetic trait involving chondrosarcoma and breast cancer occurring in the same patient.
Lab Invest
2004
;
84
:
191
–202.
25
Brueggemeier RW, Richards JA, Petrel TA. Aromatase and cyclooxygenases: enzymes in breast cancer.
J Steroid Biochem Mol Biol
2003
;
86
:
501
–7.
26
Tonelli F, Ficari F, Valanzano R, Brandi ML. Treatment of desmoids and mesenteric fibromatosis in familial adenomatous polyposis with raloxifene.
Tumori
2003
;
89
:
391
–6.
27
Rabbani SA, Khalili P, Arakelian A, Pizzi H, Chen G, Goltzman D. Regulation of parathyroid hormone-related peptide by estradiol: effect on tumor growth and metastasis in vitro and in vivo.
Endocrinology
2005
;
146
:
2885
–94.
28
Corvol MT, Carrascosa A, Tsagris L, Blanchard O, Rappaport R. Evidence for a direct in vitro action of sex steroids on rabbit cartilage cells during skeletal growth: influence of age and sex.
Endocrinology
1987
;
120
:
1422
–9.
29
van der Eerden BC, Karperien M, Wit JM. Systemic and local regulation of the growth plate.
Endocr Rev
2003
;
24
:
782
–801.
30
Paspaliaris V, Vargas SJ, Gillespie MT, et al. Oestrogen enhancement of the myometrial response to exogenous parathyroid hormone-related protein (PTHrP), and tissue localization of endogenous PTHrP and its mRNA in the virgin rat uterus.
J Endocrinol
1992
;
134
:
415
–25.
31
Rozeman LB, Hameetman L, Cleton-Jansen AM, Taminiau AHM, Hogendoorn PCW, Bovée JVMG. Absence of IHH and retention of PTHrP signalling in enchondromas and central chondrosarcomas.
J Pathol
2005
;
205
:
476
–82.
32
Wickman S, Sipila I, Ankarberg-Lindgren C, Norjavaara E, Dunkel L. A specific aromatase inhibitor and potential increase in adult height in boys with delayed puberty: a randomised controlled trial.
Lancet
2001
;
357
:
1743
–8.
33
Brodie A. Aromatase inhibitors in breast cancer.
Trends Endocrinol Metab
2002
;
13
:
61
–5.
34
Miyaji T, Nakase T, Onuma E, et al. Monoclonal antibody to parathyroid hormone-related protein induces differentiation and apoptosis of chondrosarcoma cells.
Cancer Lett
2003
;
199
:
147
–55.
35
Bovée JVMG, Van den Broek LJCM, Cleton-Jansen AM, Hogendoorn PCW. Up-regulation of PTHrP and Bcl-2 expression characterizes the progression of osteochondroma towards peripheral chondrosarcoma and is a late event in central chondrosarcoma.
Lab Invest
2000
;
80
:
1925
–33.
36
Hameetman L, Kok P, Eilers PHC, Cleton-Jansen AM, Hogendoorn PCW, Bovée JVMG. Distinguishing osteochondromas from grade I secondary peripheral chondrosarcomas: influence of patient gender and age on the use of Bcl-2 and PTHrP immunohistochemistry.
Virchows Arch
2005
;
446
:
430
–7.
37
Rozeman LB, Hogendoorn PCW, Bovée JVMG. Diagnosis and prognosis of chondrosarcoma of bone.
Expert Rev Mol Diagn
2002
;
2
:
461
–72.
38
Bovée JVMG, Cleton-Jansen AM, Wuyts W, et al. EXT-mutation analysis and loss of heterozygosity in sporadic and hereditary osteochondromas and secondary chondrosarcomas.
Am J Hum Genet
1999
;
65
:
689
–98.