Purpose: Cytochrome P450 1B1 (CYP1B1), a dioxin inducible member of the CYP supergene family, is overexpressed in various human malignancies including prostate cancer. We hypothesized that promoter/enhancer CpG methylation contributes to the regulation of CYP1B1 expression in human prostate tissue.

Experimental Design: Expression and induction of the CYP1B1 gene in clinical prostate tissues and prostate cancer cell lines were investigated. The methylation status of the CYP1B1 gene was analyzed in 175 prostate cancer and 96 benign prostatic hyperplasia samples using methylation-specific PCR (MSP) and bisulfite-modified DNA sequencing. MSP primers covered dioxin response elements (DRE) and Sp1 sites that are important for the expression of CYP1B1.

Results: Expressions of CYP1B1 mRNA and protein were increased in prostate cancer. The aryl hydrocarbon receptor (AhR)/AhR nuclear translocator (ARNT) heterodimer complex activates gene transcription by binding to the DREs of CYP1B1. In prostate cancer cells, CYP1B1 mRNA was induced by 2,3,7,8-tetrachlorodigenzo-p-dioxin (TCDD) and/or demethylation agent (5-aza-2-deoxycytidine). There was no change in the expressions of AhR and ARNT. Methylation of promoter/enhancer regions was significantly higher in benign prostatic hyperplasia compared with prostate cancer. MSP-positive patients had significantly lower risk for prostate cancer as compared with MSP-negative patients. There was no correlation between CYP1B1 methylation status and clinicopathologic features.

Conclusions: CYP1B1 is overexpressed in prostate cancer and regulated by hypomethylation of its promoter/enhancer region. This is the first report about CYP1B1 regulation in human clinical prostate samples showing that hypomethylation of the CYP1B1 gene may play an important role in prostate cancer.

Prostate cancer is one of the most common cancers in men in the world and it is a commonly diagnosed neoplasm as a result of increased availability of prostate specific antigen testing (1). The prostate is an androgen-dependent organ and contains several enzymes involved in the metabolism of steroid hormones, including androgen and estrogen. In addition, these enzymes metabolize a variety of drugs as well as dietary and environmental factors that may be activated to potent carcinogenic compounds. In this regard, some epidemiologic studies suggest a positive association between exposure to polycyclic aromatic hydrocarbons and increased risk of prostate cancer (2).

Cytochrome P450s are a multigene family of constitutively expressed and inducible enzymes involved in the oxidative metabolic activation and deactivation of carcinogens and cancer therapeutics (3, 4). Cytochrome P450 1B1 (CYP1B1) is a member of the CYP1 gene family and one of the major enzymes involved in the hydroxylation of estrogens and activation of potential carcinogens. The metabolites of CYP1B1 are known to induce prostate cancer in an experimental animal model (5, 6). Given that expression of CYP1B1 is increased in a wide range of human tumors (79), it may be potentially important in prostate tumor development and progression (10). Additionally, CYP1B1 expression may serve as a potential target for anticancer drugs and may be an important tumor biomarker (3).

The upstream regulatory region of the human CYP1B1 gene has several positive regulatory elements within the promoter region. The core promoter region is located between nucleotides (nt) −164 and +25 relative to the transcription initiation site. This region contains a TATA-like box (TTAAAA) from nt −33 to −28, and two Sp1 binding sites (GGGCGG) starting at nt −84 and −68 on the antisense strand (11, 12). The Sp1 site has been shown to bind the transcription factor Sp1 causing high rates of transcription. The enhancer region located from nt −1,022 to −835 contains several dioxin response elements (DRE) which are involved in transcriptional activation by polycyclic aromatic hydrocarbons, such as 2,3,7,8-tetrachlorodigenzo-p-dioxin (TCDD; refs. 1113). Induction of the CYP1B1 gene is regulated by the aryl hydrocarbon receptor (AhR) signaling pathway to which the polycyclic aromatic hydrocarbons bind with high affinity. In the absence of ligand, AhR is present in the cytoplasm and on binding, the AhR/ligand complex translocates to the nucleus where it forms a heterodimeric complex with the AhR nuclear translocator (ARNT). The AhR/ARNT heterodimer binds to DREs, resulting in enhanced expression of CYP1 genes (4, 14). In a recent report, AhR has been also identified as a target gene of the Wnt/β-catenin pathway in prostate cancer cells (15).

Tumors are often characterized by an imbalance in cytosine methylation having both hypermethylation and hypomethylation of various regions of the genome. DNA methylation can inactivate genes and suppress gene expression directly by interfering with the binding of transcription factors or indirectly by attracting methylated DNA binding factors that recruit histone deacetylases and precipitate an inactive chromatin structure (1618). In this regard, CpG island methylation has been shown to be important in the transcriptional silencing of many genes. In contrast, hypomethylation is generally observed in unique sequences, including transcription control sequences that are often subject to cancer-associated hypomethylation (17, 19). Hypomethylation has been implicated in the activation of oncogenes, such as c-myc (20), and may also contribute to chromosomal instability (21). The high frequency of cancer-linked DNA hypomethylation is consistent with its proposed role in cancer formation or tumor progression. The relationship between DNA hypomethylation and tumorigenesis is important in light of the interest in cancer therapies to decrease DNA methylation.

Currently, the mechanisms controlling transcription of the CYP1B1 gene are not fully understood. In this study, we investigated the expression of the CYP1B1 gene and the epigenetic mechanisms (DNA hypomethylation) involved in overexpression of CYP1B1 in prostate cancer.

Clinical samples. A total of 175 newly diagnosed prostate cancer tissues from radical prostatectomy and 96 pathologically proven benign prostatic hyperplasia (BPH) samples from transurethral resection were obtained from Shimane University Hospital (Izumo, Japan). The clinicopathologic characteristics are summarized in Table 1. All tumors were graded according to the general rule for Clinical and Pathologic Studies on prostate cancer by the Japanese Urological Association and the Japanese Society of Pathology (22). Our routine strategy to diagnose prostate cancer included serum prostate-specific antigen level, transrectal ultrasonography, color Doppler ultrasonography, and magnetic resonance imaging, which enabled us to accurately localize the prostate cancer before radical prostatectomy (23).

Table 1.

Clinical characteristics of prostate cancer and BPH

Prostate cancer  
    Total number of patients 175 
    Mean age ± SD (y) 68.6 ± 7.3 
    pT stage  
        pT1 
        pT2 117 
        pT3 55 
        pT4 
    Gleason score  
        ≤6 96 
        7 44 
        ≥8 35 
Preoperative serum PSA  
        <4 20 
        4-10 81 
        >10 74 
Benign prostatic hyperplasia  
    Total number of patients 96 
    Mean age ± SD (y) 73.6 ± 5.6 
Prostate cancer  
    Total number of patients 175 
    Mean age ± SD (y) 68.6 ± 7.3 
    pT stage  
        pT1 
        pT2 117 
        pT3 55 
        pT4 
    Gleason score  
        ≤6 96 
        7 44 
        ≥8 35 
Preoperative serum PSA  
        <4 20 
        4-10 81 
        >10 74 
Benign prostatic hyperplasia  
    Total number of patients 96 
    Mean age ± SD (y) 73.6 ± 5.6 

Tissue preparations. After radical prostatectomy, the normal and cancer regions of each prostate were identified. Half of each prostate sample (normal and cancer) was fixed in 10% buffered formalin (pH 7.0) and embedded in paraffin wax for histopathologic evaluation. The remaining half of each prostate sample was immediately frozen and stored at −80 °C for RNA extraction. The BPH tissues obtained from other patients were samples that had been fixed in formalin and embedded in paraffin. All samples were microscopically dissected and DNA was isolated for methylation analysis. In BPH samples, high-grade prostatic intraepithelial neoplasia and cancer were ruled out by microscopic analysis.

Cell culture. The human prostate cancer cell lines DU145, DUPro, LNCaP, and PC-3 were obtained from the American Type Culture Collection (Manassas, VA) and the ND-1 cell line was developed in our laboratory (24). All prostate cancer cell lines were maintained in RPMI 1640 with l-glutamine and sodium pyruvate. The ND-1 cell line was grown in McCoy's 5A media with l-glutamine. FCS (10%) was present in the media and cells were maintained in a humidified atmosphere of 5% CO2/95% air at 37°C.

Isolation of DNA and RNA from clinical prostate samples. Genomic DNA was extracted from prostate cancer and control prostate samples obtained by microdissection using a Qiagen kit (Qiagen, Valencia, CA; ref. 25). Total RNA was extracted with TRI reagent (Molecular Research Center, Cincinnati, OH) and the RNA pellet obtained after isopropanol and ethanol precipitation was dried and resuspended in 50 μL of RNase-free water. All RNA samples were treated with DNase (Wako Pure Chemical, Osaka, Japan) and stored in aliquots at −80 °C until reverse transcribed. The concentrations of DNA and RNA were determined with a spectrophotometer and their integrity was assessed by gel electrophoresis.

Expression of the CYP1B1 gene in prostate cancer cell lines and clinical prostate samples by reverse transcription-PCR. Total RNA from cancer cell lines was isolated using an extraction kit (RNeasy Mini kit; Qiagen). Reverse transcription-PCR (RT-PCR) was preformed using a TITANIUM One-Step RT-PCR Kit according to the protocol of the manufacturer (BD Biosciences Clontech, Palo Alto, CA). In prostate cancer cell lines, primer pairs L-1B1_RT, AhR_RT, and ARNT_RT were used to amplify human CYP1B1, AhR, and ARNT, respectively. Primer sequences, RT-PCR conditions (annealing temperatures and cycle numbers), and product sizes are described in Table 2. The glyceraldehyde-3-phosphate dehydrogenase (G3PDH) gene was used as an internal control and its primer pair was L-G3PDH (Table 2).

Table 2.

Primer sequences for RT-PCR and MSP

Primer setsSense primerAntisense primerAnneal temperature, °C (no. cycles)Product size (bp)
RT-PCR for clinical prostate samples     
S-1B1_RT AACGTACCGGCACTATCAC ACGACCTGATCCAATTCTGC 55 (40) 137 
S-G3PDH CAATGACCCCTTCATTGACC TGGAAGATGATGGGATTT 55 (40) 135 
     
RT-PCR for prostate cancer cell lines     
L-1B1_RT TACCGGCACTATCACTGACATCTTCG GGTGAGCCAGGATGGAGATGAAGAGAA 65 (35) 510 
AhR_RT CCACAGCAACAGCTGTGTCAGAAGATG CGGATGATGAAGTGGCTGAAGATGTGT 65 (35) 600 
ARNT_RT GCTGGGAGATCAGAGCAACAGCTACAA TGTTTCTTTCCAGAGGGACTGCTCACA 65 (35) 588 
L-G3PDH TCCCATCACCATCTTCCA CATCACGCCACAGTTTCC 60 (35) 376 
     
MSP     
Pan1 GGTTTTTTTATAAAGGGAGGGTTT ACTCCAATCATATCCCTAAAC 50 (45) 308 
MS1 GTAGGCGCGATTGTGCGTGC TCTCACGACACCTAACACGCG 64 (3), 62 (3), 60 (3), 58 (31) 118 
US1 TTTGGTAGGTGTGATTGTGTGTGT CTTCTCACAACACCTAACACACAA 60 (40) 125 
Pan2 GTTTAGGGATATGATTGGAGT ACTAAAAAAACCTAAAAAAACTAAC 50 (45) 189 
MS2 CGTACGTAAAGTTTAGTTTCGTAC GAAACGAAACCCGAACGAACGAAACG 56 (3), 54 (3), 53 (3), 52 (31) 126 
US2 GGTGTATGTAAAGTTTAGTTTTGTATACTAACAAAACAAAACAAAACCCAAACAAAACA 58 (40) 134 
MS3 TCGATTTTTTAGAAGCGGCGTACGAAACGAAACCCGAACGAAACG 62 (3), 60 (3), 58 (3), 56 (31) 144 
US3 AGTTGATTTTTTAGAAGTGGTGTATACTAACAAAACAAAACCCAAACAAAACA 58 (40) 152 
Pan5 GATTGGAGGTGGTTGTGATGAAG CCACTCCCACTCCAAAATCAAAAC 50 (45) 256 
MS5 AGTTTCGAGGTCGGTCGGTGC AACAACGCGACCTAACAAAACG 59 (38) 106 
US5 GTAGAGTTTTGAGGTTGGTTGGTGT AAAACAACACAACCTAACAAAACA61 (32) 112 
Primer setsSense primerAntisense primerAnneal temperature, °C (no. cycles)Product size (bp)
RT-PCR for clinical prostate samples     
S-1B1_RT AACGTACCGGCACTATCAC ACGACCTGATCCAATTCTGC 55 (40) 137 
S-G3PDH CAATGACCCCTTCATTGACC TGGAAGATGATGGGATTT 55 (40) 135 
     
RT-PCR for prostate cancer cell lines     
L-1B1_RT TACCGGCACTATCACTGACATCTTCG GGTGAGCCAGGATGGAGATGAAGAGAA 65 (35) 510 
AhR_RT CCACAGCAACAGCTGTGTCAGAAGATG CGGATGATGAAGTGGCTGAAGATGTGT 65 (35) 600 
ARNT_RT GCTGGGAGATCAGAGCAACAGCTACAA TGTTTCTTTCCAGAGGGACTGCTCACA 65 (35) 588 
L-G3PDH TCCCATCACCATCTTCCA CATCACGCCACAGTTTCC 60 (35) 376 
     
MSP     
Pan1 GGTTTTTTTATAAAGGGAGGGTTT ACTCCAATCATATCCCTAAAC 50 (45) 308 
MS1 GTAGGCGCGATTGTGCGTGC TCTCACGACACCTAACACGCG 64 (3), 62 (3), 60 (3), 58 (31) 118 
US1 TTTGGTAGGTGTGATTGTGTGTGT CTTCTCACAACACCTAACACACAA 60 (40) 125 
Pan2 GTTTAGGGATATGATTGGAGT ACTAAAAAAACCTAAAAAAACTAAC 50 (45) 189 
MS2 CGTACGTAAAGTTTAGTTTCGTAC GAAACGAAACCCGAACGAACGAAACG 56 (3), 54 (3), 53 (3), 52 (31) 126 
US2 GGTGTATGTAAAGTTTAGTTTTGTATACTAACAAAACAAAACAAAACCCAAACAAAACA 58 (40) 134 
MS3 TCGATTTTTTAGAAGCGGCGTACGAAACGAAACCCGAACGAAACG 62 (3), 60 (3), 58 (3), 56 (31) 144 
US3 AGTTGATTTTTTAGAAGTGGTGTATACTAACAAAACAAAACCCAAACAAAACA 58 (40) 152 
Pan5 GATTGGAGGTGGTTGTGATGAAG CCACTCCCACTCCAAAATCAAAAC 50 (45) 256 
MS5 AGTTTCGAGGTCGGTCGGTGC AACAACGCGACCTAACAAAACG 59 (38) 106 
US5 GTAGAGTTTTGAGGTTGGTTGGTGT AAAACAACACAACCTAACAAAACA61 (32) 112 

NOTE: Underline indicates the CpG sites within the primer sequence.

The cDNA from clinical prostate samples was prepared by reverse transcription (Promega Corp., Madison, WI) using DNase-treated RNA as a template. For RT-PCR of CYP1B1 and G3PDH, the primer pairs S-1B1_RT and S-G3PDH were used in the analysis of clinical prostate samples (Table 2).

RT-PCR products were electrophoresed in 2.0% agarose gels with ethidium bromide. The expression level of these genes was evaluated by Image J software (http://rsb.info.nih.gov/ij/) and the area under the curve was calculated. Levels of the CYP1B1 gene were quantified relative to that of G3PDH and expressed as arbitrary units.

5-Aza-2-deoxycytidine and 2,3,7,8-tetrachlorodigenzo-p-dioxin treatment. To investigate whether CYP1B1 was induced by TCDD and if CpG methylation was involved in the inactivation of the CYP1B1 gene, we analyzed the effect of 5-aza-2-deoxycytidine (5-Aza-dC) on basal and TCDD-inducible target gene mRNA expressions in DU145, DUPro, LNCaP, PC-3, and ND-1 prostate cancer cell lines. All cell lines were treated with 5-Aza-dC (total 1 μmol/L) for 7 days and with TCDD (10 nmol/L) for 1 day, and then were harvested on day 7. Total RNA was isolated and analyzed by One Step RT-PCR using primers specific for human CYP1B1, AhR, and ARNT.

Methylation-specific PCR. Modified DNA was used as a template for methylation-specific PCR (MSP). Sodium bisulfite modification was done using a DNA Modification Kit (Intergen, Oxford, United Kingdom) according to the protocol of the manufacturer. Based on the functional promoter/enhancer sequence of the CYP1B1 gene (1113), several sets of primers were designed using MethPrimer (http://itsa.ucsf.edu/~urolab/methprimer; ref. 26) to detect the methylation status of CpG sites in the CYP1B1 gene. Primer pairs used for amplification of CYP1B1, primer sequences, PCR conditions (annealing temperatures and cycle numbers), and product sizes are described in Table 2.

The enhancer region amplified by the Pan1 sense (S) and Pan2 antisense (AS) primers contained 57 CpG sites including five DREs and two Sp1 sites. The promoter region amplified by Pan5S and Pan5AS primers contained 24 CpG sites including two Sp1 sites, a TATA-like box, and the transcription initiation site. MSP (27) was carried out as a second round of nested PCR (MSP1, MSP2, MSP3, and MSP5) using the universal PCR product amplified by either Pan1S and Pan1AS primers, Pan2S and Pan2AS primers, or Pan5S and Pan5AS as template. The first universal primer pairs used (Pan1S and Pan1AS, Pan2S and Pan2AS, or Pan5S and Pan5AS) have no CpG sites in either forward or reverse primer whereas the MSP1 or unmethylation-specific PCR (USP) 1 primer covers the DRE1 site. Similarly, the MSP2 or USP2 primer covers both the DRE3 and SP-1 sites and the MSP3 or USP3 primer covers the DRE2 site. These three DREs in the enhancer region are particularly important for the expression of CYP1B1 (12, 13). The MSP5 or USP5 primer covers the Sp1 site as the core promoter region. In each assay, absence of DNA template served as negative control. The PCR products were separated by 2% agarose gel electrophoresis and stained with ethidium bromide. The density of each band was calculated by Image J software (http://rsb.info.nih.gov/ij) and the relative methylation level in each sample was determined using the following formula: MSP ratio (%) = MSP × 100 / (MSP + USP). The data were confirmed by visual examination and scanning. A MSP ratio of 5.0% was used as a cutoff value to assess whether samples were MSP positive or negative (28).

Bisulfite DNA sequencing. Bisulfite-modified DNA (1 μL) was amplified using Pan2 primer pairs and Pan5 primer pairs in a total volume of 20 μL. Direct bisulfite DNA sequencing of the PCR products was done according to the instructions of the manufacturer (Applied Biosystems, Foster City, CA). The Pan2AS primer (Table 2) was used to examine the enhancer region and the Pan5S primer (Table 2) used to examine the core promoter region of CYP1B1.

Immunohistochemistry of prostate cancer and benign prostatic hyperplasia samples. Immunostaining of CYP1B1 protein was done in formalin-fixed, paraffin-embedded materials using a rabbit polyclonal antibody (1:300 dilution) against human CYP1B1 (WB1B1, Gentest Corporation, Woburn, MA). The staining procedure was according to a commercial kit (Santa Cruz Biotechnology, Santa Cruz, CA) and immunoperoxidase activity was developed with 3,3-diaminobenzidine (Sigma Chemical Co., St. Louis, MO). The sections were counterstained with Harris' hematoxylin. Immunostaining was considered visually positive when CYP1B1 expression was the same or greater than the adjacent smooth muscle tissue as the visual criteria (29, 30). Alternatively, Image J–based analysis was done to quantify the intensity of immunostaining as the quantitative criteria. The average density was measured in randomly selected areas on each slide containing a minimum of 1,000 cells and expressed as arbitrary units.

Statistical analysis. Statistical analysis was done using the Mann-Whitney U test for expression of CYP1B1 mRNA and protein. The correlation between clinicopathologic findings and the methylation status of CYP1B1 was assessed using the χ2 test and logistic regression analysis. P < 0.05 was regarded as statistically significant.

CYP1B1 protein expression in prostate cancer and benign prostatic hyperplasia.Figure 1A shows typical immunostaining of CYP1B1 in BPH and prostate cancer samples. Representative sections of the epithelium show that CYP1B1 protein expression was localized to the cytoplasm of prostate cancer cells. CYP1B1 expression was also observed in smooth muscle cells of both BPH and prostate cancer samples. As visual criteria, we considered immunostaining to be positive when expression of CYP1B1 was the same or greater than the surrounding smooth muscle. Using visual criteria, positive CYP1B1 immunostaining was observed in 78.8% (26 of 33) of the prostate cancer samples. We also analyzed the intensity of immunostaining using Image J software as quantitative criteria. Using quantitative criteria, the intensity of CYP1B1 immunostaining was significantly higher in prostate cancer samples than in BPH samples [BPH versus prostate cancer: 44.4 ± 17.5 versus 78.6 ± 23.9 (P < 0.001)].

Fig. 1.

A, typical immunohistochemical staining of human CYP1B1 in prostate cancer and BPH samples. CYP1B1 was expressed in the glandular epithelium and immnoreactivity localized to the cytoplasm of prostate cancer. The average intensity of CYP1B1 immunostaining is significantly increased in prostate cancer samples compared with BPH samples (P < 0.001). B, RT-PCR of CYP1B1 mRNA in clinical prostate samples. Expression of CYP1B1 mRNA transcripts was increased in prostate cancer samples and was significantly higher as compared with control samples (P < 0.001).

Fig. 1.

A, typical immunohistochemical staining of human CYP1B1 in prostate cancer and BPH samples. CYP1B1 was expressed in the glandular epithelium and immnoreactivity localized to the cytoplasm of prostate cancer. The average intensity of CYP1B1 immunostaining is significantly increased in prostate cancer samples compared with BPH samples (P < 0.001). B, RT-PCR of CYP1B1 mRNA in clinical prostate samples. Expression of CYP1B1 mRNA transcripts was increased in prostate cancer samples and was significantly higher as compared with control samples (P < 0.001).

Close modal

Reverse transcription-PCR of CYP1B1 mRNA expression in clinical prostate samples. The expression of CYP1B1 mRNA was investigated by RT-PCR in 152 cancer regions and 164 normal regions as the control for prostate tissues (Fig. 1B). The mRNA transcript expression levels were higher in prostate cancer samples than in control prostate samples. There was a significant increase in the expression of CYP1B1 mRNA in prostate cancer [control versus cancer: 1.1 ± 0.28 versus 1.5 ± 0.52 (P < 0.001)]. There was no significant correlation between CYP1B1 mRNA levels and Gleason grade or pathologic stage in prostate cancer (data not shown).

Reverse transcription-PCR of CYP1B1, AhR, and ARNT mRNA expression in prostate cancer cell lines. Prostate cancer cell lines were treated with 5-Aza-dC (1 μmol/L) and/or TCDD (10 nmol/L) and then analyzed for expression of human CYP1B1, AhR, and ARNT mRNA by RT-PCR. DUPro and LNCaP cells did not have detectable basal or TCDD-inducible CYP1B1 mRNA in control or 5-Aza-dC treated cells. DU145 and ND-1 cells expressed CYP1B1 mRNA constitutively, but there was no induction by TCDD. Treatment of these cell lines with 5-Aza-dC had little effect on basal CYP1B1 expression (data not shown). In contrast, as shown in Fig. 2, levels of CYP1B1 mRNA in PC-3 cells were induced by TCDD. In addition, treatment of PC-3 cells with 5-Aza-dC resulted in a moderate increase in basal and TCDD-inducible CYP1B1 mRNA expressions. On the other hand, TCDD and 5-Aza-dC had little effect on the constitutive levels of AhR and ARNT mRNAs in all cell lines (data not shown) including PC-3 cells (Fig. 2). Taken together, these results suggest that in PC-3 cells, decreased promoter methylation is important for the increased expression of the CYP1B1 gene rather than increased expression of AhR and/or ARNT.

Fig. 2.

Treatment of PC-3 cancer cells with 5-Aza-dC (1 μmol/L) and/or TCDD (10 nmol/L). Expression levels of mRNA were analyzed by RT-PCR with primer pairs specific for human CYP1B1, AhR, ARNT, and G3PDH. Basal expression of CYP1B1 mRNA in PC-3 cells was observed, which was induced by TCDD. Treatment of PC-3 cells with 5-Aza-dC resulted in a moderate increase in basal and TCDD-inducible CYP1B1 expression. In contrast, expressions of AhR and ARNT mRNAs were not affected by TCDD and 5-Aza-dC in PC-3 cells.

Fig. 2.

Treatment of PC-3 cancer cells with 5-Aza-dC (1 μmol/L) and/or TCDD (10 nmol/L). Expression levels of mRNA were analyzed by RT-PCR with primer pairs specific for human CYP1B1, AhR, ARNT, and G3PDH. Basal expression of CYP1B1 mRNA in PC-3 cells was observed, which was induced by TCDD. Treatment of PC-3 cells with 5-Aza-dC resulted in a moderate increase in basal and TCDD-inducible CYP1B1 expression. In contrast, expressions of AhR and ARNT mRNAs were not affected by TCDD and 5-Aza-dC in PC-3 cells.

Close modal

Methylation status of the CYP1B1 enhancer in prostate tissues. The methylation status of the CYP1B1 gene was analyzed in 175 prostate cancer samples and 96 BPH samples. We designed primers to discriminate between methylated and unmethylated alleles following bisulfite treatment (Table 2; Fig. 3A). Typical examples of the MSP and USP bands are shown in Fig. 3B. In the 175 prostate cancer samples, a positive MSP1 band was detected in 11 samples (6.3%), MSP2 in 10 samples (5.7%), MSP3 in 25 samples (14.2%), and MSP5 in 30 samples (17.1%). On the other hand, in 96 BPH samples, a positive MSP1 band was detected in 35 samples (36.5%), MSP2 in 66 samples (68.8%), MSP3 in 76 samples (79.2%), and MSP5 in 59 samples (61.5%). The prevalence of methylation in three enhancer regions and the promoter region was significantly higher in BPH samples than in prostate cancer samples (Figs. 3B and 4). To confirm the methylation status of the enhancer and promoter regions of CYP1B1, bisulfite-modified DNA was amplified and sequenced. Typical bisulfite-modified DNA sequencing around the promoter and enhancer regions in prostate cancer and BPH samples is shown in Fig. 3C. In prostate cancer samples, CpG sites were not methylated whereas in BPH samples, most CpG sites were methylated in the promoter region including Sp1 sites and all CpG sites were methylated in the enhancer region including DRE2 and DRE3 (Fig. 3C). In addition, the DRE1 region in BPH samples was methylated whereas it was not methylated in prostate cancer samples (data not shown). As shown in Table 3, logistic regression analysis revealed that MSP-positive patients had a significantly lower risk for prostate cancer as compared with MSP-negative patients [MSP1: odds ratio, 7.3; MSP2: odds ratio, 40.5; MSP3: odds ratio, 25.8; MSP5: odds ratio, 8.7, respectively (Table 3)]. However, no significant correlation of CYP1B1 methylation with Gleason grade and pathologic category was found in this study (Fig. 4).

Fig. 3.

A, schematic representation of the promoter/enhancer region of the human CYP1B1 gene and location of primers. The regions Universal PCR1 and Universal PCR2 cover the functional enhancer of CYP1B1 and were amplified using two different sets of universal primers (Pan1S and Pan1AS; Pan2S and Pan2AS). The universal primers contained no CpG sites within their sequence. Using the universal PCR1 and PCR2 products as templates, a second round of nested PCR (MSP1, MSP2, and MSP3 and corresponding USP1, USP2, and USP3, respectively) was done. The reverse primer of MS1_AS and US1_AS covers the DRE1 (−945) site. The forward primer of MS2_S and US2_S covers DRE3 (−836). The forward primer of MS3_S and US3_S covers DRE2 (−855) and the reverse primer of MS2_AS and US2_AS covers the consensus motif of the SP1 binding site (GGGCGG). On the other hand, Universal PCR5 covers the core promoter region of CYP1B1 and was amplified using different sets of universal primers (Pan5S and Pan5AS). These universal primers also contained no CpG sites within their sequence. Using the universal PCR5 product as templates, a second round of nested PCR (MSP5 and USP5) was done. The reverse primer of MS5_AS and US5_AS covers the SP1 binding site. Primer sequences and expected PCR product sizes are shown Table 2. B, typical PCRs (MSP and USP) in BPH and prostate cancer samples are shown. MSP bands are detected in 11 (MSP1), 12 (MSP2), 15 (MSP3), and 8 (MSP5) of the BPH samples, and in only 1 (MSP1), 2 (MSP2), 2 (MSP3), and 3 (MSP5) of the prostate cancer samples. C, typical bisulfite-modified DNA sequencing at the enhancer and promoter regions in prostate cancer and BPH samples. Bars under the sequence highlight the CpG sites. In prostate cancer samples, CpG sites of the core promoter region including SP1 binding sites and the enhancer region including DRE2 and DRE3 were not completely methylated whereas in BPH samples, most CpG sites were methylated.

Fig. 3.

A, schematic representation of the promoter/enhancer region of the human CYP1B1 gene and location of primers. The regions Universal PCR1 and Universal PCR2 cover the functional enhancer of CYP1B1 and were amplified using two different sets of universal primers (Pan1S and Pan1AS; Pan2S and Pan2AS). The universal primers contained no CpG sites within their sequence. Using the universal PCR1 and PCR2 products as templates, a second round of nested PCR (MSP1, MSP2, and MSP3 and corresponding USP1, USP2, and USP3, respectively) was done. The reverse primer of MS1_AS and US1_AS covers the DRE1 (−945) site. The forward primer of MS2_S and US2_S covers DRE3 (−836). The forward primer of MS3_S and US3_S covers DRE2 (−855) and the reverse primer of MS2_AS and US2_AS covers the consensus motif of the SP1 binding site (GGGCGG). On the other hand, Universal PCR5 covers the core promoter region of CYP1B1 and was amplified using different sets of universal primers (Pan5S and Pan5AS). These universal primers also contained no CpG sites within their sequence. Using the universal PCR5 product as templates, a second round of nested PCR (MSP5 and USP5) was done. The reverse primer of MS5_AS and US5_AS covers the SP1 binding site. Primer sequences and expected PCR product sizes are shown Table 2. B, typical PCRs (MSP and USP) in BPH and prostate cancer samples are shown. MSP bands are detected in 11 (MSP1), 12 (MSP2), 15 (MSP3), and 8 (MSP5) of the BPH samples, and in only 1 (MSP1), 2 (MSP2), 2 (MSP3), and 3 (MSP5) of the prostate cancer samples. C, typical bisulfite-modified DNA sequencing at the enhancer and promoter regions in prostate cancer and BPH samples. Bars under the sequence highlight the CpG sites. In prostate cancer samples, CpG sites of the core promoter region including SP1 binding sites and the enhancer region including DRE2 and DRE3 were not completely methylated whereas in BPH samples, most CpG sites were methylated.

Close modal
Fig. 4.

Methylation frequency of the CYP1B1 promoter/enhancer region. Methylation frequency (MSP1, MSP2, MSP3, and MSP5) was significantly higher in BPH samples as compared with prostate cancer samples (P < 0.001). In prostate cancer samples, there was no significant difference in methylation associated with Gleason grade and pathologic stage in all enhancer/promoter regions.

Fig. 4.

Methylation frequency of the CYP1B1 promoter/enhancer region. Methylation frequency (MSP1, MSP2, MSP3, and MSP5) was significantly higher in BPH samples as compared with prostate cancer samples (P < 0.001). In prostate cancer samples, there was no significant difference in methylation associated with Gleason grade and pathologic stage in all enhancer/promoter regions.

Close modal
Table 3.

Logistic regression analysis of CYP1B1 methylation in BPH and prostate cancer

Odds ratio*95% confidence intervalP value
MSP1 (−) 7.26 3.01-15.92 <0.001 
MSP2 (−) 40.45 16.96-96.46 <0.001 
MSP3 (−) 25.79 12.45-53.44 <0.001 
MSP5 (−) 8.70 4.63-16.39 <0.001 
Odds ratio*95% confidence intervalP value
MSP1 (−) 7.26 3.01-15.92 <0.001 
MSP2 (−) 40.45 16.96-96.46 <0.001 
MSP3 (−) 25.79 12.45-53.44 <0.001 
MSP5 (−) 8.70 4.63-16.39 <0.001 

NOTE: Logistic regression analysis showed that MSP-positive patients had a significantly lower risk for prostate cancer as compared with MSP-negative patients.

*

Age adjusted.

BPH versus prostate cancer.

This study shows that the expressions of CYP1B1 protein and mRNA were significantly higher in prostate cancer compared with benign prostate. CYP1B1 is overexpressed in a variety of human tumor cells such as the lung, breast, liver, gastrointestinal tract, and ovarian cancer (79). Using immunohistochemical analysis, Carnell et al. (10) reported that CYP1B1 protein is frequently overexpressed in the cytoplasm of prostate cancer cells compared with premalignant and hyperplastic tissues. The CYP1B1 is expressed during premalignancy and is up-regulated at an early stage of carcinogenesis in prostate cancer. Thus, CYP1B1 seems to have a potentially crucial role in tumor development and progression. However, the mechanisms controlling the tissue-specific and cancer-specific expression of CYP1B1 are not known (4). In the present study, we found that CYP1B1 protein was overexpressed in the cytoplasm of prostate cancer cells with a high frequency whereas it was largely absent in BPH samples. This data was confirmed by RT-PCR in radical prostatectomy samples that clearly showed that CYP1B1 mRNA expression was significantly higher in prostate cancer than in nonmalignant prostate tissue. Our results are consistent with previous studies (79) showing that CYP1B1 protein is specifically localized to tumor cells.

It is well documented that the CYP1B1 gene is induced by the AhR signaling pathway to which the polycyclic aromatic hydrocarbons bind with high affinity. After ligand binding, the AhR complex is heterodimerized with ARNT and translocated to the nucleus. The AhR/ARNT heterodimer complex activates gene transcription by binding to core recognition motifs contained within the DREs of CYP1B1 (14, 31). In the present study, CYP1B1 mRNA was induced by TCDD and expression of CYP1B1 mRNA was increased in PC-3 cells after treatment with 5-Aza-dC, a DNA methyltransferase inhibitor. In contrast, levels of AhR and ARNT mRNAs were not induced by either TCDD or 5-Aza-dC compared with basal levels. Thus, increased levels of CYP1B1 in these studies were not related to increased expressions of AhR and ARNT. These results suggested that CpG methylation of the CYP1B1 gene promoter might be important in regulating its expression. On the basis of these findings, we hypothesized that CYP1B1 in human prostate cancer tissue might be regulated by aberrant CpG methylation of the CYP1B1 promoter/enhancer.

The upstream regulatory region of the human CYP1B1 gene has both basal regulatory sequences and DREs. The core promoter region contains a TATA-like box and two Sp1 binding sites. Full CYP1B1 promoter activity requires both Sp1 motifs located within the core promoter region (12). In addition, important enhancer elements of the human CYP1B1 promoter are located between nt −1,022 and −835 (11, 12), a region that contains several DRE sites [DRE1 (nt −945), DRE2 (nt −855), and DRE3 (nt −836)] that are necessary for TCDD-mediated induction of CYP1B1. Other investigators have reported that DRE2 and DRE3 are particularly important in the TCDD-mediated response (13). Because the CpG dinucleotide exists within the Sp1 binding sites and the core motif of DREs, we investigated the methylation status of the upstream regulatory region in clinical prostate samples. As shown in Fig. 3, the frequency of promoter/enhancer methylation at these four sites was significantly higher in BPH samples compared with prostate cancer samples. Thus, the CYP1B1 promoter/enhancer regions were relatively hypomethylated in prostate cancer tissue compared with BPH tissue. Taken together, these results indicate that increased CYP1B1 expression in human prostate cancer is related to CpG hypomethylation of its promoter/enhancer region.

Several mechanisms have been proposed to account for transcriptional repression by DNA methylation. DNA methylation affects histone modifications and chromatin structure, which, in turn, can alter gene expression. DNA methylation can directly interfere with the binding of specific transcription factors to their recognition sites in their respective promoters such as activator protein 2, c-Myc, and nuclear factor κB (17, 32). In addition, Takahashi et al. (33) have shown that the AhR/ARNT complex was not able to bind to methylated DREs. Our results show that several binding sites containing CpG dinucleotides are methylated in BPH samples. Methylation of these specific sites may be one of the mechanisms that prevent transcription factor binding in nonmalignant prostate tissue. Additionally, Guo et al. (18) have shown that both increased DNA methyltransferase activity and reduced demethylase activity contribute to the methylation and silencing of gene expression during breast cancer tumor progression. Although further experiments are required to determine the exact role of these types of epigenetic changes, our data suggest that demethylation of the CYP1B1 enhancer/promoter region is an epigenetic event that occurs during the tumor initiation process in prostate cancer.

Metabolic activation of carcinogens by hydroxylation is an important function of CYP1B1 and has been postulated to be a key factor in prostate carcinogenesis (5, 6) because activated carcinogens induce DNA single-strand breaks (34) and mutation (35). For instance, activation of estrogens is capable of inducing ovarian adenocarcinoma in mice (36). Some epidemiologic studies suggest a positive association between exposure to polycyclic aromatic hydrocarbons and increased risk of prostate cancer (2, 37, 38). These findings support a direct role for activated metabolites in prostate carcinogenesis and indicate that CYP1B1 is a key player in the process. In the present study, mRNA expression and the methylation status of CYP1B1 were not associated with prostate cancer clinicopathologic findings. However, expressions of CYP1B1 mRNA and protein, as well as the methylation status of its promoter/enhancer regions, were significantly different when comparing nonmalignant prostate and prostate cancer tissues. Logistic regression analysis showed that MSP-positive patients had a significantly lower risk for prostate cancer as compared with MSP-negative patients. Although expression levels of CYP1B1 mRNA are low, it is detected in normal regions. Therefore, normal tissue may contain CYP1B1, which is capable of metabolically activating compounds suspected of being prostate carcinogens (10). Thus, hypomethylation of the CYP1B1 gene may play an important role in the initiation of prostate tumors rather than in their progression. Because expression of CYP1B1 is regulated by the methylation of its promoter/enhancer, this region may be useful as a target for anticancer drugs and in preventive medicine.

In conclusion, this is the first study to demonstrate that increased CYP1B1 expression in clinical prostate cancer tissues is caused by promoter/enhancer hypomethylation of the CYP1B1 gene.

Grant support: NIH grants RO1CA101844, RO1AG21418, and T32DK07790 and Veteran Affairs Merit Review and Research Enhancement Research Program awards.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1
Quinn M, Babb P. Patterns and trends in prostate cancer incidence, survival, prevalence and mortality. Part I. International comparisons.
BJU Int
2002
;
90
:
162
–73.
2
Krstev S, Baris D, Stewart P, et al. Occupational risk factors and prostate cancer in U.S. blacks and whites.
Am J Ind Med
1998
;
34
:
421
–30.
3
McFadyen MC, McLeod HL, Jackson FC, Melvin WT, Doehmer J, Murray GI. Cytochrome P450 CYP1B1 protein expression: a novel mechanism of anticancer drug resistance.
Biochem Pharmacol
2001
;
62
:
207
–12.
4
Murray GI, Melvin WT, Greenlee WF, Burke MD. Regulation, function, and tissue-specific expression of cytochrome P450 CYP1B1.
Annu Rev Pharmacol Toxicol
2001
;
41
:
297
–316.
5
Cavalieri EL, Devanesan P, Bosland MC, Badawi AF, Rogan EG. Catechol estrogen metabolites and conjugates in different regions of the prostate of Noble rats treated with 4-hydroxyestradiol: implications for estrogen-induced initiation of prostate cancer.
Carcinogenesis
2002
;
23
:
329
–33.
6
Williams JA, Martin FL, Muir GH, Hewer A, Grover PL, Phillips DH. Metabolic activation of carcinogens and expression of various cytochromes P450 in human prostate tissue.
Carcinogenesis
2000
;
21
:
1683
–9.
7
Murray GI, Taylor MC, McFadyen MC, et al. Tumor-specific expression of cytochrome P450 CYP1B1.
Cancer Res
1997
;
57
:
3026
–31.
8
McFadyen MC, Breeman S, Payne S, et al. Immunohistochemical localization of cytochrome P450 CYP1B1 in breast cancer with monoclonal antibodies specific for CYP1B1.
J Histochem Cytochem
1999
;
47
:
1457
–64.
9
McFadyen MC, Cruickshank ME, Miller ID, et al. Cytochrome P450 CYP1B1 overexpression in primary and metastatic ovarian cancer.
Br J Cancer
2001
;
85
:
242
–6.
10
Carnell DM, Smith RE, Daley FM, et al. Target validation of cytochrome P450 CYP1B1 in prostate carcinoma with protein expression in associated hyperplastic and premalignant tissue.
Int J Radiat Oncol Biol Phys
2004
;
58
:
500
–9.
11
Tang YM, Wo YY, Stewart J, et al. Isolation and characterization of the human cytochrome P450 CYP1B1 gene.
J Biol Chem
1996
;
271
:
28324
–30.
12
Wo YY, Stewart J, Greenlee WF. Functional analysis of the promoter for the human CYP1B1 gene.
J Biol Chem
1997
;
272
:
26702
–7.
13
Shehin SE, Stephenson RO, Greenlee WF. Transcriptional regulation of the human CYP1B1 gene. Evidence for involvement of an aryl hydrocarbon receptor response element in constitutive expression.
J Biol Chem
2000
;
275
:
6770
–6.
14
Mimura J, Fujii-Kuriyama Y. Functional role of AhR in the expression of toxic effects by TCDD.
Biochim Biophys Acta
2003
;
1619
:
263
–8.
15
Chesire DR, Dunn TA, Ewing CM, Luo J, Isaacs WB. Identification of aryl hydrocarbon receptor as a putative Wnt/β-catenin pathway target gene in prostate cancer cells.
Cancer Res
2004
;
64
:
2523
–33.
16
Rountree MR, Bachman KE, Baylin SB. DNMT1 binds HDAC2 and a new co-repressor, DMAP1, to form a complex at replication foci.
Nat Genet
2000
;
25
:
269
–77.
17
Singal R, Ginder GD. DNA methylation.
Blood
1999
;
93
:
4059
–70.
18
Guo Y, Pakneshan P, Gladu J, Slack A, Szyf M, Rabbani SA. Regulation of DNA methylation in human breast cancer. Effect on the urokinase-type plasminogen activator gene production and tumor invasion.
J Biol Chem
2002
;
277
:
41571
–9.
19
Ehrlich M. DNA methylation in cancer: too much, but also too little.
Oncogene
2002
;
21
:
5400
–13.
20
Sharrard RM, Royds JA, Rogers S, Shorthouse AJ. Patterns of methylation of the c-myc gene in human colorectal cancer progression.
Br J Cancer
1992
;
65
:
667
–72.
21
Schulz WA, Elo JP, Florl AR, et al. Genomewide DNA hypomethylation is associated with alterations on chromosome 8 in prostate carcinoma.
Genes Chromosomes Cancer
2002
;
35
:
58
–65.
22
The Japanese Urological Association and Japanese Society of Pathology. General rules for clinical and pathological studies on prostate cancer. 2nd ed. Tokyo, Japan: Kanahara-shuppan Co.; 1992.
23
Shigeno K, Igawa M, Shiina H, Kishi H, Urakami S. Transrectal colour Doppler ultrasonography for quantifying angiogenesis in prostate cancer.
BJU Int
2003
;
91
:
223
–6.
24
Narayan P, Dahiya R. Establishment and characterization of a human primary prostatic adenocarcinoma cell line (ND-1).
J Urol
1992
;
148
:
1600
–4.
25
Dahiya R, Lee C, McCarville J, Hu W, Kaur G, Deng G. High frequency of genetic instability of microsatellites in human prostatic adenocarcinoma.
Int J Cancer
1997
;
72
:
762
–7.
26
Li LC, Dahiya R. MethPrimer: designing primers for methylation PCRs.
Bioinformatics
2002
;
18
:
1427
–31.
27
Herman JG, Graff JR, Myohanen S, Nelkin BD, Baylin SB. Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands.
Proc Natl Acad Sci U S A
1996
;
93
:
9821
–6.
28
Enokida H, Shiina H, Igawa M, et al. CpG hypermethylation of MDR1 gene contributes to the pathogenesis and progression of human prostate cancer.
Cancer Res
2004
;
64
:
5956
–62.
29
Gibson P, Gill JH, Khan PA, et al. Cytochrome P450 1B1 (CYP1B1) is overexpressed in human colon adenocarcinomas relative to normal colon: implications for drug development.
Mol Cancer Ther
2003
;
2
:
527
–34.
30
Hudson CE, Schulte BA, Sutter TR, Norris JS. Steroid hormones modulate expression of cytochrome P450 enzymes in male hamster reproductive tract and leiomyosarcomas.
Carcinogenesis
2001
;
22
:
763
–70.
31
Reyes H, Reisz-Porszasz S, Hankinson O. Identification of the Ah receptor nuclear translocator protein (Arnt) as a component of the DNA binding form of the Ah receptor.
Science
1992
;
256
:
1193
–5.
32
Das PM, Singal R. DNA methylation and cancer.
J Clin Oncol
2004
;
22
:
4632
–42.
33
Takahashi Y, Suzuki C, Kamataki T. Silencing of CYP1A1 expression in rabbits by DNA methylation.
Biochem Biophys Res Commun
1998
;
247
:
383
–6.
34
Han X, Liehr JG. DNA single-strand breaks in kidneys of Syrian hamsters treated with steroidal estrogens: hormone-induced free radical damage preceding renal malignancy.
Carcinogenesis
1994
;
15
:
997
–1000.
35
Chakravarti D, Mailander PC, Li KM, et al. Evidence that a burst of DNA depurination in SENCAR mouse skin induces error-prone repair and forms mutations in the H-ras gene.
Oncogene
2001
;
20
:
7945
–53.
36
Newbold RR, Liehr JG. Induction of uterine adenocarcinoma in CD-1 mice by catechol estrogens.
Cancer Res
2000
;
60
:
235
–7.
37
Tolbert PE. Oils and cancer.
Cancer Causes Control
1997
;
8
:
386
–405.
38
Nadon L, Siemiatycki J, Dewar R, Krewski D, Gerin M. Cancer risk due to occupational exposure to polycyclic aromatic hydrocarbons.
Am J Ind Med
1995
;
28
:
303
–24.