Purpose: Colorectal cancer is an important cause of cancer deaths. Here, we focused our investigation on the β-catenin gene which is implicated in colorectal carcinogenesis and tested whether β-catenin mRNA is detectable in the plasma of colorectal carcinoma and adenoma patients using quantitative reverse transcriptase-PCR.

Experimental Design: Plasma β-catenin mRNA was measured from 58 colorectal carcinoma patients, 49 colorectal adenoma patients, and 43 apparently normal subjects using intron-spanning primers and Taqman probes. Five clinicopathological parameters were studied and correlated with plasma β-catenin mRNA concentration. Additionally, 19 colorectal carcinoma patients after tumor removal were also recruited for plasma β-catenin mRNA measurement to further demonstrate the clinical usefulness of this test.

Results: β-catenin mRNA was detected with median concentrations of 8737 (range: 1480–933,100), 1218 (range: 541–2,254) and 291 (range: 0–1,366) copies/ml plasma in colorectal carcinoma, colorectal adenoma, and apparently normal subjects, respectively. Statistical analysis demonstrated that plasma β-catenin mRNA concentration was correlated to tumor stage but not sex, age, lymph node status, and degree in differentiation. Moreover, plasma β-catenin mRNA concentration decreased significantly after tumor removal in 16 of 19 (84%) colorectal carcinoma patients.

Conclusions: We conclude that plasma β-catenin mRNA may potentially serve as a marker for colorectal cancer.

Colorectal cancer is the second leading cause of cancer deaths in Western countries, but detection and treatment of this cancer at an early stage can dramatically improve survival (1) Thus, there has been great interest in developing population-based screening for colorectal cancer to detect asymptomatic colorectal carcinoma, as well as its precursor, colorectal adenoma. Many methods have been evaluated, such as fecal occult blood testing, flexible sigmoidoscopy, screening colonoscopy, virtual colonoscopy, and barium enema, but they have limited sensitivity, specificity, or are invasive procedures (2). Recently, immunostaining for minichromosome maintenance protein 2 in colonocytes and analysis of mutations in DNA extracted from stool have been investigated for diagnosis of colorectal cancer (1, 3).

Assays of tumor or virus-associated DNA and RNA in plasma or serum have been shown to be sensitive and promising techniques for detecting and monitoring various cancers (4, 5, 6, 7, 8). Moreover, it is now widely accepted that the pathogenesis of colorectal cancer is caused by sequential multistep accumulation of genetic alterations (9). Among them, the adenomatous polyposis coli gene is the most important gatekeeper of colonic epithelial cell proliferation and also responsible for the down-regulation of β-catenin, whose loss of function may lead to the transition of normal colonic mucosa into adenoma and finally colorectal carcinoma (10). β-catenin is a Mr 92,000 protein that is one of the key targets in the Wnt-signaling pathway (11). Several reports indicated that uncontrolled β-catenin expression in Wnt signaling is one of the major pathways that lead to the development of colorectal cancer (10, 12, 13). Immunostaining for β-catenin usually shows abnormal nuclear accumulation in tumor cells, which is a potential prognostic marker in colorectal cancer patients (12). Furthermore, in previous studies, we have noted that: (a) colorectal tumors had a randomly distributed pattern of apoptosis (14, 15) and a high microvessel density (16); (b) nucleic acid in plasma may come from lysis of circulating cancer cells caused by tumor necrosis, apoptosis, or active release (17); (c) hematopoietic cells were reported to be nonadherent in nature (18); and (d) our group has studied in β-catenin before with observations that all hematopoietic cells did not express membrane and nucleus β-catenin protein (unpublished data). On the basis of these latter four points, we hypothesize that at least some of the apoptotic cells would release β-catenin mRNA into the circulation and that such β-catenin mRNA might be detectable in the patients’ plasma. Thus, the present study explores the possibility of using quantitative reverse transcriptase-PCR (Q-RT-PCR) in measuring plasma β-catenin mRNA in colorectal cancer and adenoma patients. To test whether mRNA other than β-catenin is elevated, we also measured the plasma mRNA of a housekeeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Finally, β-catenin mRNA level was measured in colorectal cancer patients after tumor removal to further demonstrate the potential clinical relevance of our observations.

Plasma Samples.

This study was approved by the local institutional ethics committee, and informed consent was obtained from all patients and apparently normal subjects between November 2002 and April 2003. Blood samples from 58 colorectal carcinoma patients before surgical operation and 19 follow-up patients (5–7 days after surgical operation) were collected. Forty-nine patients with suspected colorectal adenoma were also recruited within 20 min after endoscopic removal. The blood samples were sent to the laboratory within 15 min after collection. Gloves were worn during the whole process of treatment. Diagnosis of patients with colorectal carcinoma and adenoma was confirmed by histopathology. Clinical and pathological data, including sex, age, tumor stage, lymph node status, and degree in differentiation were all collected. (Table 1). Forty-three apparently normal subjects were studied as negative controls.

RNA Extraction and Reverse Transcription Reaction.

Six milliliters of blood were collected in three EDTA tubes of 2 ml each. They were immediately centrifuged at 3838 × g for 8 min at 4°C, followed by careful separation of plasma. They were then stored at −80°C until use. mRNA was extracted from 2 ml of plasma using 1.6 ml of TRIzol reagent (Life Technologies, Inc., Gaithersburg, MD), further purified with an RNeasy column (Qiagen, Inc., Hilden, Germany), according to manufacturers’ instructions and dissolved in 15 μl of DEPC-treated water followed by treatment with DNase I (Life Technologies). RT-PCR using Omniscript Reverse Transcriptase Kit (Qiagen) was exploited to generate cDNA for Q-RT-PCR to detect the β-catenin and GAPDH genes. Each batch of reaction included a positive control from a plasma sample with β-catenin mRNA or GAPDH mRNA and negative controls without RNA and reverse transcriptase.

Q-RT-PCR Assay.

Specific intron-spanning primers and fluorescent probes were designed for β-catenin detection (Table 2), whereas those for GAPDH were purchased from Applied Biosystems. Q-RT-PCR was set up in a reaction volume of 50 μl using Core Reagents Kit (Applied Biosystems), and 6 μl of cDNA were used for each reaction. Standard protocol of the ABI Prism 7000 Sequence Detector (Applied Biosystems) was used in Q-RT-PCR assay. Calibration curve for β-catenin mRNA quantification was prepared by amplifying serial dilutions of a synthetic oligonucleotide (Table 2), with concentrations ranging from 2.5 × 106 to 25 copies/μl. Similarly, the GAPDH mRNA calibration curve was prepared by serial dilutions of human control cDNA (Applied Biosystems), with concentrations ranging from 2.6 × 105 to 41 copies/μl. Each batch of amplification included a positive control from β-catenin or GAPDH calibration oligonucleotide and a negative control without cDNA. Duplicate tests were performed. Finally, the average was calculated for each sample.

Statistics.

Statistical analyses (computer software package SPSS v11 for Windows XP; SPSS, Inc.) were carried out using nonparametric Kruskal-Wallis, Spearman correlation, and Wilcoxon matched pairs tests to compare mRNA concentrations among the three groups of subjects and explore the relationship of β-catenin mRNA concentrations with sex, age, tumor stage, lymph node status, and degree in differentiation in colorectal cancer patients and between pre and postoperation in colorectal cancer patients, respectively. A P < 0.05 was considered significant.

β-catenin mRNA was detected in the plasma of all 58 colorectal cancer, 49 colorectal adenoma patients, and 36 (84%) of 43 normal subjects, with median concentrations of 8,737 (range: 1,480–933,100), 1218 (range: 541 to 2,254), and 291 (range: 0–1,366) copies/ml plasma, respectively (Fig. 1,A). Kruskal-Wallis test showed significant differential quantities among those three groups (P < 0.0001). Results were confirmed by another pair of specific intron-spanning primers with a product size of 250 bp visualized in 1.5% agarose gel for 20 colorectal carcinoma and 20 colorectal adenoma plasma samples (Fig. 2).

The plasma GAPDH mRNA concentration was considered to be a reflection of the total plasma mRNA. All plasma samples from the three groups showed detectable quantities of GAPDH mRNA with median concentrations of 1713 (range: 243-4948), 1236 (range: 70–5729), and 1225 (61–6765) copies/ml, respectively (Fig. 1 B). Kruskal-Wallis test showed no significant difference in the concentrations among those three groups (P = 0.0712). The presence of similar quantities of mRNA from a housekeeping gene in all three groups of subjects suggested that plasma β-catenin mRNA was selectively elevated in patients with colorectal carcinomas and adenomas. All positive controls had detectable quantities of β-catenin and GAPDH mRNA, and negative controls did not have any signal in each batch of assay. In addition, Spearman correlation analysis showed that β-catenin mRNA concentration in plasma was correlated to tumor stage (P < 0.05, r = 0.778) but not sex (P = 0.27), age (P = 0.49), lymph node status (P = 0.35), and degree in differentiation (P = 0.42) in colorectal cancer patients.

As a further demonstration of the potential clinical relevance of these data, β-catenin mRNA concentration was found to decrease significantly (P < 0.001; Wilcoxon matched pairs test) in 16 of 19 colorectal cancer patients after tumor removal (Fig. 1 C).

The finding of a detectable quantity of β-catenin mRNA in the plasma of colorectal cancer patients is an exciting development, because it may provide opportunities to establish noninvasive tests for detecting and monitoring this cancer. Our results are promising in the tested cancer subjects, which may be attributable to appropriate selection of mRNA target (β-catenin) and the efficiency of our plasma RNA extraction protocol (19). Moreover, this study provides evidence that reference ranges of β-catenin mRNA for colorectal carcinoma, adenoma patients, and normal subjects should be established in clinical application.

The measurement of GAPDH mRNA can demonstrate at least that there was amplifiable mRNA in a particular plasma sample. Previous studies were mainly based on nonquantitative methods, which may limit the potential clinical usefulness of such systems (6, 7). Our approach of using Q-RT-PCR offered a valuable quantitative dimension to the study and obviated the need for postamplification manipulation, which greatly improved the sensitivity and throughput and reduced the risk of carryover contamination.

One interesting finding from this study is that β-catenin mRNA concentration in colorectal cancer patients was only associated to tumor stage but not other parameters, including lymph node status, degree in differentiation, sex, and age. That significant relationship indicates that mRNA from residual tumor cells may get to the circulation, because angiogenesis is a common feature in tumor formation (16, 20), even before the tumor extends through muscularis propria into lymph nodes. This postulation is further supported by no association between β-catenin mRNA concentration and lymph node status. A more intensive study is necessary to explore whether plasma β-catenin mRNA concentration may become a new prognostic factor, in addition to lymph node status (21), in colorectal cancer patients in the future.

The elevation in plasma β-catenin mRNA in patients with colorectal adenoma compared with normal subjects suggests that adenoma may also be detected using this assay. It is possible that the sampling of such adenoma patients after endoscopic removal might have resulted in a lower level than would have been had the blood sampling been taken before adenoma removal. In fact, we managed to obtain five plasma samples from adenoma patients before endoscopy, and the median plasma β-catenin concentration was 20–25% higher than when they were obtained after endoscopy (data not shown). The presence of excess plasma β-catenin mRNA in adenoma patients implies that it is possible to detect early stage premalignant disease (5).

In addition, the significant reduction in plasma β-catenin mRNA level after tumor removal demonstrates not only the potential of using this assay for monitoring the efficacy of treatment (22) but also provides grounds that it may originate from the tumor. Although the decline of plasma β-catenin mRNA did not correlate to either tumor stage or nodal status, continuous follow-up of those 19 colorectal cancer patients is essential to assess the potential usefulness of plasma β-catenin mRNA measurement in the early detection of tumor recurrence or metastasis, because of three cancer patients who had higher β-catenin mRNA after surgical operation, two of them had T4 tumor stage without lymph node metastasis, which indicates that tumor cells may directly invade visceral peritoneum and even other organs.

Overall, the findings of correlation between β-catenin mRNA concentration and tumor stage together with elevated β-catenin mRNA concentration in colorectal adenoma patients indicate that its level in plasma may reflect the overall tumoral/lesional mass, which is further supported by our postoperation findings.

In conclusion, this study is the first to demonstrate the potential of plasma β-catenin mRNA as a marker in colorectal cancer patients. Additional experimentations, such as collection of blood from colorectal adenoma patients before endoscopy and establishment of an optimized schedule for blood collection and storage to prevent mRNA degradation, are necessary before clinical applications can be carried out. Finally, large-scale studies would be needed to investigate whether plasma β-catenin mRNA measurement might have a role in population screening for colorectal cancer.

Grant support: Grants from Ho Hung-Chiu Medical Education Foundation Research Grant and the Kadoorie Charitable Foundations (under the auspices of the Hong Kong Cancer Genetics Research Group).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Requests for reprints: S. C. Cesar Wong, Department of Pathology, Queen Elizabeth Hospital, Hong Kong Special Administrative Region, Hong Kong, China. Phone: 852-29586813; Fax: 852-29586812; E-mail: cesar01@netvigator.com

Fig. 1.

A, β-catenin mRNA in plasma of colorectal carcinoma, adenoma patients, and healthy subjects by quantitative reverse transcriptase-PCR. Black horizontal line, the median in each group of subjects. B, glyceraldehyde-3-phosphate dehydrogenase mRNA in plasma of colorectal carcinoma, adenoma patients, and healthy subjects by quantitative reverse transcriptase-PCR. Black horizontal line, the median in each group of subjects. C, pre and postoperative β-catenin mRNA in 19 colorectal carcinoma patients.

Fig. 1.

A, β-catenin mRNA in plasma of colorectal carcinoma, adenoma patients, and healthy subjects by quantitative reverse transcriptase-PCR. Black horizontal line, the median in each group of subjects. B, glyceraldehyde-3-phosphate dehydrogenase mRNA in plasma of colorectal carcinoma, adenoma patients, and healthy subjects by quantitative reverse transcriptase-PCR. Black horizontal line, the median in each group of subjects. C, pre and postoperative β-catenin mRNA in 19 colorectal carcinoma patients.

Close modal
Fig. 2.

Detection of plasma β-catenin mRNA: (a) Lane 1–10, β-catenin RNA (250 bp) from 10 colorectal carcinoma patients; (b) Lane 11–15, β-catenin RNA (250 bp) from 5 colorectal adenoma patients; (c) Lane 16, β-catenin RNA (250 bp) and DNA (450 bp) from a positive control without DNase; (d) Lane 17, negative control; (e) Lane 18, water control; and (f) Lane M, molecular markers.

Fig. 2.

Detection of plasma β-catenin mRNA: (a) Lane 1–10, β-catenin RNA (250 bp) from 10 colorectal carcinoma patients; (b) Lane 11–15, β-catenin RNA (250 bp) from 5 colorectal adenoma patients; (c) Lane 16, β-catenin RNA (250 bp) and DNA (450 bp) from a positive control without DNase; (d) Lane 17, negative control; (e) Lane 18, water control; and (f) Lane M, molecular markers.

Close modal
Table 1

Clinicopathological data of studied subjects

Colorectal carcinoma patients (n = 58)  
 Sex  
  Male 39 (68%) 
  Female 19 (32%) 
 Age  
  Range 30–88 years old 
  Median 67.5 years old 
 TNMa classification  
  Tumor stage  
  T1 0 (0%) 
  T2 15 (26%) 
  T3 30 (52%) 
  T4 13 (22%) 
  Lymph node status  
  N0 21 (37%) 
  N1 24 (41%) 
  N2 13 (22%) 
 Degree in differentiation  
  Well 0 (0%) 
  Moderate 44 (76%) 
  Poor 14 (24%) 
Colorectal adenoma patients (n = 49)  
 Sex  
  Male 31 (63%) 
  Female 18 (37%) 
 Age  
  Range 28–73 years old 
  Median 53 years old 
 Degree in dysplasia  
  Mild 4 (8%) 
  Moderate 31 (63%) 
  Severe 14 (29%) 
Apparently normal subjects (n = 43)  
 Sex  
  Male 15 (34%) 
  Female 28 (66%) 
 Age  
  Range 25–70 years old 
  Median 34.5 years old 
Colorectal carcinoma patients (n = 58)  
 Sex  
  Male 39 (68%) 
  Female 19 (32%) 
 Age  
  Range 30–88 years old 
  Median 67.5 years old 
 TNMa classification  
  Tumor stage  
  T1 0 (0%) 
  T2 15 (26%) 
  T3 30 (52%) 
  T4 13 (22%) 
  Lymph node status  
  N0 21 (37%) 
  N1 24 (41%) 
  N2 13 (22%) 
 Degree in differentiation  
  Well 0 (0%) 
  Moderate 44 (76%) 
  Poor 14 (24%) 
Colorectal adenoma patients (n = 49)  
 Sex  
  Male 31 (63%) 
  Female 18 (37%) 
 Age  
  Range 28–73 years old 
  Median 53 years old 
 Degree in dysplasia  
  Mild 4 (8%) 
  Moderate 31 (63%) 
  Severe 14 (29%) 
Apparently normal subjects (n = 43)  
 Sex  
  Male 15 (34%) 
  Female 28 (66%) 
 Age  
  Range 25–70 years old 
  Median 34.5 years old 
a

TNM, Tumor-Node-Metastasis.

Table 2

Sequences of primers, probe, and calibration oligonucleotide

Intron-spanning primers Forward Exon 2 5′-GCGTGGACAATGGCTACTCA-3′ 
 Reverse Exon 3 5′-CCGCTTTTCTGTCTGGTTCC-3′ 
Dual-labelled fluorescent probe  Exon 3 5′-(FAMa)TGATTTGATGGAGTTGGACATGGCCA (TAMRAb)-3′ 
Oligonucleotide for calibration   5′-ATCCAGCGTGGACAATGGCTACTCAAGCTGA TTTGATGGAGTTGGACATGGCCATGGAACCA GACAGAAAAGCGCTGTT-3′ 
Intron-spanning primers Forward Exon 2 5′-GCGTGGACAATGGCTACTCA-3′ 
 Reverse Exon 3 5′-CCGCTTTTCTGTCTGGTTCC-3′ 
Dual-labelled fluorescent probe  Exon 3 5′-(FAMa)TGATTTGATGGAGTTGGACATGGCCA (TAMRAb)-3′ 
Oligonucleotide for calibration   5′-ATCCAGCGTGGACAATGGCTACTCAAGCTGA TTTGATGGAGTTGGACATGGCCATGGAACCA GACAGAAAAGCGCTGTT-3′ 
a

6-carboxyfluorescein.

b

6-carboxytetramethylrhodamine.

We thank Dr. John K. C. Chan for reviewing this manuscript and giving helpful advice.

1
Traverso G., Shuber A., Olsson L., Levin B., Johnson C., Hamilton S. R., Boynton K., Kinzler K. W., Vogelstein B. Detection of proximal colorectal cancers through analysis of faecal DNA.
Lancet
,
359
:
403
-404,  
2002
.
2
Schoen R. E. The case for population-based screening for colorectal cancer.
Nat. Rev.
,
2
:
65
-70,  
2002
.
3
Davies R. J., Freeman A., Morris L. S., Bingham S., Dilworth S., Scott I., Laskey R. A., Miller R., Coleman N. Analysis of minichromosome maintenance proteins as a novel marker for detection of colorectal cancer in stool.
Lancet
,
359
:
1917
-1919,  
2002
.
4
Johnson P. J., Lo Y. M. D. Plasma nucleic acids in the diagnosis and management of malignant disease.
Clin. Chem.
,
48
:
1186
-1193,  
2002
.
5
Kopreski M. S., Benko F. A., Borys D. J., Khan A., McGarrity T. J., Gocke C. D. Somatic mutations screening: identification of individuals harboring K-ras mutations with the use of plasma DNA.
J. Natl. Cancer Inst. (Bethesda)
,
92
:
918
-923,  
2000
.
6
Chen X. Q., Bonnefoi H., Pelte M. F., Lyautey J., Lederrey C., Movarekhi S., Schaeffer P., Mulcahy H. E., Meyer P., Stroun M., Anker P. Telomerase RNA as a detection marker in the serum of breast cancer patients.
Clin. Cancer Res.
,
6
:
3823
-3826,  
2000
.
7
Silva J. M., Dominguez G., Silva J., Garcia J. M., Sanchez A., Rodriguez O., Provencio M., Espana P., Bonilla F. Detection of epithelial messenger RNA in the plasma of breast cancer patients is associated with poor prognosis tumor characteristics.
Clin. Cancer Res.
,
7
:
2821
-2825,  
2001
.
8
Kopreski M. S., Benko F. A., Kwak L. W., Gocke C. D. Detection of tumor messenger RNA in the serum of patients with malignant melanoma.
Clin. Cancer Res.
,
5
:
1961
-1965,  
1999
.
9
Kinzler K. W., Vogelstein B. Lessons from hereditary colorectal cancer.
Cell
,
87
:
159
-170,  
1996
.
10
Morin P. J. β-catenin signaling and cancer.
Bioessays
,
21
:
1021
-1030,  
1999
.
11
Wong S. C., Lo S. F., Lee K. C., Yam J. W., Chan J. K., Hsiao W. L. Expression of frizzled-related protein and Wnt-signalling molecules in invasive human breast tumours.
J. Pathol.
,
196
:
145
-153,  
2002
.
12
Wong S. C., Lo S. F., Chan K. C., Lee K. C., Hsiao W. L. Nuclear β-catenin as a potential prognostic and diagnostic marker in colorectal cancer from Hong Kong.
J. Clin. Pathol.
,
56
:
347
-352,  
2003
.
13
Moon R. T., Bowerman B., Boutros M., Perrimon N. The promise and perils of Wnt signaling through β-catenin.
Science (Wash. DC)
,
296
:
1644
-1646,  
2002
.
14
Backus H. H., Van Groeningen C. J., Vos W., Dukers D. F., Bloemena E., Wouters D., Pinedo H. M., Peters G. J. Differential expression of cell cycle and apoptosis related proteins in colorectal mucosa, primary colon tumours, and liver metastases.
J. Clin. Pathol.
,
55
:
206
-211,  
2002
.
15
Rupa J. D., de Bruine A. P., Gerbers A. J., Leers M. P., Nap M., Kessels A. G., Schutte B., Arends J. W. Simultaneous detection of apoptosis and proliferation in colorectal carcinoma by multiparameter flow cytometry allows separation of high and low-turnover tumors with distinct clinical outcome.
Cancer (Phila.)
,
97
:
2404
-2411,  
2003
.
16
Li C., Gardy R., Seon B. K., Duff S. E., Abdalla S., Renehan A., O’Dwyer S. T., Haboubi N., Kumar S. Both high intratumoral microvessel density determined using CD105 antibody and elevated plasma levels of CD105 in colorectal cancer patients correlate with poor prognosis.
Br. J. Cancer
,
88
:
1424
-1431,  
2003
.
17
Silva J. M., Rodriguez R., Garcia J. M., Munoz C., Silva J., Dominguez G., Provencio M., Espana P., Bonilla F. Detection of epithelial tumour RNA in the plasma of colon cancer patients is associated with advanced stages and circulating tumour cells.
Gut
,
50
:
530
-534,  
2002
.
18
Hwang S. G., Lee H. C., Trepel J. B., Jeon B. H. Anticancer-drug-induced apoptotic cell death in leukemia cells is associated with proteolysis of beta-catenin.
Leuk. Res.
,
26
:
863
-871,  
2002
.
19
Ng E. K. O., Tsui N. B., Lau T. K., Leung T. N., Chiu R. W., Panesar N. S., Lit L. C., Chan K. W., Lo Y. M. D. mRNA of placental origin is readily detectable in maternal plasma.
Proc. Natl. Acad. Sci. USA
,
100
:
4748
-4753,  
2003
.
20
Hanrahan V., Currie M. J., Gunningham S. P., Morrin H. R., Scott P. A., Robinson B. A., Fox S. B. The angiogenic switch for vascular endothelial growth factor VEGF-A, VEGF-B, VEGF-C, and VEGF-D in the adenoma-carcinoma sequence during colorectal cancer progression.
J. Pathol.
,
200
:
183
-194,  
2003
.
21
O’Dwyer S. T., Haboubi N. Y., Johnson J. S., Gardy R. Detection of lymph node metastases in colorectal carcinoma.
Colorectal Dis.
,
3
:
288
-294,  
2001
.
22
Okuda N., Nakao A., Takeda S., Oshima K., Kanazumi N., Nonami T., Kurokawa T., Takagi H. Clinical significance of alpha-fetoprotein mRNA during perioperative period in HCC.
Hepatogastroenterology
,
46
:
381
-386,  
1999
.