¹⁷⁷Lu-DOTA-EB-TATE, a Radiolabeled Analogue of Somatostatin Receptor Type 2, for the Imaging and Treatment of Thyroid Cancer

The current treatment regimen for metastatic differentiated thyroid cancer (DTC) includes thyroidectomy followed by radioactive iodine (RAI) therapy, while medullary thyroid cancer (MTC) is routinely treated with surgery and tyrosine kinase inhibitors (1). Unfortunately, 5%–22% of patients become refractory to standard therapy, particularly patients with Hurthle cell thyroid cancer (HTC), characterized by low RAI uptake in metastatic lesions (2, 3). Previous studies have reported that the average survival for patients with RAI-refractory DTC is around 2.5–3.5 years and with aggressive metastatic MTC even shorter, 1.75 years (4–6). There is a clear need for improved therapy in these patients.

Somatostatins (SST) are a family of cyclopeptides that are produced by endocrine, gastrointestinal, neuronal, and immune cells (7). The metabolically stable SST analogues have been labeled with radionuclides to utilize them in peptide receptor radionuclide therapy (PRRT; ref. 8). Treatment efficacy depends on the expression of SST receptors, among which somatostatin receptor type 2 (SSTR2) is the most commonly expressed on tumor tissues (9). Currently, there are several SST analogues available with varying SSTR2 affinities and tumor retention time, with only two (radiolabeled DOTA-TATE and DOTA-TOC) currently approved by the FDA for the imaging of neuroendocrine tumors (10, 11) and one approved for the treatment of gastroenteropancreatic neuroendocrine tumors, lutetium (¹⁷⁷Lu)-labeled DOTA-TATE (12). Moreover, recent studies have shown that an SSTR2 agonist combined with Evans blue analogue (DOTA-EB-TATE) is characterized by a higher tumor uptake and residence time in vivo in preclinical models and in pilot studies of patients with advanced metastatic neuroendocrine tumors (13, 14). Recently synthesized SSTR2 antagonists, such as JR11, although not internalized, are reported to have superior binding affinity and long residence time due to slow dissociation from the receptor (15). JR11 was reported to exert superior binding characteristics and tumor-to-background uptake ratios in preclinical models and in pilot clinical trials in patients with metastatic neuroendocrine tumors (16–18).

Interestingly, the NIH case series of patients with neuroendocrine tumors revealed incidental uptake of radiolabeled SST analogue, ⁶⁸Gallium- (⁶⁸Ga)-DOTA-TATE, in thyroid nodules, among which 21% were found to be malignant (19). However, there are no data on the role of radiolabeled DOTA-EB-TATE and DOTA-JR11 in the diagnosis and treatment of thyroid cancer. Therefore, the goal of this study was to provide a comprehensive analysis of SSTR2 expression and mechanisms of its upregulation in thyroid cancer and compare the uptake and therapeutic efficacy of radiolabeled SST analogues, which are characterized by different binding capacity and tumor retention times in preclinical models of SSTR2-positive tumors.

The protocol for human studies was approved by the NIH Institutional Review Board (Bethesda, MD) and Radiation Safety Committee. All patients gave written informed consent to participate in the studies that were conducted in accordance with the ethical guidelines outlined in the Declaration of Helsinki, CIOMS, Belmont Report, and U.S. Common Rule. We performed a pilot clinical trial (clinicaltrials.gov identifier ID: NCT00001160) aimed at screening patients with RAI non-avid metastatic DTC and MTC for the presence of SSTR2 expression by imaging with ⁶⁸Ga-DOTA-TATE PET/CT. Each patient received 5 mCi of ⁶⁸Ga-DOTA-TATE intravenously followed by PET/CT imaging per standard protocol. Any lesion demonstrating activity higher than the physiologic uptake of the involved organ was considered a “true” lesion, unless correlative anatomic imaging suggested nonmalignant or alternative pathology (20). Two investigators (C. Millo and J. Klubo-Gwiezdzinska) analyzed the images and obtained maximum and mean standard uptake values (SUV) for up to six lesions in each patient.

The human thyroid cancer cell lines gifted from Dr. Electron Kebebew (Stanford University, Stanford, CA) or purchased from University of Colorado Cancer Center (Aurora, CO) or the ATCC were used in this study: follicular thyroid cancer, FTC133; papillary thyroid cancer, BCPAP and TPC1; MTC, TT; anaplastic thyroid cancer, THJ16T, THJ29T, 8505C, OCUT2, KAT18, SW1736, and C643 (ATC); and HTC, XTC1. A rat pancreatic cell line, AR42J, with intrinsically high SSTR2 expression, was used as a positive control for SST analogue uptake studies (13). The cells were authenticated by short tandem repeat analysis and contamination was excluded via IMPACT II PCR analysis.

The cells were grown in the standard media, supplemented with 10% FBS (Thermo Fisher Scientific) for human cell lines and 20% for a rat AR42J cell line, as well as with 10 U/mL Penicillin–Streptomycin (Gibco) and 0.25 μg/mL Amphotericin B (Gibco). For treatment (72 hours), valproic acid (Sigma-Aldrich, PHR1061) was added to the culture medium at a final concentration of 2 or 4 mmol/L, while tacedinaline (Sigma-Aldrich, C0621) and decitabine (Sigma-Aldrich, A3656) were added at final concentration of 500 and 75 ng/mL, respectively, which corresponds to their therapeutic serum concentrations (21).

For mRNA analysis, cells were seeded in 6-well plates and total RNA was isolated from the cells using RNeasy Mini Kit (Qiagen). RNA was quantified using Nanodrop (manufacturer) and 1 μg of RNA was used to synthesize cDNA using the iScript cDNA Synthesis Kit (Bio-Rad). The relative gene expression was analyzed using iQ SYBR Green SuperMix (Bio-Rad) on a StepOnePlus Real-Time PCR Detection System (Applied Biosystems). We used commercially available primers for the analysis of SSTR2 (Hs_SSTR2_1_SG QuantiTect primer assay and Rn_Sstr2_1_SG QuantiTect primer assay) and β-actin (Hs_ACTB_2_SG QuantiTect primer assay and Rn_Actb_1_SG QuantiTect primer assay) expression. The relative gene expression was normalized to β-actin and calculated using the 2^–ΔΔC_t method.

Cells were seeded in a 10-cm culture plate and lysed using Mammalian Protein Extraction Reagent (M-PER, Thermo Fisher Scientific) as per the manufacturer's instructions. To increase the protein concentration, Amicon Centrifugal Filters (Millipore) were used. The protein concentration was determined by using the DC protein assay kit II. The samples were loaded onto 4%–12% SDS-PAGE Gel (Novex; 30–50 μg/lane) and transferred onto a polyvinylidene difluoride membrane using a Trans-blot Turbo System (Bio-Rad). The membranes were blocked with 3% BSA and prepared in PBST for 1 hour at room temperature. The membranes were incubated overnight at 4°C with a primary antibody against SSTR2 (1:400, R&D Systems, MAB4224), acetylated histone 3 (1:500, Millipore, 06-599), or acetylated histone 4 (1:500, Millipore, 06-598), GAPDH (1:1,000; Invitrogen, MA5-15738), and β-actin (1:1,000, Santa Cruz Biotechnology, sc-47778). The membranes were washed three times with PBST followed by incubation with either anti-mouse or anti-rabbit secondary antibody for 1 hour at room temperature. The membranes were finally washed three times with PBST and imaged using ECL (Azure Biosystems) and an Imaging System (Bio-Rad).

To analyze the membranous expression of SSTR2, cells were harvested, washed, and counted. The cells were then resuspended in ice-cold PBS containing 10% FCS and 1% sodium azide at a concentration of 2 × 10⁶ cells/mL. For each sample, 200 μL of this cell suspension was used and 2 μg of SSTR2 antibody was added and incubated for 1 hour at room temperature. Following incubation, the cells were washed three times with ice-cold PBS by centrifugation at 1,000 rpm for 5 minutes. After washings, cells were incubated with an Alexa Fluor 680–labeled secondary antibody (4 μg), which was prepared in 3% BSA in PBS. The cells were incubated for 30 minutes at room temperature in the dark and washed three times, followed by resuspension in ice-cold PBS containing 3% BSA and 1% sodium azide. The cells were immediately analyzed by Flow Cytometer (LSR II, BD Biosciences) for SSTR2 membranous expression. To avoid any detection of intracellular SSTR2, cell permeabilization was avoided.

Immunostaining was performed on commercially available Human Thyroid Cancer Tissue Microarray Slides (US Biomax Inc.), on formalin-fixed, paraffin-embedded tissue samples from thyroidectomized patients (MTC and HTC), and animal thyroid cancer models. Sections were dewaxed, soaked in alcohol, and then microwave treated in Antigen Unmasking Solution (Vector Laboratories) for 10 minutes. Endogenous peroxidase activity was quenched by incubation in 3% hydrogen peroxide. Sections were then incubated for 10 minutes in a working solution of blocking serum and incubated at 4°C overnight with anti-SSTR2 antibody (Abcam, catalog no., ab9550, dilution 1/100). Immunostaining was performed using the Vectastain Universal Quick Kit (Vector Laboratories Inc.) as per the manufacturer's instructions. Sections were incubated with biotinylated secondary antibody for 10 minutes and in streptavidin/peroxidase complex working solution for 10 minutes. Peroxidase staining was revealed with the ImmPact DAB Peroxidase Substrate Kit (Vector Laboratories). Sections were counterstained with hematoxylin and mounted. The antiserum was omitted in the negative control. The results of staining were interpreted and scored independently by two investigators (V. Vasko and J. Klubo-Gwiezdzinska). The intensity of staining was scored as 0 (negative staining) and 1 (positive, intensity similar to those obtained in positive control). The quantitative data from the assessment of relative percentage of immunopositive cells in thyroid tissue samples were calculated as 0, no staining; 1, positive staining in <25% of cells; 2, positive staining in 25%–50% of cells; and 3, positive staining in >50% of cells. The final immunoscore was calculated by multiplying each score (22).

Cells were cultured in 150-mm cell culture dishes. The chromatin immunoprecipitation (ChIP) assay was performed using the ChIP-IT Express Enzymatic Kit (Active Motif, 53009) as per the manufacturer's instructions. The chromatin was sheared using the ChIP-IT Express Enzymatic Kit (Active Motif, 53035). We used Histone H3ac (pan-acetyl) antibody (Active Motif, 39139), Histone H4ac (pan-acetyl) antibody (Active Motif, 39243), and isotype IgG control for immunoprecipitation. The immunoprecipitated DNA was analyzed by real-time PCR for H3 and H4 acetylation at the SSTR2 promoter by using primers directed against the human and rat SSTR2 gene promoter. The sequences of human SSTR2 primers are: forward primer, GAAGGAAGGAAGGAAGAA and reverse primer, GGATGAAGTCATTGATGTC, while the sequences of rat SSTR2 primers are: forward primer, CCCGGGACTGGTCCGTGGTA and reverse primer, CAGCTGGTGTGGCGACTGGG. ChIP data were normalized to the input DNA and analyzed as fold enrichment relative to isotype control antibody.

The animal protocol for the experiments was approved by the NIDDK Animal Care and Use Committee. Eight- to 10-week-old athymic nude mice and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ mice (The Jackson Laboratory) were used to create subcutaneous xenograft and metastatic mouse models, respectively. For the metastatic model, the mice received a tail vein injection of FTC133 (16 × 10⁴ cells) containing a linearized pGL4.51[luc2/CMV/Neo] vector (23). The tumor burden was monitored weekly in the mice using the IVIS Lumina In Vivo Imaging System (PerkinElmer) by injecting them with luciferin (150 mg luciferin/kg body weight, PerkinElmer) 10 minutes before imaging. For the subcutaneous xenograft model, athymic nude mice were injected subcutaneously with FTC133, BCPAP, TT, or AR42J (5 × 10⁵ cells). The tumor burden was monitored regularly by using a Vernier caliper. The mice were euthanized if the tumors exceeded 2 cm in diameter, impeded movement, or if there were signs of breathing difficulty at any point in the study. The mice were grouped into control and treatment groups based on weight, gender, and tumor burden. The mice were then treated with either valproic acid (300 μg/kg, Sigma-Aldrich, P4543), decitabine (1 mg/kg), or saline (placebo) via intraperitoneal injections daily for 10 days followed by PET imaging or radionuclide therapy studies (Supplementary Fig. S8).

PET imaging was performed in the metastatic mice model at 4–5 weeks after inoculation when the average luminescence in the metastatic areas was in the range of 10⁷–10⁸. For the subcutaneous xenograft mice model, PET imaging was performed when the tumor size exceeded 1 cm. The FTC133 and AR42J formed 1–2 cm tumors within 2 weeks after inoculation, while BCPAP in 3–4 weeks and TT in 4–5 weeks. Each mouse received a dose of approximately 100 μCi of each radiolabeled SST analogue (⁶⁸Ga-DOTA-TATE, ⁶⁸Ga-DOTA-JR11, and ⁸⁶Y-DOTA-EB-TATE) consecutively via tail vein injection. DOTA-TATE (TATE supplied by CSBio) and DOTA-JR11 (JR11 provided by IPSEN), as agents characterized by a short half-life, were labeled with ⁶⁸Ga with a half-life of 67.7 minutes. DOTA-EB-TATE (EB-TATE patented by NIH and licensed by Molecular Targeting Technologies Inc.), an agent with a long half-life in the blood due to a reversible binding to albumin²⁵, required radiolabeling with ⁸⁶Y, because this isotope is characterized by a longer half-life of 14.7 hours. These pharmacokinetics and pharmacodynamics formed the rationale for the particular order of consecutive injections for each mouse with ⁶⁸Ga-DOTA-TATE and ⁶⁸Ga-DOTA-JR11, injected 4 hours apart (∼4 half-lives apart), followed by DOTA-EB-TATE as the last SST analogue in all mice (Supplementary Fig. S8A). Randomization to injection of the DOTA-EB-TATE as the first agent is futile because it would necessitate performing the remaining PET/CTs after approximately 4 days (∼4 half-lives). Significant tumor growth could take place during this delay, rendering the imaging results incomparable. The static PET imaging for ⁶⁸Ga-DOTA-TATE and ⁶⁸Ga-DOTA-JR11 was done at 60 minutes postinjection, while for ⁸⁶Y-DOTA-EB-TATE, imaging was performed at 16–24 hours postinjection, per the previously published pharmacokinetics and pharmacodynamics studies (13, 24). The PET scans were acquired on Inveon (Siemens) scanners. The PET images were analyzed using ASIPro (Siemens) to plot regions of interest and calculate SUV. The SUV was corrected for injected radioactivity dose, decay, branching, and mouse weight. After the last scan, mice were euthanized and tumor, heart, lungs, liver, spleen, and kidneys were collected to perform biodistribution studies. The counts per minute readings were normalized by the weight of the tissues and biodistribution data are presented as percentages of the injected dose per gram of tissue (%ID/g).

To evaluate therapeutic efficacy, the SST analogues were labeled with the therapeutic radionuclide, ¹⁷⁷Lu. The FTC133 and AR42J tumor mice models were pretreated with either placebo or valproic acid, with a goal of inducing SSTR2 expression in the tumors of valproic acid–treated animals. The mice were divided into control and valproic acid groups based on their body weight and gender. Two weeks after inoculation, the mice in control and valproic acid groups were subdivided into the following groups: (i) control placebo-treated mice receiving ¹⁷⁷Lu-DOTA-EB-TATE (500 μCi), (ii) control placebo-treated mice receiving saline, (iii) valproic acid–treated mice receiving ¹⁷⁷Lu-DOTA-EB-TATE (500 μCi), and (iv) valproic acid–treated mice receiving saline (Supplementary Fig. S8B). All mice received two doses of either ¹⁷⁷Lu-DOTA-EB-TATE or saline a week apart. The tumor burden in each mouse was monitored twice a week and living mice were euthanized 60 days after first ¹⁷⁷Lu-DOTA-EB-TATE injection. The tumor burden was calculated by using the formula: tumor volume = (width² × length)/2.

Subsequently, to compare the therapeutic effects of different SST analogues, we utilized mice with AR42J tumors characterized by the highest SST analogues uptake. Prior to therapy initiation, the mice were divided into three groups based on their tumor volume, gender, and body weight as follows: (i) ¹⁷⁷Lu-DOTA-TATE (500 μCi), (ii) ¹⁷⁷Lu-DOTA-JR11 (500 μCi), and (iii) ¹⁷⁷Lu-DOTA-EB-TATE (500 μCi; Supplementary Fig. S8C). All mice received their first dose 2 weeks after inoculation and the second dose was given 7 days later. The effect of the therapy was analyzed by obtaining tumor measurements twice a week. Living mice were euthanized 24 days after first ¹⁷⁷Lu-labeled SST analogue injection.

GraphPad Prism 8.1 software was used for data analysis. A two-tailed unpaired Student t test was used for comparison between two groups. One-way ANOVA with post hoc Tukey test was used for comparison between more than two groups. Data are presented as mean ± SD or mean ± SEM for normally distributed data and median with (25–75 interquartile range) for skewed data. P < 0.05 was considered significant.

RNA sequencing data available in The Cancer Genome Atlas database were analyzed for 507 patients with papillary thyroid cancer (PTC; ref. 25), demonstrating that SSTR2 is expressed in all PTC stages and subtypes (Supplementary Fig. S1A and S1B). This included 65 paired samples of tumor versus normal thyroid tissues, derived from the same patients, which demonstrated significantly higher SSTR2 expression in tumor tissue samples compared with the paired normal thyroid tissues (log fold change, 0.6; P = 0.03).

Immunostaining on 92 human tissue samples, 84 thyroid cancer tissue samples (39 PTCs, 19 FTCs, 6 poorly differentiated cancers, 16 MTCs, and 4 HTCs) and 8 normal thyroid tissues, showed high SSTR2 protein expression (IHC scores, 2 and 3) in 51.4% (35/68) of thyroid cancer samples of epithelial origin and 43.8% (7/16) of MTC samples. There was no significant expression in the normal thyroid samples (Fig. 1A; Supplementary Table S1).

To analyze the presence of SSTR2 in thyroid cancer metastases, ⁶⁸Ga-DOTA-TATE PET/CT was performed in patients with RAI non-avid metastatic DTC and MTC. Among 25 enrolled patients, ages 52.2 ± 13 years old at the study enrollment and 40 ± 15 years old at thyroid cancer diagnosis, 13 of 25 (52%) were females, 5 presented with HTC, 8 with MTC, and 12 with PTC. ⁶⁸Ga-DOTA-TATE PET/CT was positive in 20 of 25 (80%) patients. The highest uptake was observed in patients with HTC [median SUV_max, 16.5 (7.9–29)] compared with patients with MTC, characterized by low-to-moderate SUV_max [median, 4.3 (3.2–9.5); P = 0.019], and patients with PTC, with median SUV_max of 5.4 [(3.8–7.8); P = 0.007; Fig. 1B]. Two patients with MTC and 3 with PTC had no evident uptake above the background, suggesting a lack of, or very low, SSTR2 expression in their metastatic lesions. The PET/CT images demonstrating high ⁶⁸Ga-DOTA-TATE uptake are depicted in Fig. 1C (HTC), D (PTC), and E (MTC). Because the high therapeutic efficacy of PRRT in neuroendocrine tumors has been associated with tumors characterized by SUV_max > 13–15 (26, 27), we further showed that SUV_max > 15 was observed in at least one metastatic lesion in 7 of 25 (28%) enrolled patients. It was observed in 4 of 5 (80%) patients with metastatic HTC, 1 of 12 (8.3%) patients with metastatic PTC, and 2 of 8 (25%) patients with metastatic MTC (Supplementary Table S2).

Given only low-to-moderate ⁶⁸Ga-DOTA-TATE uptake in a majority of patients with PTC and MTC, functional in vitro and in vivo studies were performed to test whether SSTR2 expression could be significantly and safely upregulated and whether radiolabeled SST analogues, besides DOTA-TATE, might be associated with higher tumor uptake.

Several thyroid cancer cell lines were screened for the presence of SSTR2 by RT-PCR (Supplementary Fig. S1C). The thyroid cancer cell lines, TT, FTC133, and BCPAP, were chosen for subsequent functional in vitro and in vivo studies based on differential SSTR2 expression, histologic origin, and ability to form tumors in vivo (Supplementary Fig. S1E).

Because the thyroid cancer cell lines had low-to-moderate SSTR2 expression, it was analyzed whether SSTR2 could be upregulated in an in vitro model. SSTR2 is an epigenetically regulated gene and, therefore, we utilized epigenetic modifiers, histone deacetylase (HDAC) inhibitors, valproic acid and tacedinaline, and DNA methyltransferase inhibitor, decitabine (21). Valproic acid was observed to be a more potent inducer of SSTR2 expression in thyroid cancer cells in comparison with tacedinaline and decitabine (Supplementary Fig. S2A and S2B). Treatment with 2 or 4 mmol/L valproic acid for 72 hours significantly upregulated SSTR2 expression in FTC133, BCPAP, and TT cells (Fig. 2A,–C, and F,–H; Supplementary Fig. S1F–S1I and S1K), as well as in the AR42J cell line (Fig. 2K,–M; Supplementary Fig. S1J). Flow cytometry demonstrated an increased membranous SSTR2 expression in examined cell lines (Fig. 2B, G, and L). Valproic acid treatment resulted in growth inhibition by promoting cell-cycle arrest (Supplementary Fig. S3A–S3L).

Because valproic acid is an HDAC inhibitor, the effects of valproic acid on the acetylation of histones 3 (H3ac) and 4 (H4ac) were analyzed. As indicated in Fig. 2D, I, and N, we observed an increase in H3ac and H4ac in valproic acid–treated FTC133, BCPAP, and AR42J cells. To further identify whether valproic acid–mediated upregulation of SSTR2 expression is caused by an increase in H3ac or H4ac at the SSTR2 promoter, ChIP assays were performed. Valproic acid treatment in BCPAP and AR42J cells resulted in a significant increase in both H3ac (1.9-fold BCPAP; P < 0.001 and 2.8-fold AR42J; P < 0.001) and H4ac (2.9-fold BCPAP; P < 0.001 and 2.7-fold AR42J; P < 0.01; Fig. 2J and O). In contrast, in FTC133 cells, H4ac was increased by 2.4-fold (P < 0.001) at the SSTR2 promoter, while H3ac was slightly, but significantly reduced (P < 0.05; Fig. 2E). Overall, our results indicate that valproic acid treatment is associated with increased SSTR2 expression in thyroid cancer cells independent of baseline expression levels. Higher SSTR2 protein expression in valproic acid–treated cells is associated with increased H3ac and/or H4ac at the SSTR2 promoter.

The uptake of the radiolabeled SST analogues in FTC133, BCPAP, TT, and AR42J subcutaneous xenograft models was analyzed. Irrespective of the cell lines, ⁸⁶Y-DOTA-EB-TATE showed the highest tumor uptake in all mice models in comparison with ⁶⁸Ga-DOTA-TATE and ⁶⁸Ga-DOTA-JR11 (Fig. 3A and C,–E; Table 1).

The uptake of ⁶⁸Ga-DOTA-TATE and ⁶⁸Ga-DOTA-JR11 was similar in all mice models (Table 1). Tumors derived from AR42J cells (high SSTR2 expression) showed the highest uptake among all SST analogues in comparison with FTC133, BCPAP, and MTC (TT) mice models (P < 0.001; Fig. 3F; Table 1).

In addition to the subcutaneous mice model, the uptake of three SST analogues was examined in a metastatic FTC133 mice model. Similar to the subcutaneous mouse model, ⁸⁶Y-DOTA-EB-TATE had the highest uptake in the metastatic lesions in comparison with ⁶⁸Ga-DOTA-TATE (P < 0.001) and ⁶⁸Ga-DOTA-JR11 (P < 0.001), respectively (Fig. 3B).

We next evaluated whether valproic acid treatment improved the uptake of SST analogues in the subcutaneous and metastatic mice models. Irrespective of the model, no significant effect from valproic acid treatment was observed on the uptake of the SST analogues (Supplementary Fig. S4A–S4D). However, IHC staining did reveal higher cytoplasmic SSTR2 expression in tumor tissues derived from mice exposed to valproic acid compared with placebo in FTC133 (P = 0.023) and AR42J (P = 0.016) models (Supplementary Table S3). Similar to valproic acid, decitabine treatment did not improve the uptake of ⁸⁶Y-DOTA-EB-TATE in FTC133 and AR42J subcutaneous mice models, as indicated by PET scans (Supplementary Fig. S5A and S5B).

The alternative to the upregulation of SSTR2 in vivo is to utilize SST analogues possessing the highest binding affinity and diagnostic and therapeutic activity. Significantly enhanced tumor uptake could be obtained by using the SST analogue ⁸⁶Y-DOTA-EB-TATE compared with ⁶⁸Ga-DOTA-TATE (P < 0.001) and ⁶⁸Ga-DOTA-JR11 (P < 0.001).

To determine and compare the uptake of radiolabeled SST analogue by normal body organs and tumor tissue, biodistribution studies were performed on FTC133 and AR42J tumor–bearing mice after ⁸⁶Y-DOTA-EB-TATE scans. In FTC133 mice, the uptake by tumor tissue (5.8 ± 0.8 %ID/g) was comparable with the spleen (5.1 ± 3.5 %ID/g; P = 0.7), while the liver (4.24 ± 0.43 %ID/g; P < 0.01) and heart (3.76 ± 0.7 %ID/g; P < 0.01) had significantly lower uptake compared with tumor tissue. In contrast, uptake by the kidneys (11.6 ± 1.1 %ID/g; P < 0.001) and lungs (8.5 ± 1.4 %ID/g; P < 0.01) was significantly higher than FTC133 tumors (Fig. 4A). In AR42J tumor–bearing mice, tumor uptake (19.13 ± 8.8 %ID/g) was superior to the uptake by the liver (2.4 ± 0.56 %ID/g; P < 0.01), kidneys (6.9 ± 1.5 %ID/g; P < 0.05), spleen (2.2 ± 0.8 %ID/g; P < 0.01), heart (2.4 ± 0.36 %ID/g; P < 0.01), and lungs (5.4 ± 1 %ID/g; P < 0.05; Fig. 4D). Similar to PET imaging, biodistribution analysis also revealed superior uptake by AR42J tumors (3.3-fold higher; P < 0.05) in comparison with FTC133 tumors. Moreover, as expected, higher uptake of ⁸⁶Y-DOTA-EB-TATE by AR42J tumors was associated with relatively reduced uptake by normal organs in comparison with the FTC133 mice model. Neither valproic acid nor decitabine treatment resulted in any significant difference in the uptake of ⁸⁶Y-DOTA-EB-TATE within the tumor and normal tissues in comparison with the control mice (Supplementary Fig. S6A–S6D).

Because DOTA-EB-TATE had the highest uptake in tumor tissues, therapeutic efficacy of this analogue radiolabeled with ¹⁷⁷Lu (half-life 6.7 days) was tested in high SSTR2–expressing (AR42J) and low SSTR2–expressing tumors (FTC133). After receiving the first dose of ¹⁷⁷Lu-DOTA-EB-TATE, AR42J tumors were stabilized and did not progress further in size. After receiving a second dose 1 week later, these mice showed a decline in tumor growth. In contrast, the tumors of placebo-treated mice continued to progress, and the mice had to be euthanized within 14 days (Fig. 4E and F). The disease-specific survival of the mice that received ¹⁷⁷Lu-DOTA-EB-TATE therapy was significantly higher than the control group (P < 0.001). In contrast, the low SSTR2–expressing FTC133 tumors did not respond to the ¹⁷⁷Lu-DOTA-EB-TATE treatment (Fig. 4B and C). Valproic acid pretreatment did not improve the efficacy of ¹⁷⁷Lu-DOTA-EB-TATE in either AR42J or FTC133 mice models (Supplementary Fig. S7A and S7B).

The therapeutic efficacy of all three SST analogues was compared in the AR42J mice model. Consistent with the observed higher tumor uptake on imaging, ¹⁷⁷Lu-DOTA-EB-TATE–treated mice responded to treatment, with an overall 87% ± 13% reduction in the tumor volume after 2 weeks (Fig. 5A and B). In contrast, mice treated with ¹⁷⁷Lu-DOTA-TATE and ¹⁷⁷Lu-DOTA-JR11 showed continued tumor progression and had to be euthanized within 10 days after the starting therapy (Fig. 5A and B). The disease-specific survival in the ¹⁷⁷Lu-DOTA-EB-TATE–treated mice (24 ± 0 days) was significantly longer compared with ¹⁷⁷Lu-DOTA-TATE– (7.7 ± 2.6 days; P < 0.001) and ¹⁷⁷Lu-DOTA-JR11–treated mice (6.3 ± 3 days; P < 0.001) (Fig. 5C). There was no difference in disease-specific survival between ¹⁷⁷Lu-DOTA-TATE– and ¹⁷⁷Lu-DOTA-JR11–treated mice (P = 0.3; Fig. 5C). Thus, ¹⁷⁷Lu-DOTA-EB-TATE is characterized by superior therapeutic efficacy in the management of tumors with high SSTR2 expression. None of the radiolabeled SST analogues were effective in tumors with low-to-moderate SSTR2 expression.

We demonstrated that SSTR2 may serve as a molecular target in the diagnosis and treatment of a subset of patients with thyroid cancer. First, we showed that patients with HTC are characterized by high ⁶⁸Ga-DOTA-TATE uptake. As SUV_max of >13–15 has been associated with improved objective response rate and extended progression-free survival (PFS) in patients with neuroendocrine tumors, the median SUV_max of 16.5 (7.9–29) observed in patients with HTC suggests that PRRT might be beneficial in these patients, which are currently lacking effective therapeutic options (26–29). Further supporting this observation is our in vivo AR42J model, characterized by average EB-TATE SUV_max of 15.16 ± 4.34 in the tumor tissue, that responded to therapy with ¹⁷⁷Lu-EB-TATE with a significant reduction in tumor size and extended survival. In contrast, FTC133 in vivo model with a low radiolabeled analogue SUV_max of 4.8 ± 0.27 did not respond to PRRT.

Currently, there are a few small-scale studies showing promising results for the treatment of patients with RAI non-avid thyroid cancer with radiolabeled SST analogues (30–32). In a study of 16 patients with RAI non-avid progressive thyroid cancer (eight DTCs and eight MTCs), treatment with ⁹⁰Yttrium (⁹⁰Y)- and/or ¹⁷⁷Lu-labeled DOTA-TATE resulted in mean overall survival (OS) of 4.2 years (95% confidence interval, 2.9–5.5) and median PFS of 25 months after initial PRRT (30). Versari and colleagues documented positive ⁶⁸Ga-DOTA-TOC uptake in 24 of 41 patients with progressive RAI-negative DTC and 11 patients treated with PRRT (⁹⁰Y-DOTA-TOC), showing an objective response rate of 63% with a response duration of 3.5–11.5 months (32). However, PRRT utilizing ⁹⁰Y has been associated with nephrotoxicity, which could be decreased by utilizing ¹⁷⁷Lu for radiolabeling (33). In contrary to these studies, ¹⁷⁷Lu-DOTA-TATE therapy of 5 patients with radioiodine-refractory DTC showed heterogeneous response despite good ⁶⁸Ga-DOTA-TATE uptake in the pretherapeutic PET scan (34). In our study, we showed that only a subset of patients with thyroid cancer had high uptake of radiolabeled SST analogues and may potentially benefit from PRRT. Therefore, we investigated potential ways to upregulate SSTR2 in preclinical models and tested SST analogues characterized by different binding capacities and pharmacokinetics.

SSTR2 expression has been shown to be regulated by epigenetic modulators (21, 35–38). We screened three epigenetic regulators of SSTR2 expression and utilized the most potent among them—HDAC inhibitor, valproic acid, which is commonly used for the treatment of epilepsy and shown to have an excellent safety profile (39). We showed that valproic acid increases SSTR2 expression in thyroid cancer cell lines in vitro, which is associated with increased H3ac and H4ac at the SSTR2 promoter region. Unfortunately, we did not observe a significant valproic acid–induced increase in the uptake of SST analogues in vivo. Although valproic acid upregulated SSTR2 expression in the tumor tissues of the subcutaneous FTC133 and AR42J models, this increase in expression might be insufficient and characterized by a lack of increased localization of SSTR2 on the cell surface. In the future, it will be interesting to test more tumor-specific epigenetic regulators to improve SSTR2 expression on the cancer cell surface.

Our study is the first to test novel SST analogues, DOTA-EB-TATE and DOTA-JR11, in thyroid cancer, demonstrating that DOTA-EB-TATE is a superior SST agonist. We compared the SUV of the three analogues in each mouse serving as their own control and observed that DOTA-EB-TATE was characterized by enhanced SUV compared with DOTA-TATE and DOTA-JR11. We also compared the therapeutic efficacy of ¹⁷⁷Lu-labeled DOTA-TATE, DOTA-JR11, and DOTA-EB-TATE, documenting the superiority of the latter in the mouse model characterized by high SSTR2 expression. There are several studies that suggested the superiority of SST antagonists over SST agonists (16, 40, 41). In our study, no significant difference was observed in the uptake of octreotate (TATE agonist) versus JR11 (antagonist) linked to the same chelator (DOTA) in the tested mice models. However, attachment of Evans blue moiety to octreotate improved the uptake significantly. The addition of Evans blue moiety to the octreotate significantly improved its pharmacokinetics, as indicated by the increased half-life in the blood, lower clearance rate, and better tumor-to-organ uptake ratio (13, 14). In a recent study performed on 33 patients with metastatic neuroendocrine tumors, ¹⁷⁷Lu-DOTA-EB-TATE was observed to be more effective than similar dose of ¹⁷⁷Lu-DOTA-TATE (42). However, the study endpoint was a change in SUV before and after treatment, so there was no data on the effects on standardized hard endpoints, such as response rate by RECIST criteria, PFS, and OS. A possible concern regarding the use of DOTA-EB-TATE is that its enhanced binding to the albumin, and slow clearance rate will not only expose the tumor tissues, but also the healthy organs to the higher radiation doses. A study analyzing the safety profile of this agent reported that in comparison with ¹⁷⁷Lu-DOTA-TATE, the effective dose of ¹⁷⁷Lu-DOTA-EB-TATE was significantly higher in the kidneys and red bone marrow of the patients with metastatic neuroendocrine tumor (14). Although the small-scale pilot studies performed on patients with metastatic neuroendocrine tumors showed that ¹⁷⁷Lu-DOTA-EB-TATE is well tolerated by the patients at low doses without causing any significant hematotoxicity or nephrotoxicity (42, 43), more studies are necessary to understand the short- and long-term toxicity profile of this agent.

The major strength of our study is its translational relevance, as therapeutic efficacy of PRRT has been proven only for the model characterized by a high SSTR2 analogues uptake. It suggests that the tumors characterized by a high SUV_max, within 15.16 ± 4.34 range, may respond to PRRT using ¹⁷⁷Lu-DOTA-EB-TATE, while the uptake within SUV_max of 4.8 ± 0.27 is likely not going to translate into clinical efficacy.

Our study had a few limitations. We utilized non-thyroid cancer AR42J xenografts to model a high SUV of SST analogues, resembling SUV_max observed in our clinical trial in patients with HTC, as all screened thyroid cancer cell lines were characterized by low-to-moderate uptake of SST analogues in vivo. Nonetheless, testing radiolabeled SST analogues in models with differential SSTR2 expression levels revealed that the therapeutic efficacy of PRRT is achieved only in tumors with high SST analogues uptake.

In conclusion, our preclinical data document that DOTA-EB-TATE is a superior analogue over DOTA-TATE and DOTA-JR11 for the imaging and treatment of SSTR2-high–expressing tumors. A high ⁶⁸Ga-DOTA-TATE uptake observed in metastatic HTC makes these patients, who lack alternative treatment options, ideal candidates for PRRT. Our study forms a basis for a clinical trial testing the diagnostic and therapeutic efficacy of ¹⁷⁷Lu-DOTA-EB-TATE in patients with tumors characterized by high SST analogue uptake.

O. Jacobson reports a patent for chemical conjugates of Evans blue derivatives and their use as radiotherapy and imaging agents licensed and with royalties paid from E-150-2016-0-US-01. X. Chen reports a patent for WO2017196806A1 pending, licensed, and with royalties paid from Molecular Targeted Therapeutics, Inc. No disclosures were reported by the other authors.

S. Thakur: Conceptualization, data curation, formal analysis, investigation, methodology, writing-original draft, writing-review and editing. B. Daley: Data curation, investigation, writing-review and editing. C. Millo: Data curation, software, formal analysis, writing-review and editing. C. Cochran: Resources, writing-review and editing. O. Jacobson: Data curation, software, formal analysis, methodology, writing-review and editing. H. Lu: Methodology, writing-review and editing. Z. Wang: Methodology, writing-review and editing. D. Kiesewetter: Resources, writing-review and editing. X. Chen: Resources, writing-review and editing. V. Vasko: Data curation, formal analysis, methodology, writing-review and editing. J. Klubo-Gwiezdzinska: Conceptualization, resources, data curation, formal analysis, supervision, funding acquisition, investigation, visualization, methodology, writing-original draft, project administration, writing-review and editing.

This work was supported by NIH/NIDDK Intramural funding ZIA DK 07513803. We thank our patients for participation in the study. We thank IPSEN for providing DOTA-JR11 for the animal studies. Special thanks to Dr. Peter Herscovitch, Chief of Positron Emission Tomography for supporting the clinical part of the study. Special thanks to Drs. Hongxiu Luo and Shirisha Avadhanula for seeing and coordinating care for a subset of study participants. Special thanks to flow cytometry core facility, National Heart, Lung, and Blood Institute, NIH for their help with flow cytometer experiments. We thank Drs. Lee S. Weinstein and Sunita Agarwal for a critical review of the article. We thank Sungyoung Auh for the statistical analysis of the data in relation to a reviewer's comment.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.