Purpose: One third of ER-positive breast cancer patients who initially respond to endocrine therapy become resistant to treatment. Such treatment failure is associated with poor prognosis and remains an area of unmet clinical need. Here, we identify a specific posttranslational modification that occurs during endocrine resistance and which results in tumor susceptibility to the apoptosis-inducer TRAIL. This potentially offers a novel stratified approach to targeting endocrine-resistant breast cancer.

Experimental Design: Cell line and primary-derived xenograft models of endocrine resistance were investigated for susceptibility to TRAIL. Tumor viability, cancer stem cell (CSC) viability (tumorspheres), tumor growth kinetics, and metastatic burden were assessed. Western blots for the TRAIL-pathway inhibitor, c-FLIP, and upstream regulators were performed. Results were confirmed in primary culture of 26 endocrine-resistant and endocrine-naïve breast tumors.

Results: Breast cancer cell lines with acquired resistance to tamoxifen (TAMR) or faslodex were more sensitive to TRAIL than their endocrine-sensitive controls. Moreover, TRAIL eliminated CSC-like activity in TAMR cells, resulting in prolonged remission of xenografts in vivo. In primary culture, TRAIL significantly depleted CSCs in 85% endocrine-resistant, compared with 8% endocrine-naïve, tumors, whereas systemic administration of TRAIL in endocrine-resistant patient-derived xenografts reduced tumor growth, CSC-like activity, and metastases. Acquired TRAIL sensitivity correlated with a reduction in intracellular levels of c-FLIP, and an increase in Jnk-mediated phosphorylation of E3-ligase, ITCH, which degrades c-FLIP.

Conclusions: These results identify a novel mechanism of acquired vulnerability to an extrinsic cell death stimulus, in endocrine-resistant breast cancers, which has both therapeutic and prognostic potential. Clin Cancer Res; 24(10); 2452–63. ©2018 AACR.

Translational Relevance

Current options for breast cancer patients who relapse on endocrine therapy are limited and mostly rely on retargeting of endocrine pathways or nonspecific chemotherapy, neither of which addresses the molecular changes that occur during transition to drug resistance. Here, we identified one such acquired change, which resulted in endocrine-resistant tumors becoming sensitive to the proapoptotic effects of the targeted agent, TRAIL. Moreover, this acquired sensitivity was particularly acute in the cancer stem–like cell population, leading to long-term regression of tumors in vivo. Identification of the mechanism underlying this acquired sensitivity provides a companion predictive biomarker of this response. These data support future clinical investigation into the stratified use of TRAIL agonists for patients who develop resistance to endocrine therapy, a key area of clinical unmet need that affects more than 8 million breast cancer patients worldwide.

Over 70% of breast tumors express estrogen receptor (ER), and it is clear that estrogen itself plays a vital role in tumor development and progression (1). As a result, the nonsteroidal antiestrogen tamoxifen has provided improved survival and quality of life for many early and advanced ER+ve disease sufferers (2, 3).

Since the introduction of tamoxifen to the clinic nearly 30 years ago, further endocrine agents have been developed, notably the steroidal antiestrogen fulvestrant (Faslodex) that also promotes ER degradation (4), and aromatase inhibitors (AI) that suppress estrogen production in the body (5, 6). Although AIs are now the gold-standard endocrine strategy in the ER+ve postmenopausal setting (7), tamoxifen remains a pivotal treatment option in ER+ve premenopausal breast cancer patients with 67% of patients responding to tamoxifen as first-line therapy (8–10). Fulvestrant in turn can prove valuable under conditions where tamoxifen or AIs fail (11).

Unfortunately, a large proportion of patients acquire resistance to endocrine treatment following initial responsiveness, and this is associated with reinstigation of tumor growth and disease progression (12, 13). Thus, the majority of patients with advanced disease and up to 30% of ER+ve patients in the adjuvant setting will acquire resistance to the inhibitory effects of their endocrine treatment (12, 13). The acquisition of resistance manifests with a partial epithelial–mesenchymal transition (EMT) and increased migratory and invasive activity both in anti–estrogen-resistant cell line models (14) and in clinical samples (14–17). Furthermore, a subset of tumor-initiating cells with stem-like characteristics (cancer stem cells: CSCs) is enriched in tamoxifen-resistant breast cancers and may demonstrate resistance to endocrine therapies, thus contributing to disease recurrence and metastatic progression (18–21).

It has been suggested that ER expression remains a stable phenotype for many acquired resistance tumors that initially respond to endocrine agents (22) which is corroborated by data showing that a significant proportion of acquired resistance tumors remain sensitive to alternative endocrine treatment. However, as a therapeutic avenue this too has its limitations, as response to additional endocrine therapies declines over time while some patients also lose ER expression during endocrine treatment (23–25). In vitro and xenograft model studies have elucidated that endocrine agents upregulate various “compensatory” growth factor signaling pathways that sustain cell survival and residual proliferative activity, culminating in resistant growth (26, 27). A number of approaches have been examined in patients targeting such signaling mechanisms to overcome endocrine resistance (28); however, responses to such targeted approaches are short-lived for many patients (29, 30). Of these agents, CDK4/6 (palbociclib, ribociclib) and mTOR inhibitors (everolimus) have shown particular promise; however, toxicities associated with these therapies must be managed carefully and predictive biomarkers for response are currently being investigated to help in patient selection (31–33). There thus remains a critical need for superior treatments guided by predictive biomarkers with greater long-term benefits in the management of endocrine resistance in the clinic. TRAIL is an immune-related apoptotic protein that has been shown to specifically target cancer cells while sparing normal cells. Unfortunately, several studies have now shown that despite this cancer specificity, many tumor cell subtypes are inherently resistant to treatment with TRAIL agonists, with no improvement in overall survival rates in clinical trials (34). In breast cancer for example, epithelial-like ER-positive tumor cells are resistant to the proapoptotic effects of TRAIL, whereas cells with a mesenchymal phenotype, including CSCs within epithelial-like tumors, exhibit some sensitivity to TRAIL (35–37). Yet despite these observations, TRAIL agonists have not progressed well in the clinical setting (34, 38). Although tumor resistance has been largely attributed to poor agonist potency, it is probable that a scarcity of adequately stratified patient populations also partly contributes to resistance through a lack of understanding of the underlying mechanisms of resistance (39). The intrinsic TRAIL-mediated apoptosis inhibitor c-FLIP is believed to be one contributing factor behind TRAIL resistance of breast cancer cells as mesenchymal CSC and non-CSCs exhibit redistribution of c-FLIP (37), and removal of c-FLIP blockade hypersensitized both the bulk tumor cell population (40, 41) and breast CSCs to TRAIL in vitro and significantly reduced metastasis in in vivo models (36).

Given the evidence above that endocrine resistance was also associated with mesenchymal-like traits (including CSCs), we postulated that endocrine-resistant breast tumors may respond better to TRAIL therapy than their endocrine-naïve counterparts. If this were the case, we proposed that the increased TRAIL sensitivity may be mediated by c-FLIP. Here, we tested these hypotheses using in vitro and in vivo cell line models and clinical samples of acquired endocrine-resistant breast cancer. We showed that acquired endocrine-resistant breast cancer cell lines and their constituent CSC subpopulation were indeed sensitive to TRAIL treatment, and that this sensitivity correlated with the reduction of c-FLIP levels through a posttranslational mechanism. Furthermore, the TRAIL-mediated reduction in endocrine-resistant CSCs in vitro was replicated in vivo with a marked reduction in metastatic disease. These findings were supported by patient-derived breast cancer tissue models leading to the conclusion that the selective use of TRAIL agonists to target the CSC compartment in breast tumors that have acquired endocrine resistance may improve clinical outcome with potential long-term benefits to patients.

Cell culture

Parental breast cancer cell lines MCF-7ER+HER2- and T47DER+HER2- (obtained from the ATCC) were maintained in RPMI 1640 medium supplemented with 5% FBS, 1% penicillin—streptomycin, and 0.5% l-glutamine. Tamoxifen- and Faslodex-resistant subclones of these cell lines were derived as described (22, 42, 43) and maintained in phenol red–free RPMI 1640 supplemented with 5% FBS (charcoal stripped for MCF-7 derivatives), 1% penicillin–streptomycin, 0.5% l-glutamine, and 100 nmol/L of 4-OH-tamoxifen (Sigma) or fulvestrant (AstraZeneca).

siRNA

Small-interfering RNAs (siRNA) targeting two unique sequences in human c-FLIP (FLIPi—sense: GGAUAAAUCUGAUGUGUCCUCAUUA, antisense: UAAUGAGGACACAUCAGAUUUAUCC) and a nonspecific scrambled control (SCi—sense: GGACUAAUAGUUGUGCUCCAAUUUA, antisense: UAAAUUGGAGCACAACUAUUAGUCC) RNA were used in reverse transfections (Invitrogen). Cells were trypsinized and resuspended at a density of 1 × 105 and seeded into wells containing 20 μL of 100 nmol/L siRNA in serum-free Optimem (GIBCO) in a volume of 100 μL per well together with 0.3 μL of Lipofectamine (Invitrogen). Cells were cultured in the presence of siRNA for 48 hours prior to subsequent assay.

TRAIL treatment of target cells

Cells were treated with soluble human recombinant TRAIL (SuperKillerTRAIL; Enzo Life Sciences) at a concentration of 20 or 100 ng/mL for 18 hours at 37°C in 5% CO2.

Western blot assays

Western blots of cell lysates were performed as described (44). The following antibodies were used: c-FLIP (Enzo Life Sciences—7F10, ALX-8040428; Santa Cruz Biotechnology—5D8, sc-136160), ER-alpha (Santa Cruz Biotechnology; sc-7207), ErbB2 (Abcam; ab2428), GAPDH (Santa Cruz Biotechnology; sc365062), ITCH (AbCam; 99087), and pITCH (Millipore; 10050).

Cell viability and cell death assays

CellTiter blue cell viability assay (CTB; Promega) was performed according to the manufacturer's instructions in a 96-well plate format and fluorescence assessed using a ClarioStar (BMG Labtech) plate reader, whereas Invitrogen live/dead-labeled cells were stained for 15 minutes at 4°C in the dark and subsequently analyzed by flow cytometry (BD Accuri).

Primary-derived tumor cell processing and xenografts

Primary and local relapse human breast tumor pathologic and postsurgical core biopsies were obtained following consent from the Cardiff and Vale Breast Cancer Centre, Llandough Hospital under National Institute for Social Care and Health Research (NISCHR) ethical approval (12/WA/0252), and pleural effusions/ascitic fluid metastatic samples obtained through Manchester Cancer Research Center Biobank and The Christie NHS Foundation Trust (studies 12/ROCL/01, 05/Q1402/25, respectively). Cells were processed, maintained, and stored according to the Human Tissue Act with local (Cardiff University) research ethics approval. All animal xenograft procedures were performed in accordance with the Animals (Scientific Procedures) Act 1986 and approved by the UK Home Office (PPL 30/2849). Tumors excised from mice or received from patients were finely minced and then processed in a MACs tissue dissociator using a MACs tissue dissociation kit according to the manufacturer's protocol (Miltenyi Biotec). Primary cells were maintained in 5% CO2 and 5% O2 at 37°C. The patient-derived xenograft (PDX) models were generated either as previously described (45) or for the PDX 151 model, and 3 mm chunks of primary tumor material from a 72-year-old patient with local relapse previously receiving endocrine treatment (see Supplementary Fig. S4A) were serially passaged by subcutaneous implantation in JAXTM NOD.Cg-PrkdcscidIl2rgtm1Wj (NSG) mice.

Tumorsphere culture

Cell lines and primary tumor samples were initially treated in adherent culture conditions as described and then dissociated into single-cell suspensions and plated (P1) in ultralow attachment 96-well plates (Corning) at a density of 20,000 cells/mL in a serum-free epithelial growth medium (DMEM/F12; Gibco), supplemented with 2% B27 (Invitrogen), 55 μmol/L β-mercaptoethanol, 20 ng/mL EGF (Sigma), 5 μg/mL insulin (Sigma), and 1 μg/mL hydrocortisone. After 7 days, tumorspheres were collected by gentle centrifugation (300 x g), dissociated in 0.05% trypsin and 0.25% EDTA, and reseeded (P2) at 20,000 cells/mL for subsequent passages. %TFU was calculated by dividing the number of spheres formed by the total number of single cells seeded.

Fluorescent-activated cell sorting

The directly conjugated mouse FITC anti-CD24 antibody (BD; 555427), mouse allophycocyanin (APC) anti-CD44 antibody (BD; 559942), mouse APC anti-DR5 (biolegend; DjR2-4), and mouse FITC anti-DR4 (AbCam; ab59047) were used to stain single-cell suspensions at 4°C in the dark for 30 minutes. Control samples were stained with isotype-matched control antibodies, and samples were analyzed using BD Accuri flow cytometer.

Aldefluor assay

To measure ALDH activity, Aldefluor assay (Stem Cell Technologies) was performed on surviving cell populations as previously described (46). Briefly, dissociated single cells were suspended in assay buffer containing ALDH substrate, bodipyaminoacetaldehyde (BAAA), at 1.5 mmol/L and incubated for 45 minutes at 37°C. To distinguish between ALDH+ve and −ve cells, cells were also incubated under identical conditions in the presence of a 2-fold molar excess of the ALDH inhibitor, diethylaminobenzaldehyde (DEAB).

Xenograft assays of MCF-7-TAMR cells

Tumor initiation and growth were assessed by orthotopic mammary fat pad transplantation of dissociated MCF-7 and MCF-7-TAMR cells. Cells were harvested using 1 mmol/L EDTA, washed, and resuspended at a density of 5 × 106 in serum-free L15 media. A 1.5 mg, 90-day slow release 17-β estradiol or Tamoxifen pellet (Innovative Research of America) for parental and TAMR cells respectively was inserted subcutaneously above the right scapula of anesthetized NOD-SCID mice (Harlan). A total of 1 × 106 cells were orthotopically injected directly into the abdominal mammary fat pad, and when tumors reached 5 mm in diameter, the mice were treated with 16 mg/kg TRAIL (IP) daily for 4 days twice, separated by a 6-day treatment holiday. Mice were then monitored, and tumor volume was measured twice weekly. Metastatic tumor burden within lung tissue was then assessed histologically in serial hematoxylin and eosin sections.

RNA extraction and cDNA synthesis

Cultured cells were pelleted via centrifuge at 300 rcf for 5 minutes before being resuspended in 350 μL RLT buffer (Qiagen) and placed on ice for immediate extraction or frozen at −80°C for future extraction. RNA extraction was performed using the Qiagen RNEasy Kit following the manufacturer's instructions. The concentration and quality of RNA were analyzed using a nanodrop 3000 spectrophotometer (Thermo Scientific). Previously isolated RNA was synthesized into cDNA using the QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer's instructions.

Quantitative PCR

All qRT-PCR experiments were designed to include both target gene probe and ACTB control probe. For each experiment, TaqMan Universal Master Mix II, with UNG (ThermoFischer Scientific), was used. TaqMan master mix was added to target and ACTB control probes together with RNase free H2O to make individual target master mixes containing all reaction components and plated in 384-well qPCR plates (Applied Biosystems). Plates were then run on a QuantStudio 7 Real-Time PCR machine (Applied Biosystems) set to the following protocol: initial denaturation at 95°C for 10 minutes, followed by 40 cycles of 95°C for 15 seconds (denaturation), and 60°C for 1 minute (annealing/elongation). Relative quantity was determined using ΔΔCt values calculated from the reference sample.

Statistical methods

Data are represented as mean ± SEM for a minimum of three independent experiments, unless otherwise stated. Statistical significance between means was measured using parametric testing, assuming equal variance, by standard t test for two paired samples. The χ2 test was used to determine the significance of deviation from expected ratios of responders to nonresponders in the clinical cohort.

Acquired endocrine-resistant breast cancer cell lines develop hypersensitivity to TRAIL-induced cell death

The development of endocrine therapy resistance in primary breast cancer is associated with poor prognosis and, in cell line models and clinical samples of endocrine resistance, a transition to more aggressive tumor phenotypes that have undergone partial EMT (14–17). The cancer therapeutic TRAIL has been shown to preferentially induce cell death in breast cancer cell lines that exhibit a more mesenchymal phenotype (35). We wished to investigate therefore whether the adaptation to endocrine treatment also increased the sensitivity of breast cancer cells to TRAIL. Initially, four models of acquired endocrine resistance, derived from continuous endocrine treatment with tamoxifen or Faslodex of the luminal ER+ve breast cancer cell lines MCF-7 (42) and T47D (43), were investigated. Acquired tamoxifen-resistant (TAMR) and acquired Faslodex-resistant (FASR) cell lines were significantly more sensitive to the cytotoxic effects of TRAIL than their parental controls. (Fig. 1A and B; Supplementary Fig. S1A). Sensitivity was particularly prominent in the TAMR derivatives. The gain in TRAIL sensitivity was then confirmed in an independent MCF-7–derived tamoxifen-resistant model (ref. 20; Supplementary Fig. S1B). This marked susceptibility to TRAIL could not be explained by the combinatorial effect of TRAIL with either endocrine agent and was a feature confined to the resistant state, as the combination of tamoxifen or Faslodex with TRAIL treatment on the previously untreated MCF-7 cells (cotreated) or on cells pretreated with these endocrine agents for up to 7 days (pretreatment) did not confer TRAIL sensitivity (Fig. 1C). Furthermore, tamoxifen withdrawal (TAMR-W) for 7 days prior to TRAIL treatment also had no effect on the sensitivity of TAMR cells to TRAIL (Fig. 1D). Combined, these results suggested that the substantially increased TAMR sensitivity to TRAIL was due to a stable adaptation resulting from acquired resistance to tamoxifen.

TRAIL treatment of acquired endocrine-resistant cells targets CSC-like traits in vitro

According to the CSC hypothesis, a drug-resistant subpopulation of stem/progenitor-like tumor cells is likely to contribute to promotion of resistance to conventional therapies (18, 21, 47, 48). To determine if these cells demonstrated a comparable sensitivity to TRAIL to the bulk cell cultures in the acquired endocrine-resistant lines, the effect of TRAIL on stem-like activity was assessed by tumorsphere assay, whereas cancer stem/progenitor cell numbers were measured using cell surface markers and ALDEFLUOR assay. Both the MCF-7–derived TAMR and FASR cell lines exhibited an increased capacity to form tumorspheres, which were similar in morphology and size to their parental MCF-7 cell line. However, in contrast to the parental line, these self-renewing tumorsphere-forming cells were significantly more sensitive to TRAIL, with a complete ablation of tumorsphere-forming units (TFU) and colony-forming units in the TAMR cells following treatment with TRAIL (Fig. 2A and B; Supplementary Fig. S2C). Furthermore, this TRAIL sensitivity was independent of the presence of tamoxifen in the media (Fig. 2C), implying that the hypersensitization to TRAIL was inherent to the acquired endocrine (tamoxifen) resistance phenotype. The effect of TRAIL on the CSC compartment in the TAMR line was further supported by flow cytometry using surrogate markers of stem/progenitor cells. Both CD44HiCD24Lo and ALDH+ve subpopulations were significantly elevated in tamoxifen-resistant cell lines and yet remained sensitive to TRAIL-mediated apoptosis (Fig. 2D), although TRAIL failed to further deplete the CD44 population in TAMR cells. A significant reduction in CSC-like activity was also observed in a second cell line model of acquired tamoxifen resistance (T47D-derived). Although the sensitivity to TRAIL was not as profound, TRAIL-treated TAMR cells were still significantly reduced compared with their TRAIL-treated parental counterparts (Supplementary Fig. S2A and S2B) with a 50% reduction in tumorsphere-forming capacity and a 4-fold reduction in CD44+ve cells in T47D-TAMR cells following TRAIL treatment. In summary, these data suggest that sensitivity of breast cancer stem–like cells to TRAIL develops following the acquisition of resistance to antiestrogens, most acutely with tamoxifen resistance.

Systemic TRAIL administration results in long-term regression of TAMR tumors in vivo

In order to determine if the TRAIL-mediated reduction in overall cell viability and CSC-like properties in vitro was reflected in tumor growth in vivo, mice bearing established MCF-7 parental or TAMR orthotopic tumors of approximately 5 mm in diameter were subjected to eight i.p. injections of TRAIL over a period of 2 weeks and then monitored for tumor response. Along with the previously observed elevation in CSC-like and proliferative activity of TAMR cells in vitro (Fig. 2B), orthotopic TAMR tumors were found to be more aggressive than parental MCF-7 controls under vehicle control conditions, with an elevated growth rate and appearance of spontaneous metastases to the lung (Fig. 2E and F). MCF-7 tumors responded transiently to TRAIL treatment (20% reduction in tumor volume) but, within 2 weeks of treatment, had regained similar growth kinetics to the vehicle-treated cohort (Fig. 2E). Treatment of TAMR tumors with TRAIL on the other hand resulted in a complete (100%) and sustained regression of all tumors (n = 8) for up to 15 weeks (Fig. 2E). Furthermore, following TRAIL treatment, both the number and size of TAMR metastatic lesions in the lungs were decreased by more than 95% (Fig. 2F), correlating with the profound decrease in CSC-like activity observed in vitro (Fig. 2B). Taken together, these data suggested that tamoxifen-resistant cell response to TRAIL in vivo correlated with the observed in vitro responses whereby tumor regression occurred by debulking tumor mass, and in turn, metastatic tumor burden and tumor relapse were significantly reduced through the elimination of the cancer stem/progenitor pool.

Clinical samples from multiple endocrine drug-resistant patients exhibit TRAIL sensitivity

Having seen clear benefits of TRAIL treatment in cell line models of antiestrogen resistance in vitro and in vivo, the efficacy of TRAIL on endocrine-resistant breast cancer was determined in clinical samples ex vivo. Primary cell cultures were derived from pleural effusions or ascites of 13 patients with advanced ER+ve breast cancer, 11 having received endocrine treatment and 2 endocrine-naïve samples (Supplementary Fig. S3A). Cells were plated into tumorsphere culture prior to treatment with TRAIL ex vivo (Fig. 3A). Nine of 11 (82%) of the clinical samples from the advanced metastatic endocrine-resistant patients exhibited a significant reduction in TFUs following treatment with TRAIL (Fig. 3A), whereas neither of the endocrine-naïve metastatic patient samples (90 and 94) responded to TRAIL. Similarly, 7 of 8 (88%) of the endocrine-resistant patient samples cultured as an adherent monolayer were also sensitive to TRAIL, with only 1 of the 2 endocrine-naïve samples exhibiting a significant response to TRAIL (Supplementary Fig. S3B).

A similar relationship was observed in primary cell cultures derived from 13 fresh core biopsies of local relapse ER-positive breast cancer (Fig. 3A). Of two tumor biopsies originating from patients who had relapsed following treatment with tamoxifen (samples 127 and 188), both demonstrated a significant reduction in tumorsphere-forming capacity, whereas only 1 of 11 (9%) of endocrine treatment-naïve primary tumors exhibited such a response to TRAIL.

Overall, 11 of 13 samples (85%) from all clinical groups that had relapsed following endocrine treatment responded to TRAIL ex vivo, compared with just 1 of 13 tumors that had not previously seen endocrine therapy (Fig. 3A–C). Taken together, the findings from these ex vivo models provide preclinical evidence that TRAIL may be valuable in controlling endocrine-resistant breast cancers and potentially provide long-term benefits by targeting the CSC subset.

In vivo PDX models of endocrine-resistant breast cancer demonstrate sensitivity to TRAIL administration

The potential for TRAIL as a further therapeutic option following acquisition of endocrine resistance was subsequently tested in vivo using two distinct PDX models of endocrine-resistant breast cancer.

For the first PDX model, a primary ER-positive tumor was maintained orthotopically by serially passaging in immunocompromised mice receiving either estradiol (MaCa 3366) or tamoxifen (MaCa 3366 TAMR) for up to 3 years, generating estradiol-dependent and tamoxifen-resistant models, respectively, from the same parental tumor tissue (45). Mice were subjected to systemic administration of 8 i.p. injections of TRAIL over 2 weeks (treatment windows highlighted in pink, Fig. 4) and tumor growth kinetics monitored from the beginning of treatment (100 mm3). In the tamoxifen-sensitive estrogen-dependent control tumors, systemic in vivo TRAIL treatment failed to elicit a significant growth-inhibitory response compared with vehicle only (Fig. 4A). There was also no alteration in the CSC compartment within the tumors (Fig. 4A). In contrast, a transient (10 day) yet significant regression of MaCa 3366 TAMR tumors was observed following first TRAIL administration, compared with a doubling in tumor volume in the vehicle control arm over the same time period, which after a second dose of TRAIL culminated in a sustained and significant reduction in tumor size at 4 weeks compared with untreated controls (P = 0.0045; Fig. 4B). Thus, although TRAIL-treated naïve 3,366 tumors exhibited a 4-fold increase in tumor volume over 4 weeks, TRAIL-treated endocrine-resistant tumors exhibited a 1.8-fold increase over the same time period (Fig. 4A and B). Furthermore, consistent with observations in our cell line models of tamoxifen resistance, there was a significantly higher basal level of CSC-like cells in MaCa 3366 TAMR tumors compared with its endocrine-responsive, estrogen-dependent, counterpart, and TRAIL treatment in vivo significantly depleted the CSC-like activity in the tamoxifen-resistant model (Fig. 4B), whereas no significant difference was observed in the endocrine-sensitive model. In addition, tumorspheres generated from the TRAIL-treated MaCa 3366-TAMR tumors also maintained their sensitivity to TRAIL when treated ex vivo, demonstrating that the tumorsphere-forming subset surviving in vivo TRAIL administration was not a consequence of acquired TRAIL resistance (Supplementary Fig. S4B).

For the second PDX model, a core biopsy (CUbbs 151) obtained from a locally relapsed ER-negative tumor from an ER-positive (original status prior to endocrine treatment) breast cancer patient who had relapsed on the AI anastrazole was used to propagate tumors in recipient immunocompromised mice to model AI-resistant breast cancer (histopathologically characterized in Supplementary Fig. S4A). AIs have become the gold-standard first-line therapy for the majority of postmenopausal ER-positive breast cancer patients, and many of the endocrine-resistant clinical samples used in this study (Fig. 3) had at some point in their treatment received an AI (Supplementary Fig. S3A). In order to determine AI-resistant breast cancer sensitivity to TRAIL, mice bearing CUbbs 151 tumors (PDX 151) were administrated 8 i.p. injections of TRAIL over 2 weeks. This resulted in a significant reduction in AI-resistant tumor growth compared with vehicle control (Fig. 4C), and ex vivo control PDX 151 tumor cells also demonstrated significant sensitivity of CSC-like cells to treatment with TRAIL (Fig. 4D). Furthermore, the sensitivity of PDX 151 CSCs ex vivo was consistent with the sensitivity of the patient biopsy (CUbbs 151) treated ex vivo prior to transplantation (i.e., original biopsy straight from the patient; Supplementary Fig. S4C). This was paralleled by a profound reduction in both the number and size of spontaneous lung metastases in vivo (Fig. 4E), adding additional confirmation that the CSC-like compartment within these tumors was particularly sensitive to TRAIL treatment.

c-FLIP degradation via Jnk activation leads to the observed sensitivity of tamoxifen-resistant breast cancer cells

In order to elucidate the underlying cause of the TRAIL hypersensitivity gained both in endocrine-resistant breast cancer cell lines and clinical tumors, key cellular components of TRAIL-mediated cytotoxicity were assessed by Western blot and fluorescent-activated cell sorting analysis in the TAMR and FASR cell lines. These included the TRAIL receptors DR4 and DR5 and the endogenous TRAIL-receptor complex inhibitor c-FLIP, all of which have been shown to influence TRAIL sensitivity in other cancer cell types (49–52). Comparative levels of DR4 and DR5 cell surface receptor expression did not reflect the relative sensitivity of each cell line to TRAIL (Supplementary Fig. S5A). The relative protein levels of the TRAIL pathway inhibitor, c-FLIP (55 kDa isoform identified with two independent antibodies), however, were found to be lower in TAMR cells compared with parental MCF-7 cells (Fig. 5A). Similarly, c-FLIP protein levels were also significantly reduced in TAMR and FASR derivatives of the T47D cell line (Fig. 5A). This reduction in c-FLIP protein levels is attributed to posttranscription regulation of c-FLIP, as no correlation between c-FLIP mRNA levels in either the cell lines or the primary samples tested correlated with TRAIL response (Supplementary Fig. S5B).

Previously, a Jnk-mediated degradation of c-FLIP via the E3 ubiquitin ligase ITCH has been described to explain regulation of c-FLIP protein in primary mouse cells (ref. 53; Supplementary Fig. S5C). Accordingly, phosphorylated ITCH (pITCH) was upregulated in MCF-7– and T47D-derived TAMR and FASR cells (Fig. 5A) compared with parental controls with no parallel increase in total ITCH levels. The proposed link between Jnk and suppressed c-FLIP levels was confirmed by pretreatment of the MCF-7–derived TAMR cells with the Jnk inhibitor SP600125, which after 4-hour exposure partially rescued TAMR cell and endocrine-resistant primary sample viability in the presence of TRAIL (Fig. 5B; Supplementary Fig. S5D; Supplementary Fig. S5E). Furthermore, Jnk inhibition decreased ITCH activation (reduced phospho-ITCH levels) and subsequently restored c-FLIP protein expression of TAMR cells to parental MCF-7 levels (Fig. 5C).

Similarly, untreated MaCa 3366-TAMR tumors exhibited a significantly lower level of c-FLIP protein expression and increased ITCH and pITCH expression compared with its endocrine-sensitive, estrogen-dependent control (Fig. 5D). Western blot analysis of 8 of the advanced metastatic endocrine-resistant clinical samples ex vivo with varying TRAIL response was performed in order to determine if the mechanism of sensitivity in these primary cells was consistent with that of the endocrine-resistant cell lines (Fig. 5E). The activation (phosphorylation) of ITCH and relative c-FLIP levels were subsequently determined by densitometry normalized to GAPDH controls. The activation of ITCH and c-FLIP protein levels were inversely correlated such that increased activation of ITCH in endocrine-resistant samples correlated with a reduction in c-FLIP levels, and, when averaged, cells sensitive to TRAIL had significantly lower levels of c-FLIP and higher levels of ITCH activation (Fig. 5F; Supplementary Fig. S5F). In addition, reduction of c-FLIP protein levels and increased ITCH activation correlated with response to TRAIL (Fig. 5F; Supplementary Fig. S3B). Furthermore, the advanced metastatic endocrine-resistant clinical sample with the lowest activation of ITCH (sample 81, Fig. 5E) and the sample with the highest level of c-FLIP protein (sample 29, Fig. 5E), both of which demonstrated no significant response to TRAIL under adherent conditions, could be substantially sensitized to TRAIL by siRNA inhibition of c-FLIP, supporting the role for c-FLIP in TRAIL sensitivity (Fig. 5G; Supplementary Fig. S5G and S5H). Finally, the endocrine-naïve, TRAIL-resistant, clinical sample 90 could also be sensitized to TRAIL by siRNA suppression of c-FLIP (Fig. 5H; Supplementary Fig. S5I). These data demonstrate that the activation of ITCH and reduction of c-FLIP is one potential mechanism of hypersensitivity of endocrine-resistant clinical samples ex vivo.

There is a clear unmet need for alternative treatments for patients who relapse on endocrine therapy. Relapse rates are high, and following multiple lines of endocrine therapy, there is higher risk of metastasis and poorer overall survival with limited treatment options.

Here, we demonstrate that acquired endocrine-resistant breast cancer cells gain sensitivity to TRAIL treatment compared with their endocrine-responsive parental counterparts. This appears to manifest following the acquisition of resistance and is a stable sensitivity, as administration of endocrine agents in ER-responsive cells does not increase response to TRAIL.

Although other changes in signaling pathways have been identified as a consequence of endocrine resistance—such as EGFR/HER2, MAPK, CDK4/6, mTOR, and Src (54–59)—the data reported here represent to our knowledge the first demonstration of a sensitization to a single agent targeting a proapoptotic pathway. Previous studies have demonstrated increased Jnk signaling following the long-term acquisition of resistance to endocrine therapies (12, 60). Here, we demonstrate that one consequence of this Jnk activation is the ITCH-dependent destabilization of c-FLIP protein, which correlates with TRAIL sensitivity both in cell line models in vitro and in clinical samples ex vivo.

Previously, modest outcomes in phase II clinical trials of TRAIL agonists in terms of overall survival have been partly attributed to the lack of potency of existing TRAIL receptor agonists (34); however, it could also be postulated that a lack of stratification and suitable biomarkers for response also contributes to the poor results seen to date. The data presented here suggest that acquired resistance to endocrine therapy could represent a key subgroup of patients that might exhibit improved responses to TRAIL agonists and that monitoring of c-FLIP, pITCH, and/or p-Jnk levels in tumors could further potentiate the selection process by identifying at least a proportion of TRAIL-responsive tumors. Further exploration of these molecular markers by immunohistochemical analysis of pathologic samples with access to fresh tissue material would be required to determine if these could be used as predictive biomarkers of TRAIL response.

We recently reported that TRAIL can selectively target the CSC-like cells in breast cancer cell lines in vitro following suppression of c-FLIP. Here, we demonstrate that acquired endocrine resistance potentiates sensitivity of the CSC-like compartment to TRAIL in primary-derived breast cancer samples, and that this significantly correlates with a reduction in c-FLIP levels. These observations are particularly significant given that CSCs have been demonstrated to evade conventional chemotherapy agents and potentially endocrine agents, either due to cell quiescence, through the prevention of drug uptake or modulation of intracellular signaling (18, 21, 61–63). Targeted therapies that initiate cell death through cell surface receptors circumvent these resistance mechanisms and therefore may prove to be a more effective strategy for targeting CSCs (64–66). Indeed, this was confirmed in xenograft models of endocrine-resistant tumors, whereby systemic TRAIL treatment resulted in a profound suppression of tumor recurrence (Figs. 2 and 4) and a marked decrease in spontaneous metastasis (Figs. 2F and 4E). Interestingly, response to TRAIL was observed regardless of cellular ER status. In vitro models of TAMR maintain ER positivity following acquisition of resistance, and active ER signaling remains important in cell proliferation. Similarly, MaCa 3366 also maintains ER positivity following acquisition of resistance; however, FASR cell lines and PDX 151 do not maintain their ER positivity. Despite these important differences in cellular signaling, all these models demonstrated sensitivity to TRAIL treatment in vitro and in vivo. Taken together, these data have important implications for potential long-term survival benefit patients who ultimately relapse on any form of endocrine therapy.

Previous studies have proposed that the acquisition of endocrine resistance is accompanied by the appearance of mesenchymal-like properties, which might also explain the increased risk of metastatic disease. This was the premise on which we initially tested for TRAIL sensitivity in endocrine-resistant breast cancer cells, as TRAIL had previously been shown to selectively target breast cancer cell types with a mesenchymal-like phenotype (35). The question still remains as to whether a partial EMT sufficiently explains the strong correlation between endocrine resistance and TRAIL sensitivity in clinical samples observed here. Further studies into the mechanism of Jnk activation and the role of EMT-like processes in TRAIL sensitivity will help elucidate its relationship with acquired endocrine resistance.

In summary, we have shown that acquired endocrine resistance confers sensitivity of breast cancer cells and particularly breast CSCs to TRAIL-mediated apoptosis. These data support further investigation into the selective use of TRAIL agonists as a subsequent treatment for ER+ve patients who relapse on endocrine therapy regardless of their ER status following relapse.

P. Barrett-Lee reports receiving remuneration from Roche Products Ltd. J. Gee reports receiving commercial research grants from AstraZeneca. No potential conflicts of interest were disclosed by the other authors.

Conception and design: L. Piggott, T. Robinson, C. Morris, R. Clarkson

Development of methodology: L. Piggott, I. Fichtner, L. Andera, C. Morris, P. Barrett-Lee, R. Clarkson

Acquisition of data (provided animals, acquired and managed patients, provided facilities, etc.): L. Piggott, A. Silva, T. Robinson, A. Santiago-Gómez, B.M. Simões, M. Becker, P. Young, C. Morris, P. Barrett-Lee, F. Alchami, M. Piva, M.dM. Vivanco, R.B. Clarke, J. Gee

Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): L. Piggott, A. Silva, T. Robinson, A. Santiago-Gómez, B.M. Simões, M. Becker, M. Piva, M.dM. Vivanco, R. Clarkson

Writing, review, and/or revision of the manuscript: L. Piggott, A. Silva, T. Robinson, A. Santiago-Gómez, B.M. Simões, L. Andera, C. Morris, P. Barrett-Lee, F. Alchami, R.B. Clarke, J. Gee, R. Clarkson

Administrative, technical, or material support (i.e., reporting or organizing data, constructing databases): L. Piggott, A. Silva, I. Fichtner, C. Morris, F. Alchami

Study supervision: L. Piggott, P. Barrett-Lee, R. Clarkson

The authors acknowledge the patients and their families for their participation in this study. We acknowledge the infrastructure support from Wales Cancer Bank (www.walescancerbank.com) for the collection of patient samples and Professor Sacha Howell (The Christie NHS Foundation Trust) for access to pleural effusion patient samples.

This study was funded by Breast Cancer Now (charity no. 1160558). A. Silva was supported by Tenovus Cancer Care funding (charity no. 1054015).

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Anderson
E
. 
Progesterone receptors – animal models and cell signaling in breast cancer: the role of oestrogen and progesterone receptors in human mammary development and tumorigenesis
.
Breast Cancer Res
2002
;
4
:
197
201
.
2.
Early Breast Cancer Trialists' Collaborative Group (EBCTCG)
. 
Effects of chemotherapy and hormonal therapy for early breast cancer on recurrence and 15-year survival: an overview of the randomised trials
.
Lancet Lond Engl
2005
;
365
:
1687
717
.
3.
Jaiyesimi
IA
,
Buzdar
AU
,
Decker
DA
,
Hortobagyi
GN
. 
Use of tamoxifen for breast cancer: twenty-eight years later
.
J Clin Oncol
1995
;
13
:
513
29
.
4.
Wakeling
AE
,
Dukes
M
,
Bowler
J
. 
A potent specific pure antiestrogen with clinical potential
.
Cancer Res
1991
;
51
:
3867
73
.
5.
Osborne
CK
. 
Aromatase inhibitors in relation to other forms of endocrine therapy for breast cancer
.
Endocr Relat Cancer
1999
;
6
:
271
6
.
6.
Johnston
SJ
,
Cheung
KL
. 
Fulvestrant - a novel endocrine therapy for breast cancer
.
Curr Med Chem
2010
;
17
:
902
14
.
7.
Buzdar
AU
. 
Aromatase inhibitors in breast cancer therapy
.
Clin Breast Cancer
2003
;
4
:
S84
8
.
8.
Arpino
G
,
Weiss
H
,
Lee
AV
,
Schiff
R
,
De Placido
S
,
Osborne
CK
, et al
Estrogen receptor-positive, progesterone receptor-negative breast cancer: association with growth factor receptor expression and tamoxifen resistance
.
J Natl Cancer Inst
2005
;
97
:
1254
61
.
9.
Rakha
EA
,
El-Sayed
ME
,
Green
AR
,
Paish
EC
,
Powe
DG
,
Gee
J
, et al
Biologic and clinical characteristics of breast cancer with single hormone receptor–positive phenotype
.
J Clin Oncol
2007
;
25
:
4772
8
.
10.
Osborne
CK
,
Schiff
R
,
Arpino
G
,
Lee
AS
,
Hilsenbeck
VG
. 
Endocrine responsiveness: understanding how progesterone receptor can be used to select endocrine therapy
.
Breast Edinb Scotl
2005
;
14
:
458
65
.
11.
Johnston
S
. 
Fulvestrant and the sequential endocrine cascade for advanced breast cancer
.
Br J Cancer
2004
;
90
:
S15
8
.
12.
Musgrove
EA
,
Sutherland
RL
. 
Biological determinants of endocrine resistance in breast cancer
.
Nat Rev Cancer
2009
;
9
:
631
43
.
13.
Schiff
R
,
Massarweh
S
,
Shou
J
,
Osborne
CK
. 
Breast cancer endocrine resistance: how growth factor signaling and estrogen receptor coregulators modulate response
.
Clin Cancer Res
2003
;
9
:
447S
54S
.
14.
Hiscox
S
,
Jiang
WG
,
Obermeier
K
,
Taylor
K
,
Morgan
L
,
Burmi
R
, et al
Tamoxifen resistance in MCF7 cells promotes EMT-like behaviour and involves modulation of beta-catenin phosphorylation
.
Int J Cancer
2006
;
118
:
290
301
.
15.
Yuan
J
,
Liu
M
,
Yang
L
,
Tu
G
,
Zhu
Q
,
Chen
M
, et al
Acquisition of epithelial-mesenchymal transition phenotype in the tamoxifen-resistant breast cancer cell: a new role for G protein-coupled estrogen receptor in mediating tamoxifen resistance through cancer-associated fibroblast-derived fibronectin and β1-integrin signaling pathway in tumor cells
.
Breast Cancer Res
2015
;
17
:
69
.
16.
Işeri
OD
,
Kars
MD
,
Arpaci
F
,
Atalay
C
,
Pak
I
,
Gündüz
U
. 
Drug resistant MCF-7 cells exhibit epithelial-mesenchymal transition gene expression pattern
.
Biomed Pharmacother
2011
;
65
:
40
5
.
17.
Al Saleh
S
,
Al Mulla
F
,
Luqmani
YA
. 
Estrogen receptor silencing induces epithelial to mesenchymal transition in human breast cancer cells
.
PLoS One
2011
;
6
:
e20610
.
18.
O'Brien
CS
,
Farnie
G
,
Howell
SJ
,
Clarke
RB
. 
Breast cancer stem cells and their role in resistance to endocrine therapy
.
Horm Cancer
2011
;
2
:
91
103
.
19.
Sansone
P
,
Ceccarelli
C
,
Berishaj
M
,
Chang
Q
,
Rajasekhar
VK
,
Perna
F
, et al
Self-renewal of CD133(hi) cells by IL6/Notch3 signalling regulates endocrine resistance in metastatic breast cancer
.
Nat Commun
2016
;
7
:
10442
.
20.
Piva
M
,
Domenici
G
,
Iriondo
O
,
Rábano
M
,
Simões
BM
,
Comaills
V
, et al
Sox2 promotes tamoxifen resistance in breast cancer cells
.
EMBO Mol Med
2014
;
6
:
66
79
.
21.
Simões
BM
,
O'Brien
CS
,
Eyre
R
,
Silva
A
,
Yu
L
,
Sarmiento-Castro
A
, et al
anti-estrogen resistance in human breast tumors is driven by JAG1-NOTCH4-dependent cancer stem cell activity
.
Cell Rep
2015
;
12
:
1968
77
.
22.
Staka
CM
,
Nicholson
RI
,
Gee
JMW
. 
Acquired resistance to oestrogen deprivation: role for growth factor signalling kinases/oestrogen receptor cross-talk revealed in new MCF-7X model
.
Endocr Relat Cancer
2005
;
12
:
S85
97
.
23.
Johnston
SR
,
Saccani-Jotti
G
,
Smith
IE
,
Salter
J
,
Newby
J
,
Coppen
M
, et al
Changes in estrogen receptor, progesterone receptor, and pS2 expression in tamoxifen-resistant human breast cancer
.
Cancer Res
1995
;
55
:
3331
8
.
24.
Kuukasjärvi
T
,
Kononen
J
,
Helin
H
,
Holli
K
,
Isola
J
. 
Loss of estrogen receptor in recurrent breast cancer is associated with poor response to endocrine therapy
.
J Clin Oncol
1996
;
14
:
2584
9
.
25.
Osborne
CK
,
Fuqua
SAW
. 
Mechanisms of tamoxifen resistance
.
Breast Cancer Res Treat
1994
;
32
:
49
55
.
26.
Zhao
M
,
Ramaswamy
B
. 
Mechanisms and therapeutic advances in the management of endocrine-resistant breast cancer
.
World J Clin Oncol
2014
;
5
:
248
62
.
27.
Osborne
CK
,
Schiff
R
. 
Mechanisms of endocrine resistance in breast cancer
.
Annu Rev Med
2011
;
62
:
233
47
.
28.
Johnston
SRD
. 
Enhancing the efficacy of hormonal agents with selected targeted agents
.
Clin Breast Cancer
2009
;
9
:
S28
36
.
29.
Baselga
J
,
Campone
M
,
Piccart
M
,
Burris
HA
,
Rugo
HS
,
Sahmoud
T
, et al
Everolimus in postmenopausal hormone-receptor-positive advanced breast cancer
.
N Engl J Med
2012
;
366
:
520
9
.
30.
Piccart
M
,
Hortobagyi
GN
,
Campone
M
,
Pritchard
KI
,
Lebrun
F
,
Ito
Y
, et al
Everolimus plus exemestane for hormone-receptor-positive, human epidermal growth factor receptor-2-negative advanced breast cancer: overall survival results from BOLERO-2†
.
Ann Oncol
2014
;
25
:
2357
62
.
31.
Almstedt
K
,
Schmidt
M
. 
Targeted therapies overcoming endocrine resistance in hormone receptor-positive breast cancer
.
Breast Care
2015
;
10
:
168
72
.
32.
Finn
RS
,
Crown
JP
,
Lang
I
,
Boer
K
,
Bondarenko
IM
,
Kulyk
SO
, et al
The cyclin-dependent kinase 4/6 inhibitor palbociclib in combination with letrozole versus letrozole alone as first-line treatment of oestrogen receptor-positive, HER2-negative, advanced breast cancer (PALOMA-1/TRIO-18): a randomised phase 2 study
.
Lancet Oncol
2015
;
16
:
25
35
.
33.
Liu
C-Y
,
Wu
C-Y
,
Petrossian
K
,
Huang
T-T
,
Tseng
L-M
,
Chen
S
. 
Treatment for the endocrine resistant breast cancer: current options and future perspectives
.
J Steroid Biochem Mol Biol
2017
;
172
:
166
75
.
34.
Holland
PM
. 
Death receptor agonist therapies for cancer, which is the right TRAIL?
Cytokine Growth Factor Rev
2014
;
25
:
185
93
.
35.
Rahman
M
,
Davis
SR
,
Pumphrey
JG
,
Bao
J
,
Nau
MM
,
Meltzer
PS
, et al
TRAIL induces apoptosis in triple-negative breast cancer cells with a mesenchymal phenotype
.
Breast Cancer Res Treat
2009
;
113
:
217
30
.
36.
Piggott
L
,
Omidvar
N
,
Martí Pérez
S
,
French
R
,
Eberl
M
,
Clarkson
RWE
. 
Suppression of apoptosis inhibitor c-FLIP selectively eliminates breast cancer stem cell activity in response to the anti-cancer agent, TRAIL
.
Breast Cancer Res
2011
;
13
:
R88
.
37.
French
R
,
Hayward
O
,
Jones
S
,
Yang
W
,
Clarkson
R
. 
Cytoplasmic levels of cFLIP determine a broad susceptibility of breast cancer stem/progenitor-like cells to TRAIL
.
Mol Cancer
2015
;
14
:
209
.
38.
de Miguel
D
,
Lemke
J
,
Anel
A
,
Walczak
H
,
Martinez-Lostao
L
. 
Onto better TRAILs for cancer treatment
.
Cell Death Differ
2016
;
23
:
733
47
.
39.
Lemke
J
,
von Karstedt
S
,
Zinngrebe
J
,
Walczak
H
. 
Getting TRAIL back on track for cancer therapy
.
Cell Death Differ
2014
;
21
:
1350
64
.
40.
Palacios
C
,
Yerbes
R
,
López-Rivas
A
. 
Flavopiridol induces cellular FLICE-inhibitory protein degradation by the proteasome and promotes TRAIL-induced early signaling and apoptosis in breast tumor cells
.
Cancer Res
2006
;
66
:
8858
69
.
41.
Day
TW
,
Huang
S
,
Safa
AR
. 
c-FLIP knockdown induces ligand-independent DR5-, FADD-, caspase-8-, and caspase-9-dependent apoptosis in breast cancer cells
.
Biochem Pharmacol
2008
;
76
:
1694
704
.
42.
Knowlden
JM
,
Hutcheson
IR
,
Jones
HE
,
Madden
T
,
Gee
JMW
,
Harper
ME
, et al
Elevated levels of epidermal growth factor receptor/c-erbB2 heterodimers mediate an autocrine growth regulatory pathway in tamoxifen-resistant MCF-7 cells
.
Endocrinology
2003
;
144
:
1032
44
.
43.
Jordan
NJ
,
Dutkowski
CM
,
Barrow
D
,
Mottram
HJ
,
Hutcheson
IR
,
Nicholson
RI
, et al
Impact of dual mTORC1/2 mTOR kinase inhibitor AZD8055 on acquired endocrine resistance in breast cancer in vitro
.
Breast Cancer Res
2014
;
16
:
R12
.
44.
Tiffen
PG
,
Omidvar
N
,
Marquez-Almuina
N
,
Croston
D
,
Watson
CJ
,
Clarkson
RWE
. 
A dual role for oncostatin M signaling in the differentiation and death of mammary epithelial cells in vivo
.
Mol Endocrinol
2008
;
22
:
2677
88
.
45.
Naundorf
H
,
Becker
M
,
Lykkesfeldt
AE
,
Elbe
B
,
Neumann
C
,
Büttner
B
, et al
Development and characterization of a tamoxifen-resistant breast carcinoma xenograft
.
Br J Cancer
2000
;
82
:
1844
50
.
46.
Korkaya
H
,
Paulson
A
,
Iovino
F
,
Wicha
MS
. 
HER2 regulates the mammary stem/progenitor cell population driving tumorigenesis and invasion
.
Oncogene
2008
;
27
:
6120
30
.
47.
Meacham
CE
,
Morrison
SJ
. 
Tumour heterogeneity and cancer cell plasticity
.
Nature
2013
;
501
:
328
37
.
48.
Chen
J
,
Li
Y
,
Yu
T-S
,
McKay
RM
,
Burns
DK
,
Kernie
SG
, et al
A restricted cell population propagates glioblastoma growth after chemotherapy
.
Nature
2012
;
488
:
522
6
.
49.
Mitsiades
CS
,
Treon
SP
,
Mitsiades
N
,
Shima
Y
,
Richardson
P
,
Schlossman
R
, et al
TRAIL/Apo2L ligand selectively induces apoptosis and overcomes drug resistance in multiple myeloma: therapeutic applications
.
Blood
2001
;
98
:
795
804
.
50.
van Geelen
CM
,
Pennarun
B
,
Le
PT
,
de Vries
EG
,
de Jong
S
. 
Modulation of TRAIL resistance in colon carcinoma cells: different contributions of DR4 and DR5
.
BMC Cancer
2011
;
11
:
39
.
51.
Wu
GS
. 
TRAIL as a target in anti-cancer therapy
.
Cancer Lett
2009
;
285
:
1
5
.
52.
Ashkenazi
A
,
Herbst
RS
. 
To kill a tumor cell: the potential of proapoptotic receptor agonists
.
J Clin Invest
2008
;
118
:
1979
90
.
53.
Chang
L
,
Kamata
H
,
Solinas
G
,
Luo
J-L
,
Maeda
S
,
Venuprasad
K
, et al
The E3 ubiquitin ligase itch couples JNK activation to TNFalpha-induced cell death by inducing c-FLIP(L) turnover
.
Cell
2006
;
124
:
601
13
.
54.
Gee
JMW
,
Nicholson
RI
,
Barrow
D
,
Dutkowski
CM
,
Goddard
L
,
Jordan
NJ
, et al
Antihormone induced compensatory signalling in breast cancer: an adverse event in the development of endocrine resistance
.
Horm Mol Biol Clin Investig
2011
;
5
:
67
77
.
55.
Morgan
L
,
Gee
J
,
Pumford
S
,
Farrow
L
,
Finlay
P
,
Robertson
J
, et al
Elevated Src kinase activity attenuates tamoxifen response in vitro and is associated with poor prognosis clinically
.
Cancer Biol Ther
2009
;
8
:
1550
8
.
56.
Drury
SC
,
Detre
S
,
Leary
A
,
Salter
J
,
Reis-Filho
J
,
Barbashina
V
, et al
Changes in breast cancer biomarkers in the IGF1R/PI3K pathway in recurrent breast cancer after tamoxifen treatment
.
Endocr Relat Cancer
2011
;
18
:
565
77
.
57.
Shou
J
,
Massarweh
S
,
Osborne
CK
,
Wakeling
AE
,
Ali
S
,
Weiss
H
, et al
Mechanisms of tamoxifen resistance: increased estrogen receptor-HER2/neu cross-talk in ER/HER2-positive breast cancer
.
J Natl Cancer Inst
2004
;
96
:
926
35
.
58.
Miller
TW
,
Balko
JM
,
Arteaga
CL
. 
Phosphatidylinositol 3-kinase and antiestrogen resistance in breast cancer
.
J Clin Oncol
2011
;
29
:
4452
61
.
59.
Kato
S
,
Endoh
H
,
Masuhiro
Y
,
Kitamoto
T
,
Uchiyama
S
,
Sasaki
H
, et al
Activation of the estrogen receptor through phosphorylation by mitogen-activated protein kinase
.
Science
1995
;
270
:
1491
4
.
60.
Shou
J
,
Wong
J
,
Weigel
N
,
Osborne
CK
,
Schiff
R
. 
JNK and p38 MAP kinases potentially contribute to tamoxifen resistance of breast cancer via direct phosphorylation of both estrogen receptor and AIB1 coactivator
.
Eur J Cancer
2002
;
38
:
S159
.
61.
Patel
P
,
Chen
E
. 
Cancer stem cells, tumor dormancy, and metastasis
.
Front Endocrinol
2012
;
3
.
62.
Cojoc
M
,
Mäbert
K
,
Muders
MH
,
Dubrovska
A
. 
A role for cancer stem cells in therapy resistance: cellular and molecular mechanisms
.
Semin Cancer Biol
2015
;
31
:
16
27
.
63.
Huang
R
,
Wang
G
,
Song
Y
,
Tang
Q
,
You
Q
,
Liu
Z
, et al
Colorectal cancer stem cell and chemoresistant colorectal cancer cell phenotypes and increased sensitivity to Notch pathway inhibitor
.
Mol Med Rep
2015
;
12
:
2417
24
.
64.
Marangoni
E
,
Lecomte
N
,
Durand
L
,
de Pinieux
G
,
Decaudin
D
,
Chomienne
C
, et al
CD44 targeting reduces tumour growth and prevents post-chemotherapy relapse of human breast cancers xenografts
.
Br J Cancer
2009
;
100
:
918
22
.
65.
Harrison
H
,
Farnie
G
,
Howell
SJ
,
Rock
RE
,
Stylianou
S
,
Brennan
KR
, et al
Regulation of breast cancer stem cell activity by signaling through the Notch4 receptor
.
Cancer Res
2010
;
70
:
709
18
.
66.
Li
Y
,
Maitah
MY
,
Ahmad
A
,
Kong
D
,
Bao
B
,
Sarkar
FH
. 
Targeting the Hedgehog signaling pathway for cancer therapy
.
Expert Opin Ther Targets
2012
;
16
:
49
66
.