Background: Sequence variants located at 15q25 have been associated with lung cancer and propensity to smoke. We recently reported an association between rs16969968 and risk of upper aerodigestive tract (UADT) cancers (oral cavity, oropharynx, hypopharynx, larynx, and esophagus) in women (OR = 1.24, P = 0.003) with little effect in men (OR = 1.04, P = 0.35).

Methods: In a coordinated genotyping study within the International Head and Neck Cancer Epidemiology (INHANCE) consortium, we have sought to replicate these findings in an additional 4,604 cases and 6,239 controls from 10 independent UADT cancer case–control studies.

Results: rs16969968 was again associated with UADT cancers in women (OR = 1.21, 95% CI = 1.08–1.36, P = 0.001) and a similar lack of observed effect in men [OR = 1.02, 95% CI = 0.95–1.09, P = 0.66; P-heterogeneity (Phet) = 0.01]. In a pooled analysis of the original and current studies, totaling 8,572 UADT cancer cases and 11,558 controls, the association was observed among females (OR = 1.22, 95% CI = 1.12–1.34, P = 7 × 10−6) but not males (OR = 1.02, 95% CI = 0.97–1.08, P = 0.35; Phet = 6 × 10−4). There was little evidence for a sex

difference in the association between this variant and cigarettes smoked per day, with male and female rs16969968 variant carriers smoking approximately the same amount more in the 11,991 ever smokers in the pooled analysis of the 14 studies (Phet = 0.86).

Conclusions: This study has confirmed a sex difference in the association between the 15q25 variant rs16969968 and UADT cancers.

Impact: Further research is warranted to elucidate the mechanisms underlying these observations. Cancer Epidemiol Biomarkers Prev; 20(4); 658–64. ©2011 AACR.

Exposure to alcohol and tobacco are the major risk factors for upper aerodigestive tract (UADT) cancers (cancers of the oral cavity, oropharynx, hypopharynx, larynx, and esophagus) in Europe and America (1).

Common genetic variants located at chromosome 15q25, a locus that contains 3 genes that encode nicotinic acetylcholine receptor (nAChR) subunits (CHRNA5, CHRNA3, and CHRNB4), have been implicated in the risk of lung cancer, chronic obstructive pulmonary disease (COPD) and peripheral arterial disease (2–5). The same variants are associated with increased propensity to smoke tobacco (4, 6, 7), leading to the hypothesis that this might explain the associations noted with pathologies linked to tobacco exposure (4, 8). Others have suggested that these variants may have additional independent effects (2, 5, 9–11). In a recent study of 3,968 UADT cancer cases and 5,319 controls (10), we observed that there was statistically significant association between 15q25 variant rs16969968 and risk of UADT cancers in women (OR = 1.24, 95% CI = 1.08–1.42, P = 0.003) but not men [OR = 1.04, 95% CI = 0.96–1.12, P = 0.35; P-heterogeneity (Phet) = 0.03]. In the present study, we sought to validate these findings in an independent series of 4,604 UADT cancer cases and 6,239 controls from 10 UADT cancer case–control studies participating in the International Head and Neck Cancer Epidemiology (INHANCE) consortium (12).

Study subjects

Ten independent case–control studies of UADT cancers from INHANCE consortium (7 were conducted in America and 3 in Europe) participated in our present study. Study designs and population characteristics have been described in more detail previously (12–15) and are briefly described in Table 1 and Supplementary Table S1. All the subjects included in the pooled analysis were of self-reported European ancestry. As previously described (12), all INHANCE studies have extensive information on tumor site and histology, as well as lifestyle characteristics. The majority of hospital-based studies excluded controls with tobacco-related pathologies as a control source (13–15). The exceptions were the Penn State, Rome, MD Anderson, and Pittsburgh studies that did not exclude tobacco-related pathologies specifically. Written informed consent was obtained from all study subjects and studies were approved by the Institutional Review Boards at each study center. Analysis was restricted to squamous cell carcinomas.

Table 1.

Selected demographic characteristics of study subjects

Combined seriesWomenMen
CasesControlsCasesControlsCasesControls
n%n%n%n%n%n%
Age group             
 <50 1,624 18.95 2,039 17.64 343 17.26 573 17.18 1,281 19.45 1,466 17.83 
 50 to <60 2,867 33.45 3,838 33.21 571 28.74 1,049 31.45 2,296 34.87 2,789 33.92 
 60 to <70 2,591 30.23 3,413 29.53 600 30.20 942 28.25 1,991 30.24 2,471 30.05 
 ≥70 1,490 17.38 2,268 19.62 473 23.80 771 23.12 1,017 15.44 1,497 18.21 
Cancer site             
 Oral cavity 1,968 22.96   605 30.45   1,363 20.70   
 Oropharynx 1,930 22.52   398 20.03   1,532 23.26   
 Hypopharynx 440 5.13   57 2.87   383 5.82   
 Larynx 2,773 32.35   534 26.87   2,239 34.00   
 Esophagus 401 4.68   88 4.43   313 4.75   
 Othersa 870 10.15   232 11.68   638 9.69   
 Missing 190 2.22   73 3.67   117 1.78   
Smoking status             
 Never smokers 1,093 12.75 3,810 32.96 456 22.95 1,605 48.13 637 9.67 2,205 26.82 
 Former smokers 1,965 22.92 3,501 30.29 428 21.54 712 21.35 1,537 23.34 2,789 33.92 
 Current smokers 4,562 53.22 2,827 24.46 919 46.25 602 18.05 3,643 55.32 2,225 27.06 
 Former or current smokers 539 6.29 393 3.40 112 5.64 80 2.40 427 6.48 313 3.81 
 Missing 413 4.82 1,027 8.89 72 3.62 336 10.07 341 5.18 691 8.40 
Alcohol consumption             
 Never drinkers 884 10.31 1,953 16.90 486 24.46 995 29.84 398 6.04 958 11.65 
 Ever drinkers 7,173 83.68 8,282 71.66 1,346 67.74 1,928 57.81 5,827 88.49 6,354 77.27 
 Missing 515 6.01 1,323 11.45 155 7.80 412 12.35 360 5.47 911 11.08 
Total 8,572  11,558  1,987  3,335  6,585  8,223  
Combined seriesWomenMen
CasesControlsCasesControlsCasesControls
n%n%n%n%n%n%
Age group             
 <50 1,624 18.95 2,039 17.64 343 17.26 573 17.18 1,281 19.45 1,466 17.83 
 50 to <60 2,867 33.45 3,838 33.21 571 28.74 1,049 31.45 2,296 34.87 2,789 33.92 
 60 to <70 2,591 30.23 3,413 29.53 600 30.20 942 28.25 1,991 30.24 2,471 30.05 
 ≥70 1,490 17.38 2,268 19.62 473 23.80 771 23.12 1,017 15.44 1,497 18.21 
Cancer site             
 Oral cavity 1,968 22.96   605 30.45   1,363 20.70   
 Oropharynx 1,930 22.52   398 20.03   1,532 23.26   
 Hypopharynx 440 5.13   57 2.87   383 5.82   
 Larynx 2,773 32.35   534 26.87   2,239 34.00   
 Esophagus 401 4.68   88 4.43   313 4.75   
 Othersa 870 10.15   232 11.68   638 9.69   
 Missing 190 2.22   73 3.67   117 1.78   
Smoking status             
 Never smokers 1,093 12.75 3,810 32.96 456 22.95 1,605 48.13 637 9.67 2,205 26.82 
 Former smokers 1,965 22.92 3,501 30.29 428 21.54 712 21.35 1,537 23.34 2,789 33.92 
 Current smokers 4,562 53.22 2,827 24.46 919 46.25 602 18.05 3,643 55.32 2,225 27.06 
 Former or current smokers 539 6.29 393 3.40 112 5.64 80 2.40 427 6.48 313 3.81 
 Missing 413 4.82 1,027 8.89 72 3.62 336 10.07 341 5.18 691 8.40 
Alcohol consumption             
 Never drinkers 884 10.31 1,953 16.90 486 24.46 995 29.84 398 6.04 958 11.65 
 Ever drinkers 7,173 83.68 8,282 71.66 1,346 67.74 1,928 57.81 5,827 88.49 6,354 77.27 
 Missing 515 6.01 1,323 11.45 155 7.80 412 12.35 360 5.47 911 11.08 
Total 8,572  11,558  1,987  3,335  6,585  8,223  

aOther cancer sites included oral/pharynx cancer, not otherwise specified, or overlapping head and neck cancer.

Genotyping and quality control

Genotyping of the 15q25 variant, rs16969968, was carried out in 8 genotyping laboratories (Supplementary Table S1) using the TaqMan genotyping platform (rs16969968 Taqman assay primers GAGTGGTAGTGGACCAAAATCTTCT and ACCTCACGGACATCATTTTCCTT probes VIC-MGB-CTGCGCTCAATTC, FAM-MGB-CTGCGCTCGATTC). A common series of 90 standard DNAs were genotyped at each laboratory to ensure the quality and comparability of the genotyping results across the different studies. The overall concordance with the consensus genotype and the genotypes from the 8 laboratories for the standardized DNAs was 99.86%. Genotype success rate was greater than 95.87% across each site and genotype distributions were consistent with that expected by Hardy–Weinberg equilibrium (HWE).

Statistical analysis

The association between rs16969968 and UADT cancer risk was estimated by ORs and 95% CIs per allele (under log-additive model) and genotype derived from multivariate unconditional logistic regression, with age, sex, and study site (or country when appropriate) included in the model as covariates. Heterogeneity of ORs was assessed using the Cochran's Q test. The association between the rs16969968 variant allele and number of cigarettes smoked per day (CPD) was carried out in ever smokers using multivariate linear regression on log-transformed data. Mean values and 95% CIs were calculated in the combined initial and present data sets with adjustment for age, sex, and study site (and case–control status when appropriate). Differential effect of this single nucleotide polymorphism (SNP) on CPD between sexes was evaluated in a linear regression analysis by including a genotype by sex interaction term.