Somatic variants in TET2 and DNMT3A are founding mutations in hematological malignancies that affect the epigenetic regulation of DNA methylation. Mutations in both genes often co-occur with activating mutations in genes encoding oncogenic tyrosine kinases such as FLT3ITD, BCR-ABL1, JAK2V617F, and MPLW515L, or with mutations affecting related signaling pathways such as NRASG12D and CALRdel52. Here, we show that TET2 and DNMT3A mutations exert divergent roles in regulating DNA repair activities in leukemia cells expressing these oncogenes. Malignant TET2-deficient cells displayed downregulation of BRCA1 and LIG4, resulting in reduced activity of BRCA1/2-mediated homologous recombination (HR) and DNA-PK–mediated non-homologous end-joining (D-NHEJ), respectively. TET2-deficient cells relied on PARP1-mediated alternative NHEJ (Alt-NHEJ) for protection from the toxic effects of spontaneous and drug-induced DNA double-strand breaks. Conversely, DNMT3A-deficient cells favored HR/D-NHEJ owing to downregulation of PARP1 and reduction of Alt-NHEJ. Consequently, malignant TET2-deficient cells were sensitive to PARP inhibitor (PARPi) treatment in vitro and in vivo, whereas DNMT3A-deficient cells were resistant. Disruption of TET2 dioxygenase activity or TET2—Wilms' tumor 1 (WT1)–binding ability was responsible for DNA repair defects and sensitivity to PARPi associated with TET2 deficiency. Moreover, mutation or deletion of WT1 mimicked the effect of TET2 mutation on DSB repair activity and sensitivity to PARPi. Collectively, these findings reveal that TET2 and WT1 mutations may serve as biomarkers of synthetic lethality triggered by PARPi, which should be explored therapeutically.

Significance:

TET2 and DNMT3A mutations affect distinct DNA repair mechanisms and govern the differential sensitivities of oncogenic tyrosine kinase–positive malignant hematopoietic cells to PARP inhibitors.

Oncogenic tyrosine kinases (OTK) are found in many types of neoplasms, including hematopoietic malignancies (1). For example, mutations in FLT3 and MPL cell membrane tyrosine kinases (e.g., FLT3ITD/TKD and MPLW515L), in ABL1 nuclear/cytoplasmic tyrosine kinase (e.g., BCR-ABL1) and in JAK2 cytoplasmic tyrosine kinase (e.g., JAK2V617F) are associated with numerous hematological malignancies, such as acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL), chronic myeloid leukemia (CML), and myeloproliferative neoplasms (MPN). Standard treatment for these malignancies includes chemotherapy and/or targeted approaches with selective tyrosine kinase inhibitors (TKi). With the exception of CML in chronic phase, complete remissions are uncommon in TKi-treated patients, and after an initial response, diseases often progress to a more aggressive stage. There is an urgent need for new therapies that could improve the therapeutic outcome of patients with hematological malignancies driven by OTKs.

Previous reports (2–7) demonstrate that OTK-positive cells accumulate high levels of spontaneous and drug-induced DNA double-strand breaks (DSB) in comparison with normal cells, but survive because of enhanced/altered DNA repair activities (8). Therefore, survival of OTK-positive cells depends on efficient repair of DSBs, the most lethal DNA lesions. DSBs are usually repaired by BRCA1/2-dependent homologous recombination (HR; key proteins: BRCA1, BRCA2, PALB2, RAD54, and RAD51), DNA-PK–mediated non-homologous end-joining (D-NHEJ; key proteins: DNA-PKcs, Ku70, Ku80, and LIG4), and PARP1-dependent alternative NHEJ (Alt-NHEJ; key proteins: PARP1, LIG3), which often serves as a backup DSB repair pathway (9).

The clinical success of the PARP inhibitor (PARPi) olaparib in BRCA1/2-mutated breast and ovarian cancers has established proof-of-concept for precision medicine in HR-deficient neoplasms by synthetic lethality (10). Although OTK-positive cancer cells survive in spite of increased DSB repair activity, TKi-treated cells specifically display HR and/or D-NHEJ deficiencies that sensitize malignant hematopoietic cells to synthetic lethality triggered by PARPi (3, 6, 11). Intriguingly, reports from our laboratory (3, 6) and others (12–14) suggest that the types of mutations co-occurring with OTKs strongly influence DNA repair in these cells and the sensitivity to PARPi.

Somatic mutations in TET2 (ten-eleven translocation 2) and DNMT3A [DNA (cytosine-5)-methyltransferase 3A] are common in age-related clonal hematopoiesis and are frequently detected in hematological malignancies (15). Most variants in both genes are point mutations that lead to loss of function. Although the proteins antagonistically regulate the epigenetic mark of 5-methylcytosine (5-mC), where DNMT3A catalyzes addition of 5-mC (16) whereas TET2 oxidizes 5-mC as a first step in DNA demethylation (17), mutations in both genes appear in a similar spectrum of human hematopoietic malignancies and occur with common cooperating mutations, including OTKs. Moreover, although the mutations exert divergent effect on primitive hematopoietic progenitor cells (18), they lead to similar disease phenotypes, suggesting the roles of these mutations in hematopoietic malignancies may relate to mechanisms outside of DNA methylation.

The potential role of TET2 and DNMT3A mutations in DNA damage response (DDR) of hematopoietic malignancies was highlighted by the observation that loss of TET2 in AML reduced their sensitivity to AraC by altering the dynamics of transition between differentiated and stem-like states (19), and that AML with DNMT3A mutations displayed impaired sensitivity to anthracycline treatment due to their inability to sense and repair the drug-induced DNA torsional stress (20).

Here, we report that mutations in TET2 and DNMT3A exert opposite effects on the sensitivity of OTK-transformed hematopoietic cells to PARPi; with TET2 mutations sensitizing malignant cells to PARPi, whereas DNMT3A mutations were associated with resistance. Moreover, in cells carrying DNMT3A mutations, the inactivation of TET2 overcomes PARPi resistance. The sensitivity of TET2-mutant cells to PARPi was dependent on the disruption of TET2 interaction with the Wilms' tumor 1 (WT1) protein. Our observations suggest that certain combinations of co-occurring mutations with OTKs influence distinct DNA repair mechanisms and govern the differential sensitivities of OTK-positive leukemia cells to PARPi.

Primary human AML samples

AML samples (see Supplementary Table S1) were from the ECOG-ACRIN E1900 clinical trial (21), from Leukemia Tissue Bank, Princess Margaret Hospital, Ontario Cancer Institute, Toronto, Canada, from Mayo Clinic, Rochester, MN, University of Bologna, Bologna, Italy and from the Department of Internal Medicine I, Division of Hematology and Hemostaseology, Medical University of Vienna, Austria. The investigators obtained informed written consent from the subjects.

Genetically modified mice

The Institutional Animal Care and Use Committee at Washington University approved all animal procedures. Dnmt3afl/fl (22), Tet2fl/fl (23), and Parp1−/− (11) mice were crossed to Flt3ITD (24) and Vav-Cre (25) strains as described previously (18) to generate mice used for experiments. The following primers were used for genotyping: Vav-Cre-AGATGCCAGGACATCAGGAACCT and ATCAGCCACACCAGACACAGAGATC; Tet2fl-AAGAATTGCTACAGGCCTGC and TTCTTTAGCCCTTGCTGAGC; Flt3ITD-common TCTGGTTCCATCCATCTTCC, wild-type AGGAAGTCGATGTTGGCACT and mutant CTTCGTATAATGTATGCTATACG; Dnmt3afl-ATCACATTACCTTTGTCCTCCCAGATCCAG and AGGCTGTCTGCATCGGACAGTGAGTGGTG, and Parp1-common CATGTTCGATGGGAAAGTCCC, wild-type CCAGCGCAGCTCAGAGAAGCCA, and mutant AGGTGAGATGACAGGAGATC. Flt3m/m;Wt1+/− (Flt3ITD;Wt1+/−) mice were described previously (26). To verify efficiency of deletion of Dnmt3a floxed alleles, the following primers were used: Dnmt3a_loxForward CTGTGGCATCTCAGGGTGATGAGCA, Dnmt3a_1loxReverse TGAGTGGTGAGGCCCAGCTTATCGA, Dnmt3a_2loxReverse AAGCCTCAGGCCCTCTAGGCAAGAT using Phusion polymerase as previously described (27).

Ectopic expression constructs

Murine Tet2 catalytic domain (mTet2-CD) and enzymatically inactive mTet2-CDCM mutant (H1295Y+D1297A) and human hTET2-CD were obtained from Dr. Yue Xiong, University of North Carolina at Chapel Hill, Chapel Hill, NC (28). hTET2-CDA1505T mutant was generated using QuikChange II XL site-directed mutagenesis kit from (Agilent Technologies, #200521) according to the manufacturer's instructions. hTET2-CD and hTET2-CDA1505T were cloned into the custom-built lentiviral vector pLVX-CMV-flag-IRES-mRFP1 (VectorBuilder Inc.). mTet2-CD and mTet2-CDCM were re-cloned into MIGR1 retroviral plasmid.

Viral infections

HEK 293T/17 cells (ATCC CRL-11268, validated by the ATCC) were used no longer than 4 weeks after thawing and were not tested for Mycoplasma. Retroviruses were prepared by cotransfecting HEK 293T/17 cells in a 10-cm plate with 10 μg of packaging pCL-ECO plasmid (Addgene #12371) and 10 μg MIGR1-based vectors by using Lipofectamine 2000 Transfection Reagent (Invitrogen) according to the manufacturer's protocol. Lentiviruses were generated by cotransfection of HEK 293T/17 cells with 10 μg of pLVX-CMV-hTet2(CD)-flag-IRES-mRFP1–based vectors, and 10 μg packaging pCMV delta R8.2 plasmid (Addgene #12263) and envelope pVSV-G plasmid (Clontech, #PT3343–5). Viruses were harvested 40 and 64 hours after the transfection and filtered through a 0.45-μm PES filter (Millipore). For infection, 5 × 105 cells were suspended in 1 mL of virus-containing medium with 6 μg/mL polybrene (Sigma). GFP+ and RFP+ cells were sorted 48 hours after the initial infection.

CRISPR/Cas9 targeting

Briefly, guide RNAs (gRNA) targeting murine Tet2 and Dnmt3a were generated using CRISPR Design (Supplementary Table S2) and cloned into the lentiCRISPRv2 vector. The lentiCRISPRv2 vector with a gRNA insert, the packaging plasmid psPAX2, and the envelope plasmid VSVG were mixed together and packed in HEK293T/17 cells using Fugene 6. Lentiviruses were harvested at 48 and 72 hours, respectively. FLT3ITD-positive 32Dcl3 cells [described before (3) and authenticated by Western blot detecting constitutively active FLT3ITD kinase] were used for up to 4 weeks after thawing and were not tested for Mycoplasma. Cells were infected with freshly collected CRISPR-Cas9-gRNA lentivirus supplemented with 8 μg/mL polybrene (Sigma-Aldrich) for 48 hours. Infected cells were selected in media with puromycin (1 μg/mL) for up to 14 days. Single clones were harvested from methylcellulose and successful mutation of infected clones was confirmed with T7E1 assay. To identify the mutations, the PCR products were sequenced by Sanger sequencing. The primers used for Sanger sequencing are listed in Supplementary Table S2. Downregulation of TET2 and/or DNMT3A proteins was detected by Western blot.

Western blot

Nuclear and total cell lysates were obtained as described before (29) and analyzed by SDS-PAGE using primary antibodies against: TET2 (Cell Signaling Technology #45010), DNMT3A (R&D Systems, MAB63151 and Cell Signaling #2160), ATM (Santa Cruz Biotechnology #sc-135663), 53BP1 (Abcam #ab-21083), CtIP (ThermoFisher Scientific #PA5–20963), SLFN11 (Abcam #ab121731), BRCA1 (EMD Millipore #OP92–100UG), BRCA2 (Abcam #ab75335), PALB2 (ThermoFisher Scientific #PA5–20796), RAD51 (Santa Cruz Biotechnology #sc-8349), RAD52 (Santa Cruz Biotechnology #sc-365341), RAD54 (Santa Cruz Biotechnology #sc-374598), DNA-PKcs (Bethyl #A300–518A), DNA ligase 4 (Santa Cruz Biotechnology #sc-271299), Ku80 (ThermoFisher Scientific #MA5–15873), Ku70 (Santa Cruz Biotechnology #sc-17789), PARP1 (Santa Cruz Biotechnology #sc-74470), PARP2 (Abgent #AP12265a), PARP3 (Abgent #AP6296b), DNA ligase 3 (Santa Cruz Biotechnology #sc-135883), Flag (Cell Signaling Technology #2368), lamin B (Abcam #ab-16048–100), and β-actin (Santa Cruz Biotechnology #sc-47778) and the following secondary antibodies conjugated to HRP (horseradish peroxidase): goat anti-rabbit (EMD Millipore #12–348) and goat anti-mouse (EMD Millipore #AP181P).

5hmC dot-blot

Genomic DNA was isolated using the DNeasy Blood Tissue Kit (Qiagen #69506), run in the Bio-Dot SF Microfiltration Apparatus (Bio-Rad #170–6542), cross-linked to Zeta-Probe Blotting Membrane (Bio-Rad # 1620153) and blotted with anti-5hmC primary antibody (Active Motif # 39791) followed by secondary HRP-conjugated goat anti-rabbit HRP-conjugated antibody (EMD Millipore #12–348).

Inhibitors/compounds

PARPi olaparib and talazoparib, FLT3i quizartinib, JAK1/2i ruxolitinib, doxorubicin and hydroxyurea were from Selleckchem. 2-hydroxyglutarate (2-HG) was purchased from Cayman Chemical [(2R)-Octyl-α-hydroxyglutarate-d17] and Toronto Research Chemicals [(2S)-2-Hydroxyglutaric Acid Octyl Ester Sodium Salt and (2R)-2-Hydroxyglutaric Acid Octyl Ester Sodium Salt, mixed 1:1]. Vitamin C (L-ascorbic acid = L-AA) was from Sigma. All compounds were dissolved, aliquoted and stored following the manufacturer's instructions.

In vitro sensitivity assays

LinCD34+ human cells and Lin-cKit+ murine cells were obtained from mononuclear fractions by magnetic sorting using the EasySep Lin negative selection followed by CD34 or cKit positive selection cocktail as described before (11). Human AML primary cells were incubated in StemSpanSFEM medium (Stem Cell Technologies) supplemented with the cocktail of growth factors (100 ng/mL SCF, 20 ng/mL IL-3, 100 ng/mL FLT-3 ligand, 20 ng/mL GCSF, 20 ng/mL IL6) as described before (11). Murine normal and malignant hematopoietic cells were maintained in StemSpan SFEM medium supplemented with normal CML-like and AML-like (100 ng/mL SCF and 20 ng/mL IL3); MPN-like (100 ng/mL SCF; 10 ng/mL FLT3 ligand; 20 ng/mL IL3, IL6, GCSF, and GMCSF); 12 units/ml EPO; 2.5 ng/mL TPO as described before (3, 6, 11). Compounds were added for 3 days following by trypan blue exclusion viability test and/or plating in Methocult (Stemcell Technologies) when indicated; colonies were scored after 5–7 days.

DNA fibers

Cells were left untreated or treated with 2.5 μmol/L olaparib for 24 hours. DNA fibers were examined as described before (30). Briefly cells were treated with IdU (250 μmol/L) for 50 minutes and washed three times. After lysis DNA spreads were obtained by tilting slides to 30 degrees and air dry for 3 hours. DNA was denatured with HCl for 2.5 hours and after blocking cells were stained with primary anti-BrdUrd antibody (BD Biosciences #347580) for 2.5 hours. Secondary Alexa Fluor 594 rabbit anti-mouse IgG (H+L) antibody (Invitrogen #11062) was incubated for 1 hour. Images were taken with a Nikon NIU Upright Fluorescent Microscope and DNA fibers were measured using ImageJ.

DNA damage/repair

DSBs were detected by γH2AX immunofluorescence and neutral comet assay as described before (5) with modifications. Briefly, comet assays were performed using the Oxiselect Comet Assay Kit (Cell Biolabs #STA-355) according to the manufacturer's instructions. Images were acquired by an inverted Olympus IX70 fluorescence microscope using a FITC filter, and the percentage of tail DNA of individual cells was calculated using the OpenComet plugin of ImageJ. HR, D-NHEJ and Alt-NHEJ were measured using DR-GFP (HR), EJ2-GFP (D-NHEJ), and EJ5-GFP (Alt-NHEJ) reporter cassettes as described before (11).

Bone marrow transplantations

Sublethally (600 cGy) irradiated CD45.1+ congenic mice were transplanted intravenously with 2.5 × 106 CD45.2+ bone marrow cells (BMC) from Flt3ITD, Flt3ITD;Parp1−/−, Flt3ITD;Tet2−/−, Flt3ITD;Tet2−/−;Parp1−/−, Flt3ITD;Dnmt3a−/− and Flt3ITD;Dnmt3a−/−;Parp1−/− mice. Eight weeks later engraftment of CD45.2+ and CD45.2+Lin-Sca1+cKit+ cells was examined by flow cytometry (anti-CD45.2—#60695, anti-mouse lineage antibody cocktail— #558074, anti-mouse Ly6A/E—#556162, anti-mouse CD117—560557; all from BD Pharmingen) and 2.5 × 106 BMCs were transplanted to the sublethally irradiated secondary CD45.1+ recipients. Donor engraftment in secondary recipients was analyzed 8-weeks post-transplant as above.

In vivo treatments

Sublethally (600 cGy) irradiated CD45.1+ congenic mice were transplanted intravenously with 2 × 106 CD45.2+ BMCs from Flt3ITD;Tet2−/−, Flt3ITD;Dnmt3a−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− mice. Three weeks later engraftment of CD45.2+ cells was confirmed in peripheral blood of the individual CD45.1+ recipient mice. Engrafted mice were randomized and treated intravenously for 14 consecutive days with vehicle, 1 mg/kg quizartinib and/or 0.33 mg/kg talazoparib. CD45.2+ and CD45.2+Lin-Sca1+cKit+ cells were quantified by immunofluorescence in peripheral blood, spleen, and bone marrow 3 days after the end of treatment.

Institutional approvals

The patient samples were collected after obtaining informed consent in concordance with Declaration of Helsinki and were approved by the Institutional Review Boards. Animal experiments were approved by the Institutional Animal Care and Use Committee of Temple University and Washington University School of Medicine.

Quantification and statistical analysis

All experiments were conducted at least in three independent replications. The mean and standard deviation (SD) and statistical analysis (P value) was executed by Student t test in SigmaPlot (Systat Software). Data are considered statistically significant when P value is less than 0.05.

TET2 and DNMT3A mutations exert opposite effect on the sensitivity of malignant cells to PARPi

To begin to assess how cooperating mutations influence the sensitivity of OTK-positive leukemia cells to agents that target DDR mechanisms, clonogenic assays were performed with Lin-CD34+ cells from patients with AML with FLT3 ITD + NPM1 mutation (FLT3 ITD;NPM1mut) and FLT3 ITD;NPM1mut AML samples carrying TET2 mutation (TET2mut), DNMT3A mutation (DNMT3Amut) or both mutations as indicated in Supplementary Table S1. Results showed that FLT3ITD;NPM1mut;TET2mut AML cells were sensitive to PARPi olaparib, whereas FLT3ITD;NPM1mut;DNMT3Amut cells were resistant (Fig. 1A, left). Remarkably, TET2mut reversed the resistance phenotype of DNMT3Amut AML cells, as FLT3ITD;NPM1mut;TET2mut;DNMT3Amut and FLT3ITD;NPM1mut;TET2mut cells displayed similar sensitivity to olaparib. By contrast, TET2mut and DNMT3Amut did not affect the sensitivity of AML cells to the FLT3 kinase inhibitor (FLT3i) quizartinib (Fig. 1A, middle). In addition, although FLT3ITD;NPM1mut;DNMT3Amut AML cells expectedly displayed resistance to doxorubicin (20), FLT3(ITD);NPM1mut;TET2mut cells displayed similar sensitivity to FLT3ITD;NPM1mut cells (Fig. 1A, right). Moreover, TET2mut sensitized FLT3ITD;NPM1mut and FLT3ITD;NPM1mut;DNMT3Amut cells to the combination of olaparib + quizartinib ± doxorubicin (Fig. 1B).

Figure 1.

TET2mut and DNMT3Amut predetermine the sensitivity of OTK-positive hematological malignancies to PARPi combined with TKi and/or cytotoxic drug. A and B, Clonogenic activity of Lin-CD34+ cells from individual AML patients carrying FLT3ITD;NPM1mut (FN; n = 4 in A and 3 in B), FLT3ITD;NPM1mut;TET2mut (FNT; n = 3 in A and B), FLT3ITD;NPM1mut;DNMT3Amut (FND; n = 4 in A and 3 in B), and FLT3ITD;NPM1mut;TET2mut;DNMT3Amut (FNTD; n = 3 in A and B) treated for 72 hours with the indicated concentrations of olaparib, quizartinib, or doxorubicin (A) and quizartinib (Q; 10 nmol/L), olaparib (O; 1.25 μmol/L), doxorubicin (D; 2.5 nmol/L), and combinations (B). C and D, Clonogenic activity of Lin-Kit+ BMC from Flt3ITD (F), Flt3ITD;Tet2−/− (FT), Flt3ITD;Dnmt3a−/− (FD), and Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD) mice (n = 3/genotype) incubated for 72 hours with various concentrations of olaparib (C) and 1 μmol/L olaparib (O), 100 nmol/L quizartinib (Q), 10 nmol/L doxorubicin (D), and combinations (D). E, 50:50 mixtures of RFP+ FD: GFP+ FT cells and RFP+ FD: GFP+ FTD cells were incubated with the indicated concentrations of olaparib for 10 days, followed by flow cytometry analysis. Results show mean fold change ± SD of the percentage of the indicated cells in suspension when compared with untreated counterparts from triplicate experiments. Panels illustrate indicated cell mixtures after the treatment with 10 μmol/L olaparib or diluent (Control). Pictures were acquired with Evos FL Auto 2 fluorescent microscope (Invitrogen). Magnification, ×10. F, Clonogenic activity of BCR-ABL1 (BA), BCR-ABL1;Tet2−/− (BAT), BCR-ABL1;Dnmt3a−/− (BAD), and normal (N) murine Lin-Kit+ BMC incubated for 72 hours with various concentrations of olaparib. G and H, Clonogenic activity of JAK2V617F (J), CALRdel52 (C), and MPLW515 L (M) -positive Tet2−/− (T) and Dnmt3a−/− (D) murine Lin-Kit+ BMC incubated with the indicated concentrations of olaparib (G) and 100 nmol/L ruxolitinib (R), 2.5 μmol/L olaparib (O), and/or 10 μmol/L hydroxyurea (H; H). A–D and F–H, Results show the mean percentage of ± SD of colonies from all tested samples compared with untreated cells; *, P < 0.05 in comparison with F and/or FD/JD.

Figure 1.

TET2mut and DNMT3Amut predetermine the sensitivity of OTK-positive hematological malignancies to PARPi combined with TKi and/or cytotoxic drug. A and B, Clonogenic activity of Lin-CD34+ cells from individual AML patients carrying FLT3ITD;NPM1mut (FN; n = 4 in A and 3 in B), FLT3ITD;NPM1mut;TET2mut (FNT; n = 3 in A and B), FLT3ITD;NPM1mut;DNMT3Amut (FND; n = 4 in A and 3 in B), and FLT3ITD;NPM1mut;TET2mut;DNMT3Amut (FNTD; n = 3 in A and B) treated for 72 hours with the indicated concentrations of olaparib, quizartinib, or doxorubicin (A) and quizartinib (Q; 10 nmol/L), olaparib (O; 1.25 μmol/L), doxorubicin (D; 2.5 nmol/L), and combinations (B). C and D, Clonogenic activity of Lin-Kit+ BMC from Flt3ITD (F), Flt3ITD;Tet2−/− (FT), Flt3ITD;Dnmt3a−/− (FD), and Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD) mice (n = 3/genotype) incubated for 72 hours with various concentrations of olaparib (C) and 1 μmol/L olaparib (O), 100 nmol/L quizartinib (Q), 10 nmol/L doxorubicin (D), and combinations (D). E, 50:50 mixtures of RFP+ FD: GFP+ FT cells and RFP+ FD: GFP+ FTD cells were incubated with the indicated concentrations of olaparib for 10 days, followed by flow cytometry analysis. Results show mean fold change ± SD of the percentage of the indicated cells in suspension when compared with untreated counterparts from triplicate experiments. Panels illustrate indicated cell mixtures after the treatment with 10 μmol/L olaparib or diluent (Control). Pictures were acquired with Evos FL Auto 2 fluorescent microscope (Invitrogen). Magnification, ×10. F, Clonogenic activity of BCR-ABL1 (BA), BCR-ABL1;Tet2−/− (BAT), BCR-ABL1;Dnmt3a−/− (BAD), and normal (N) murine Lin-Kit+ BMC incubated for 72 hours with various concentrations of olaparib. G and H, Clonogenic activity of JAK2V617F (J), CALRdel52 (C), and MPLW515 L (M) -positive Tet2−/− (T) and Dnmt3a−/− (D) murine Lin-Kit+ BMC incubated with the indicated concentrations of olaparib (G) and 100 nmol/L ruxolitinib (R), 2.5 μmol/L olaparib (O), and/or 10 μmol/L hydroxyurea (H; H). A–D and F–H, Results show the mean percentage of ± SD of colonies from all tested samples compared with untreated cells; *, P < 0.05 in comparison with F and/or FD/JD.

Close modal

NPM1mut often accompany FLT3ITD alone or together with TET2mut and/or DNMT3Amut (31). However, NPM1mut did not alter the sensitivity of leukemia cells to olaparib (Supplementary Fig. S1A and S1B).

Mouse models were generated to validate the unique roles of TET2mut and DNMT3Amut in regulating sensitivity of OTK–positive cells to PARPi. To model the somatic loss-of-function mutations found in human blood diseases, mice with conditional inactivation of Dnmt3a and Tet2 in the hematopoietic system were generated. Mice with loxP-flanked exons within Dnmt3a or Tet2 were crossed with Vav-Cre recombinase strain, which is active in all hematopoietic cells from E14.5 of development (henceforth referred to as Dnmt3a−/− and Tet2−/− respectively). The resultant mice were further crossed to mice harboring Flt3ITD mutation. In concordance with human Lin-CD34+ AML cells, Lin-cKit+ BMCs from Flt3ITD;Tet2−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− mice were highly sensitive to olaparib (Fig. 1C) and to the combination of olaparib + quizartinib ± doxorubicin (Fig. 1D) when compared Lin-cKit+ BMC from Flt3ITD and Flt3ITD;Dnmt3a−/− mice. The opposing effects of Tet2 and Dnmt3a mutations on sensitivity to PARPi was further supported by olaparib-induced selective elimination of Flt3ITD;Tet2−/− cells and Flt3ITD;Tet2−/−;Dnmt3a−/− cells from 50:50 mixtures with Flt3ITD;Dnmt3a−/− cells (Fig. 1E).

The PARPi sensitivity phenotype of Tet2−/− cells was not restricted to co-occurrence with Flt3ITD as murine Tet2−/− Lin-cKit+ BM cells transformed with BCR-ABL1, JAK2V617F, MPLW515 L and CALRdel52 were also more sensitive to olaparib when compared with Dnmt3a−/− counterparts (Fig. 1F and G). In addition, JAK2V617F;Tet2−/− cells responded better to the combination of olaparib and ruxolitinib (JAK1/2 inhibitor) and/or hydroxyurea than JAK2V617F;Dnmt3a−/− cells (Fig. 1H). Moreover, as OTKs signals through NRAS, Tet2−/− Lin-cKit+ cells expressing the NrasG12D activating mutation (32) were also highly sensitive to olaparib, compared with NrasG12D;Dnmt3a−/− counterparts (Supplementary Fig. S1C).

To provide additional evidence that inactivation of TET2 and DNMT3A affect the sensitivity of OTK-positive cells to PARPi, expression of these proteins was inhibited by CRISPR/Cas9 approach in FLT3ITD-positive 32Dcl3 murine hematopoietic clones (Fig. 2A). Targeted deletion of Tet2 or Tet2 and Dnmt3a genes was associated with enhanced sensitivity to olaparib compared with control, whereas deletion of Dnmt3a caused olaparib resistance (Fig. 2A). These effects correlated with the magnitude of downregulation of TET2 and DNMT3A in FLT3ITD-positive 32Dcl3 clones (Fig. 2B).

Figure 2.

Inhibition of TET2 enzymatic activity enhances the sensitivity of FLT3ITD-positive murine AML-like cells to PARPi. A and B, Trypan blue excluding cells relative to untreated control ± SD after 96 hours of treatment with various concentrations of olaparib (three experiments in triplicates). Western blot showing expression of DNMT3A and/or TET2 in FLT3ITD-positive 32Dcl3 cells (F) and in clones with complete (A) or complete and partial (B) targeted deletion of TET2 (FT, Ft), DNMT3A (FD, Fd), and DNMT3A+TET2 (FTD) by CRISPR/Cas9. C, Clonogenic activity of GFP+ Lin-cKit+ BMC from FLT3ITD;Tet2−/−;Evi1-GFP, FLT3ITD;Tet2+/−;Evi1-GFP, and FLT3ITD;Tet2+/+;Evi1-GFP mice treated for 72 hours with various concentrations of olaparib. Results show the mean percentage of ± SD of cells/colonies compared with untreated cells. D, Clonogenic activity of murine Lin-cKit+FLT3ITD;Tet2−/− BMC-expressing GFP (control) and Flag-tagged TET2-CD and TET2-CD(CM) and treated with 1 μmol/L olaparib for 72 hours. Results represent the percentage of colonies ± SD compared with untreated cells. *, P < 0.05 when compared with other groups. Western blot showing expression of the Flag-tagged proteins in total cells lysates. E, Clonogenic activity of murine Lin-cKit+FLT3ITD;Tet2−/− BMC treated with 1 μmol/L olaparib (O) and/or 250 μmol/L L-AA for 6 days. Results show mean percentage ± SD of colonies compared with untreated cells. Representative dot-blot detecting 5hmC is shown. F, Clonogenic activity of murine Lin-cKit+FLT3ITD;Dnmt3a2−/− BMC treated with 1 μmol/L olaparib (O) and/or 500 μmol/L 2-HG for 96 hours. Results show the mean percentage of ± SD of colonies compared with untreated cells. *, P < 0.05 when compared with O. Representative dot-blot detecting 5hmC is shown. G, Mean percentage of colonies ± SD from FLT3TKD;NPM1mut;DNMT3Amut Lin-CD34+ AML cells treated for 96 hours with 1.25 μmol/L olaparib (O), 50 nmol/L quizartinib (Q), and/or 250 mmol/L 2-HG when compared with untreated cells. * and **, P < 0.05 when compared with single and dual treatments, respectively.

Figure 2.

Inhibition of TET2 enzymatic activity enhances the sensitivity of FLT3ITD-positive murine AML-like cells to PARPi. A and B, Trypan blue excluding cells relative to untreated control ± SD after 96 hours of treatment with various concentrations of olaparib (three experiments in triplicates). Western blot showing expression of DNMT3A and/or TET2 in FLT3ITD-positive 32Dcl3 cells (F) and in clones with complete (A) or complete and partial (B) targeted deletion of TET2 (FT, Ft), DNMT3A (FD, Fd), and DNMT3A+TET2 (FTD) by CRISPR/Cas9. C, Clonogenic activity of GFP+ Lin-cKit+ BMC from FLT3ITD;Tet2−/−;Evi1-GFP, FLT3ITD;Tet2+/−;Evi1-GFP, and FLT3ITD;Tet2+/+;Evi1-GFP mice treated for 72 hours with various concentrations of olaparib. Results show the mean percentage of ± SD of cells/colonies compared with untreated cells. D, Clonogenic activity of murine Lin-cKit+FLT3ITD;Tet2−/− BMC-expressing GFP (control) and Flag-tagged TET2-CD and TET2-CD(CM) and treated with 1 μmol/L olaparib for 72 hours. Results represent the percentage of colonies ± SD compared with untreated cells. *, P < 0.05 when compared with other groups. Western blot showing expression of the Flag-tagged proteins in total cells lysates. E, Clonogenic activity of murine Lin-cKit+FLT3ITD;Tet2−/− BMC treated with 1 μmol/L olaparib (O) and/or 250 μmol/L L-AA for 6 days. Results show mean percentage ± SD of colonies compared with untreated cells. Representative dot-blot detecting 5hmC is shown. F, Clonogenic activity of murine Lin-cKit+FLT3ITD;Dnmt3a2−/− BMC treated with 1 μmol/L olaparib (O) and/or 500 μmol/L 2-HG for 96 hours. Results show the mean percentage of ± SD of colonies compared with untreated cells. *, P < 0.05 when compared with O. Representative dot-blot detecting 5hmC is shown. G, Mean percentage of colonies ± SD from FLT3TKD;NPM1mut;DNMT3Amut Lin-CD34+ AML cells treated for 96 hours with 1.25 μmol/L olaparib (O), 50 nmol/L quizartinib (Q), and/or 250 mmol/L 2-HG when compared with untreated cells. * and **, P < 0.05 when compared with single and dual treatments, respectively.

Close modal

Dose-dependent effects of TET2 on PARPi sensitivity may have clinical relevance because both heterozygous and homozygous TET2 mutations have been detected in hematopoietic malignancies (33), which affected 5hmC levels: Tet2+/+ >Tet2+/−>Tet2−/− (34). Clonogenic assays with mouse BMC cells confirmed a dose-dependent effect of Tet2 on sensitivity to olaparib: Flt3ITD;Tet2+/+ > Flt3ITD;Tet2+/− > Flt3ITD;Tet2−/− (Fig. 2C).

To determine whether the 5-methylcytosine hydroxylase activity of TET2 regulated sensitivity to PARPi, the TET2 catalytic domain (TET2-CD) or catalytically inactive mutant (TET2-CDCM; ref. 28) were expressed in Flt3ITD;Tet2−/− murine Lin-cKit+ BMC cells followed by treatment with olaparib. The results indicated that loss of TET2 enzymatic activity was responsible for sensitizing the cells to PARPi (Fig. 2D). However, restoration of TET1/2/3-mediated global 5hmC by L-ascorbic acid (L-AA) in Flt3ITD;Tet2−/− cells did not result in resistance to olaparib (Fig. 2E), suggesting that regulation of the response to PARPi is TET2 dioxygenase-specific.

Incubation of the Flt3ITD;Dnmt3a−/− murine Lin-cKit+ BMC with 2-HG, a competitive inhibitor of α-ketoglutarate–dependent dioxygenases, including TET1–3 (35), reduced global 5hmC and induced sensitivity of these cells to olaparib (Fig. 2F). However, 2-HG did not affect the sensitivity of Flt3ITD;Tet2−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− cells to olaparib (Supplementary Fig. S2) strongly suggesting that 2-HG–mediated inhibition of TET2 enzymatic activity contributed to this effect. 2-HG treatment also enhanced the sensitivity of FLT3TKD;NPM1mut;DNMT3Amut human primary Lin-CD34+ AML cells to olaparib ± quizartinib (Fig. 2G). Cumulatively, these data suggest that loss of enzymatic activity of TET2 modulates the sensitivity of TET2mut cells to PARPi.

Tet2 and Dnmt3a loss of functions determine the therapeutic effect of PARPi ± TKi against Flt3ITD-positive murine leukemias in vivo

To determine the clinical impact of in vitro findings, combination therapies were applied to murine leukemia cells in vivo. Congenic mice (CD45.1+) were transplanted with leukemic BM cells from Flt3ITD;Tet2−/−, Flt3ITD;Dnmt3a−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− mice (CD45.2+). Representative mice with AML-like disease were chosen as donors of leukemia BM cells from the cohorts described before (18) and also from these characterized in Supplementary Fig. S3A–S3D. Following engraftment of donor cells, recipient mice were treated with vehicle, FLT3i quizartinib, PARPi talazoparib, or quizartinib + talazoparib (Fig. 3A). Talazoparib was used here because it displays better pharmacokinetic parameters in mice than olaparib (36). Therapeutic effect was examined by quantification of CD45.2+ cells in peripheral blood, spleen and bone marrow, and CD45.2+ Lin-Sca1+cKit+ stem/progenitor cells in the bone marrow.

Figure 3.

Divergent effect of the loss of Tet2 and Dnmt3a on sensitivity of Flt3ITD-positive murine AML-like cells to talazoparib ± quizartinib in mice. A, Experimental scheme. B, CD45.1+ congenic mice (n = 6–9/group) bearing CD45.2+Flt3ITD;Tet2−/− (FT; green), Flt3ITD;Dnmt3a−/− (FD; orange), or Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD; purple) leukemia cells were treated with vehicle (−), 1 mg/kg quizartinib (Q), 0.33 mg/kg talazoparib (T), and Q+T. Results represent the mean percentage of ± SD of CD45.2+ and/or CD45.2+LSK cells in peripheral blood leukocytes (PBL), spleen cells (SPL), and BMCs relative to control (vehicle-treated mice). * and **, P < 0.05 when compared with control and single treatment, respectively, using one-way ANOVA.

Figure 3.

Divergent effect of the loss of Tet2 and Dnmt3a on sensitivity of Flt3ITD-positive murine AML-like cells to talazoparib ± quizartinib in mice. A, Experimental scheme. B, CD45.1+ congenic mice (n = 6–9/group) bearing CD45.2+Flt3ITD;Tet2−/− (FT; green), Flt3ITD;Dnmt3a−/− (FD; orange), or Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD; purple) leukemia cells were treated with vehicle (−), 1 mg/kg quizartinib (Q), 0.33 mg/kg talazoparib (T), and Q+T. Results represent the mean percentage of ± SD of CD45.2+ and/or CD45.2+LSK cells in peripheral blood leukocytes (PBL), spleen cells (SPL), and BMCs relative to control (vehicle-treated mice). * and **, P < 0.05 when compared with control and single treatment, respectively, using one-way ANOVA.

Close modal

Untreated animals developed myeloid leukemia without maturation-like disease (≥25% Lin-CD45.2+ cells and ≤1% Mac1+, Ter119+, B220+ and CD3e+ cells in bone marrow; ref. 37). Talazoparib alone and especially in combination with quizartinib exerted a strong inhibitory effect against Flt3ITD;Tet2−/− AML, and to a lesser degree against Flt3ITD;Tet2−/−;Dnmt3a−/− cells (Fig. 3B). Conversely, talazoparib was ineffective against Flt3ITD;Dnmt3a−/− cells, nor did it enhance the effect of quizartinib against this genotype.

Flt3ITD-positive Tet2-mutant leukemia cells accumulate DSBs due to increased speed of replication fork progression and attenuated HR and D-NHEJ activities

Because OTK-positive cells show accumulation of DNA damage, DSBs were examined in mice from the different genotypes as a mechanism to explain the differential responses to PARPi. This was quantified via accumulation of toxic DSBs (by neutral comet assay and histone H2AX phosphorylation on serine 139 = γH2AX; refs. 38, 39) and cell survival after exposure to olaparib ± quizartinib and doxorubicin. In general, olaparib ± quizartinib -treated Flt3ITD;Tet2−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− murine Lin-cKit+ cells accumulated significantly more DSBs than their Flt3ITD;Dnmt3a−/− counterparts (Fig. 4A), which was associated with reduced survival rate of the former cells (Supplementary Fig. S4A). Moreover, Flt3ITD;Tet2−/− cells treated with the combination of olaparib ± quizartinib ± doxorubicin also displayed higher levels of DSBs when compared with Flt3ITD;Dnmt3a−/− cells (Supplementary Fig. S4B).

Figure 4.

Tet2 deletion is associated with accelerated fork progression and impaired DSB repair, resulting in accumulation of DSBs in PARPi ±OTKi–treated Flt3ITD-positive cells. Flt3ITD (F), Flt3ITD;Tet2−/− (FT), Flt3ITD;Dnmt3a−/− (FD), and Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD) murine Lin-cKit+ BMC were tested. A, Cells were treated with 10 μmol/L olaparib (O) ± 100 nmol/L quizartinib (Q) for 24 and 48 hours. DSBs were assessed by γH2AX immunofluorescence (top) and neutral comet assay (bottom). Results represent the mean percentage of control ± SD from triplicates. B, DNA fibers from cells untreated or treated with 2.5 μmol/L olaparib (O) for 24 hours. Results represent forks speed. The P value was calculated using the Mann–Whitney rank sum test. C, HR, D-NHEJ, and Alt-NHEJ activities were measured using DR-GFP, EJ-GFP, and EJ2-GFP reporter cassettes, respectively. Results represent the mean percentage ± SD from triplicates. *, P < 0.05 in comparison with Flt3ITD cells. D, Western blot analysis of the nuclear lysates obtained from indicated cells.

Figure 4.

Tet2 deletion is associated with accelerated fork progression and impaired DSB repair, resulting in accumulation of DSBs in PARPi ±OTKi–treated Flt3ITD-positive cells. Flt3ITD (F), Flt3ITD;Tet2−/− (FT), Flt3ITD;Dnmt3a−/− (FD), and Flt3ITD;Tet2−/−;Dnmt3a−/− (FTD) murine Lin-cKit+ BMC were tested. A, Cells were treated with 10 μmol/L olaparib (O) ± 100 nmol/L quizartinib (Q) for 24 and 48 hours. DSBs were assessed by γH2AX immunofluorescence (top) and neutral comet assay (bottom). Results represent the mean percentage of control ± SD from triplicates. B, DNA fibers from cells untreated or treated with 2.5 μmol/L olaparib (O) for 24 hours. Results represent forks speed. The P value was calculated using the Mann–Whitney rank sum test. C, HR, D-NHEJ, and Alt-NHEJ activities were measured using DR-GFP, EJ-GFP, and EJ2-GFP reporter cassettes, respectively. Results represent the mean percentage ± SD from triplicates. *, P < 0.05 in comparison with Flt3ITD cells. D, Western blot analysis of the nuclear lysates obtained from indicated cells.

Close modal

Olaparib-induced accumulation of DSBs might result from enhanced induction and/or inadequate repair of DSBs. PARPi-triggered DSBs could be generated by increased speed of replication fork progression (40). Replication fork kinetic analyses indicate that olaparib accelerated fork elongation in Flt3ITD and Flt3ITD;Tet2−/− cells, but inhibited fork elongation in Flt3ITD;Dnmt3a−/− cells (Fig. 4B). Olaparib did not further accelerate already high speed fork progression in Flt3ITD;Tet2−/−;Dnmt3a−/− cells.

The impact of TET2 and DNMT3A loss of function on DSB repair was tested using specific reporter cassettes measuring HR, D-NHEJ and Alt-NHEJ repair activities as described before (Fig. 4C; ref. 11). Both HR and D-NHEJ responses were sharply attenuated in Tet2-mutant Flt3ITD murine Lin-cKit+ BMC compared with Flt3ITD and Flt3ITD;Dnmt3a−/− cells. Conversely, Alt-NHEJ activity was selectively diminished in Flt3ITD;Dnmt3a−/− cells.

To evaluate the specific alterations in DSB repair pathways induced by TET2 and DNMT3A loss of function, Western blot analyses were performed to examine expression of the key components of DDR, including HR, D-NHEJ, and Alt-NHEJ. BRCA1 and LIG4 were downregulated in Tet2-mutant mouse AML cells (Fig. 4D), in concordance with abrogation of BRCA1-dependent HR and LIG4-dependent D-NHEJ (Fig. 4C). PARP1 was downregulated in Flt3ITD;Dnmt3a−/− cells (Fig. 4D), which underlies their reduced Alt-NHEJ (Fig. 5C) and cellular PARylation activity (Supplementary Fig. S5).

Figure 5.

PARP1 protects Flt3ITD;Tet2−/− cells from lethal effect of DSBs. A, Genotypes of the bone marrow donor mice. B, Mean number of colonies ± SD from 103 LSK bone marrow cells (3 mice/group). *, P < 0.05 when compared with FT and/or F counterparts. C, Mean number of CD45.2+ and CD45.2+ LSK BMC ± SD in bone marrow of sublethally irradiated CD45.1+ congenic mice transplanted with 2.5 × 106 bone marrow cells from the indicated mice (6–8 mice/group). *, P < 0.01 when compared with FT. D, Mean the percentage of ± SD of colonies from triplicates of LSK cells treated with 50 nmol/L quizartinib (Q) ± 5 nmol/L doxorubicin (D) when compared with untreated cells. *, P < 0.05 when compared with FT, and FP and FDP counterparts. E and F, Indicated LSK cells were treated with 100 nmol/L quizartinib (Q) ± 10 nmol/L doxorubicin (D) for 24 hours. DSBs were assessed by neutral comet assay (E) and γH2AX immunofluorescence (F). Results represent the mean percentage of control ± SD from triplicates.

Figure 5.

PARP1 protects Flt3ITD;Tet2−/− cells from lethal effect of DSBs. A, Genotypes of the bone marrow donor mice. B, Mean number of colonies ± SD from 103 LSK bone marrow cells (3 mice/group). *, P < 0.05 when compared with FT and/or F counterparts. C, Mean number of CD45.2+ and CD45.2+ LSK BMC ± SD in bone marrow of sublethally irradiated CD45.1+ congenic mice transplanted with 2.5 × 106 bone marrow cells from the indicated mice (6–8 mice/group). *, P < 0.01 when compared with FT. D, Mean the percentage of ± SD of colonies from triplicates of LSK cells treated with 50 nmol/L quizartinib (Q) ± 5 nmol/L doxorubicin (D) when compared with untreated cells. *, P < 0.05 when compared with FT, and FP and FDP counterparts. E and F, Indicated LSK cells were treated with 100 nmol/L quizartinib (Q) ± 10 nmol/L doxorubicin (D) for 24 hours. DSBs were assessed by neutral comet assay (E) and γH2AX immunofluorescence (F). Results represent the mean percentage of control ± SD from triplicates.

Close modal

Mutations in TET2 and DNMT3A are known to deregulate DNA methylation and mRNA expression of genes involved in pathogenesis of leukemia (41). We found that mRNA expression of DSB repair genes, including BRCA1, LIG4, and PARP1 was similar in FLT3ITD, FLT3ITD;TET2mut, FLT3ITD;DNMT3Amut and FLT3ITD;TET2mut;DNMT3Amut AMLs (Supplementary Fig. S6A). Moreover, single-cell RNA-seq analysis of murine Lin-cKit+Flt3ITD, Flt3ITD;Tet2−/− and Flt3ITD;Dnmt3a−/− BMC did not reveal any significant differences in expression of DSB repair genes except upregulation of Parp1 in Flt3ITD;Tet2−/− cells (Supplementary Fig. S6B and S6C; Supplementary Table S3), which, however, did not translate into upregulation of the protein expression (see Fig. 4D). Altogether, we hypothesize that deregulation of BRCA1, LIG4, and PARP1 protein expression in OTK-positive TET2 and/or DNMT3A-mutated hematological malignancies may depend on post-transcriptional modifications.

PARP1 protects Flt3itd;Tet2−/− but not Flt3ITD;Dnmt3a−/− leukemia-initiating cells from lethal DSBs

The prior data suggest that PARP activity and reliance on the Alt-NHEJ is required to protect OTK-positive TET2mut leukemia cells from the toxic effect of DSBs. Among the 18 members of the PARP family, only PARP1, PARP2, and PARP3 have been identified to catalyze PARylation during the DDR and to be involved in DSB repair (42). PARP1 does not show a clear preference for any type of strand break, whereas PARP2 and PARP3 are preferentially activated by DNA strand breaks harboring a 5′ phosphate, suggesting that among PARP1–3, PARP1 plays a more universal role in DSB repair (43).

To examine the role of PARP1 in response to DSBs in hematological cells with TET2 and DNMT3A loss of function, clonogenic potential, engraftment capability and response to DNA damage was compared in Lin-Sca1+cKit+ (LSK) BMC from mice of the aforementioned genotypes lacking Parp1 (Fig. 5A).

The genetic absence of Parp1 significantly reduced the clonogenic potential of LSK cells with Flt3ITD and Tet2 mutations, exerted only a modest effect on LSK cells with Flt3ITD alone, but did not affect the clonogenic potential of LSK cells with Flt3ITD and Dnmt3a mutations (Fig. 5B). To assess the impact of Parp1 deletion on LSCs serial bone marrow transplantations were performed. Secondary transplant engraftment capacity of Flt3ITD;Tet2−/−;Parp1−/− BMC was reduced when compared with Flt3ITD;Tet2−/− cells (Fig. 5C). Conversely, lack of Parp1 had no effect on engraftment capabilities of Flt3ITD and Flt3ITD;Dnmt3a−/− BM. Therefore, PARP1 appears to plan important role in maintaining LSCs of Flt3ITD;Tet2−/− but not Flt3ITD and Flt3ITD;Dnmt3a−/− genotype.

Flt3ITD;Tet2−/−;Parp1−/−, but not Flt3ITD;Parp1−/− and Flt3ITD;Dnmt3a−/−;Parp1−/− LSK cells were more sensitive to quizartinib + doxorubicin than their Parp1+/+ counterparts (Fig. 5D). These effects were associated with an enhanced accumulation of spontaneous and drug-induced DSBs assessed by neutral comet assay (Fig. 5E) and γH2AX (Fig. 5F). In conclusion, PARP1 plays an important role in maintaining OTK-positive leukemia cells with Tet2, but not Dnmt3a, mutations.

Disruption of TET2—WT1 axis sensitizes leukemia cells to PARPi

TET2 interacts with multiple proteins to exert its regulatory role. TET2 mutations detected in patients with AML disrupt its interaction with WT1 protein (28) and WT1 mutations result in loss of TET2 function in AML (28). In keeping with this observation, WT1 and TET2 mutations are in general mutually exclusive in AML and suggest that a single mutation in TET2 or WT1 is sufficient to block the activity of the TET2/WT1 complex (44).

To test the role of WT1 mutations (WT1mut) in sensitivity to PARPi, hTET2-CD wild-type and its enzymatically active but WT1 binding-deficient hTET2-CDA1505T mutant (28) were expressed in FLT3ITD;NPM1mut;TET2mut Lin-CD34+ primary AML cells. Remarkably, although hTET2-CD reduced the sensitivity to olaparib (as also seen in murine cells, Fig. 2D), cells expressing the TET2-CDA1505T mutant remained sensitive to olaparib (Fig. 6A). If WT1 binding to TET2 was important for this phenotype, we hypothesized that WT1mut AML cells may also be sensitive to PARPi. In concordance, FLT3ITD;WT1mut Lin-CD34+ AML primary cells were highly sensitive to olaparib as compared with FLT3ITD;DNMT3Amut cells (Fig. 6B); the former cells were also sensitive to olaparib +/quizartinib ± doxorubicin (Fig. 6C).

Figure 6.

WT1mut mimics TET2mut to increase the sensitivity of FLT3ITD cells to PARPi. A, Clonogenic activity of human FLT3ITD;NPM1mut;TET2mut Lin-CD34+ AML cells expressing mRFP1 (control), mRFP1 + Flag-tagged TET2-CD, and mRFP1 + TET2-CDA1505T mutant treated with 1 μmol/L olaparib. Results from three individual AML samples represent the percentage of colonies ± SD in comparison with untreated cells. *, P < 0.05 when compared with TET2-CD. Western blot showing expression of the Flag-tagged TET2-CD and TET2-CDA1505T proteins in total cells lysates. B and C, Clonogenic activity of Lin-CD34+ cells from individual patients with AML carrying FLT3ITD;DNMT3Amut (FD; n = 5) and FLT3ITD;WT1mut (FW; n = 4) treated with the indicated concentrations of olaparib (B) and quizartinib (Q; 10 nmol/L; C), olaparib (O; 1.25 μmol/L), doxorubicin (D; 2.5 nmol/L), and combinations. Results show the mean percentage of ± SD of colonies compared with untreated cells. *, P < 0.05 and **, P < 0.05 in comparison with single- and dual-drug treatment, respectively. D, Clonogenic activity of murine Flt3ITD;Dnmt3a−/− (FD), Flt3ITD;Tet2−/− (FT), and Flt3ITD;Wt1+/− (FW) Lin-cKit+ BMC treated with the indicated concentrations of olaparib. Results show the mean percentage of ± SD of colonies compared with untreated cells. E, Neutral comet assay from Lin-cKit+ cells from individual AML patients (three patients/group) carrying FLT3ITD;DNMT3Amut (FD), FLT3ITD;NPM1mut;TET2mut (FNT), and FLT3ITD;WT1mut (FW) treated with 10 μmol/L olaparib. Results represent the mean percentage of tail DNA ± SD. *, P < 0.05 in comparison with FD cells. F, HR, D-NHEJ, and Alt-NHEJ activities were measured in Lin-CD34+ AML cells using specific reporter cassettes. Results represent the mean percentage of ± SD from three patients/group. *, P < 0.05 in comparison with corresponding FD cells. G, Western blot analysis of the indicated proteins in the nuclear lysates of Lin-CD34+ AML FD, FW, and FNT cells from individual patients #1–6.

Figure 6.

WT1mut mimics TET2mut to increase the sensitivity of FLT3ITD cells to PARPi. A, Clonogenic activity of human FLT3ITD;NPM1mut;TET2mut Lin-CD34+ AML cells expressing mRFP1 (control), mRFP1 + Flag-tagged TET2-CD, and mRFP1 + TET2-CDA1505T mutant treated with 1 μmol/L olaparib. Results from three individual AML samples represent the percentage of colonies ± SD in comparison with untreated cells. *, P < 0.05 when compared with TET2-CD. Western blot showing expression of the Flag-tagged TET2-CD and TET2-CDA1505T proteins in total cells lysates. B and C, Clonogenic activity of Lin-CD34+ cells from individual patients with AML carrying FLT3ITD;DNMT3Amut (FD; n = 5) and FLT3ITD;WT1mut (FW; n = 4) treated with the indicated concentrations of olaparib (B) and quizartinib (Q; 10 nmol/L; C), olaparib (O; 1.25 μmol/L), doxorubicin (D; 2.5 nmol/L), and combinations. Results show the mean percentage of ± SD of colonies compared with untreated cells. *, P < 0.05 and **, P < 0.05 in comparison with single- and dual-drug treatment, respectively. D, Clonogenic activity of murine Flt3ITD;Dnmt3a−/− (FD), Flt3ITD;Tet2−/− (FT), and Flt3ITD;Wt1+/− (FW) Lin-cKit+ BMC treated with the indicated concentrations of olaparib. Results show the mean percentage of ± SD of colonies compared with untreated cells. E, Neutral comet assay from Lin-cKit+ cells from individual AML patients (three patients/group) carrying FLT3ITD;DNMT3Amut (FD), FLT3ITD;NPM1mut;TET2mut (FNT), and FLT3ITD;WT1mut (FW) treated with 10 μmol/L olaparib. Results represent the mean percentage of tail DNA ± SD. *, P < 0.05 in comparison with FD cells. F, HR, D-NHEJ, and Alt-NHEJ activities were measured in Lin-CD34+ AML cells using specific reporter cassettes. Results represent the mean percentage of ± SD from three patients/group. *, P < 0.05 in comparison with corresponding FD cells. G, Western blot analysis of the indicated proteins in the nuclear lysates of Lin-CD34+ AML FD, FW, and FNT cells from individual patients #1–6.

Close modal

To validate the role of WT1 in response of FLT3ITD-positive AML cells to PARPi, we studied BM from Flt3ITD;Wt1+/− haploinsufficient mice, which developed a lethal fully penetrant AML (26). Olaparib sensitivity of murine Flt3ITD;Wt1+/− leukemic cells mimicked that of Flt3ITD;Tet2−/− cells (Fig. 6D).

Similar to FLT3ITD;NPM1mut;TET2mut cells, FLT3ITD;WT1mut Lin-CD34+ AML cells accumulated a high number of olaparib-induced DSBs as detected by neutral comet assay when compared with FLT3ITD;DNMT3Amut cells (Fig. 6E). FLT3ITD;WT1mut Lin-CD34+ AML cells also displayed HR, D-NHEJ and Alt-NHEJ repair activities similar to FLT3ITD;NPM1mut;TET2mut cells (Fig. 6F). Analogous to mice, BRCA1 and LIG4 were selectively downregulated in Lin-CD34+FLT3ITD;WT1mut and FLT3ITD;NPM1mut;TET2mut AML cells compared with FLT3ITD;DNMT3Amut counterparts (Fig. 6G). Cumulatively, these data show that WT1mut mimics the impact of TET2mut on DSB repair and sensitivity to PARPi in FLT3ITD-positive AML.

PARPi combination therapy with TKi has the potential to become a novel clinical approach against cohorts of hematological malignancies and solid tumors driven by OTKs (45). Because OTKs are usually accompanied by additional mutations, it is paramount to determine whether these mutations alter the sensitivity to PARPi (3, 6, 13, 14). Mutations in genes encoding epigenetics-modifying enzymes TET2 and DNMT3A are common in myeloid malignancies such as AML, CML, and MPNs (46–48).

We show here that loss-of-function mutations of Tet2 and/or Dnmt3a in murine hematopoietic cells play divergent roles in regulating PARPi sensitivity in hematological malignancies expressing OTKs such as FLT3ITD, JAK2V617F, BCR-ABL1, MPLW515L and in those harboring activating mutations in OTKs-mediated signaling pathways, for example, CALRdel52 and NRASG12D; Tet2mut caused PARPi sensitivity; conversely, Dnmt3amut induced PARPi resistance. In addition, genetic and biochemical inactivation of TET2 in PARPi-resistant Flt3ITD;Dnmt3a−/− cells restored their sensitivity to olaparib. These results from multiple in vitro experimental models translated in to the anti-leukemia activity of PARPi ± TKi in mice bearing Flt3ITD;Tet2−/− and Flt3ITD;Tet2−/−;Dnmt3a−/− leukemias, but not against these with Flt3ITD;Dnmt3a−/− AML.

Our observation that TET2 deficiency enhances the sensitivity of OTK-positive leukemia cells to PARPi is supported by recent report demonstrating that CRISPR/Cas9-targeted deletion of TET2 in AML cells lines OCI-AML2 and THP1 was associated with increased sensitivity to olaparib and talazoparib (49). Because each of these cell lines harbor >200 somatic mutations and chromosomal translocations/aberrations (50), specific genetic contribution of TET2 mutations to the sensitivity to PARPi could not be identified. Our findings pinpoint new role of TET2 mutations, divergent from that of DNMT3A mutations, in regulating the DSB repair and sensitivity to PARPi in OTK-induced leukemias. Although we cannot exclude the possibility that other undetected genetic aberrations may affect sensitivity to PARPis, results from murine genetic models of leukemias mimicking these in primary human malignancies support our conclusion about the specific roles of TET2 and DNMT3A mutations.

Although most TET2 mutations result in loss of the protein expression, some are missense mutations inactivating its enzymatic activity while preserving the protein expression (51). Inability of the enzymatically inactive TET2-CDCM mutant to restore olaparib resistance in Flt3ITD;Tet2−/− cells suggested that OTK-positive AML cells carrying TET2 mutations encoding for enzymatically inactive protein should be sensitive to PARPi ± standard treatment (TKi and/or doxorubicin).

Increased sensitivity of OTK-positive TET2mut leukemia cells to PARPi was associated with accumulation of lethal DSBs due to accelerated fork progression and inhibition of HR and D-NHEJ activities. Downregulation of BRCA1 and LIG4, the key proteins in HR and D-NHEJ, respectively, is in concordance with impaired HR and D-NHEJ in these cells. Altogether, we show that PARPi triggers robust synthetic lethality in OTK-positive TET2mut malignant hematopoietic cells displaying HR and D-NHEJ deficiencies (11).

RNA-seq performed in naïve and ruxolitinib-treated JAK2V617F;Tet2−/− and JAK2V617F;Tet+/+ LincKit+ cells (6) identified numerous pathways affected by Tet2 knockout (Supplementary Fig. S7A–S7D). Among the unique regulators were transcription factors, such as KLF4, NOTCH1, CEBPβ, PML, p53 and MYC, which can modulate DDR to regulate sensitivity of OTK-positive TET2mut cells to PARPi independently of HR and D-NHEJ (Supplementary Fig. S7E and S7F).

Nontransformed murine Tet2−/− hematopoietic stem/progenitor cells display a signature of inefficient/aberrant DNA repair (abundant accumulation of transitions and transversions) and were more sensitive to olaparib than their Tet2+/+ counterparts (49, 52). However, Tet2−/− cells did not accumulate DSBs and their DNA repair defects are most likely due to deregulation of translesion synthesis, mismatch repair and/or glycosylases involved in base excision repair, and may not involve HR and D-NHEJ (53, 54). Therefore, mechanisms responsible for PARPi-mediated synthetic lethality in OTK-positive TET2mut leukemia cells are different from those increasing cytotoxicity of PARPi in nontransformed Tet2−/− hematopoietic cells.

TET2 and WT1 interact to stimulate transactivation of target genes (28). We have shown that WT1 mutations recapitulate the alterations associated with TET2 mutations in DSB metabolism (enhanced accumulation of DSBs, downregulation of BRCA1 and LIG4 proteins, and inhibition of HR and D-NHEJ) and in sensitivity to PARPi of the primary OTK-positive leukemia cells. The impact of the TET2–WT1 axis on DSB repair is also supported by other reports that downregulation of TET2 and WT1 was associated with reduced mRNA expression of BRCA1 in U2OS osteosarcoma cell line and LIG4 in the HL60 AML cell line, respectively (13, 28).

Collectively, the accumulation of toxic DSBs in FLT3ITD;Tet2−/− and FLT3ITD;Tet2−/−;Dnmt3a−/− cells when compared with FLT3ITD and FLT3ITD;Dnmt3a−/− cells appears to result from an increased speed of fork progression and/or impaired HR/D-NHEJ repair activities.

Experiments involving knockout mice pinpointed PARP1, which is one of the key elements of Alt-NHEJ, as the predominant factor protecting HR/D-NHEJ–deficient Flt3ITD;Tet2−/−, but not HR/D-NHEJ–proficient Flt3ITD;Dnmt3a−/− leukemia-initiating cells from toxic DSBs. However, in addition to DNA repair, PARP1 has been broadly implicated in regulation of epigenetic events, thus we cannot exclude the possibility that the detrimental effect of Tet2 and Parp1 double knockout in Flt3ITD-positive cells depends also on abnormal histone modification, chromatin state and/or transcriptional regulation (55).

It has been reported that leukemia cells harboring IDH1/2 mutants, which generate high levels of 2-hydroxyglutarate (2-HG), a competitive inhibitor of α-ketoglutarate–dependent dioxygenases (e.g., TET1–3 and KDM4A/B), or cells treated with 2-HG were sensitive to PARPi (14, 56). 2-HG–mediated PARPi-triggered synthetic lethality was due to downregulation of DNA damage sensor ATM and inhibition of RAD51 in HR, but these effects depended on inhibition of histone demethylases KDM4A/B, but not of TET2.

In conclusion, mutations in TET2 and DNMT3A exert opposite effects on the sensitivity to PARPi in malignant hematopoietic cells displaying activation of OTK-mediated signaling (Supplementary Fig. S8A). Because mutations in TET2 are found in cohorts of OTK-positive AML, MPN, and CML (Supplementary Fig. S8B), we postulate that PARPi may have a broad clinical application. In addition to mutations, numerous leukemias may display functional deficiency of TET2 due to reduced expression levels of non-mutated gene (Supplementary Fig. S8C–S8F), further increasing the spectrum of patients, which might benefit from such an approach. Moreover, OTKs (e.g., BCR–ABL1) can promote cytoplasmic compartmentalization of TET2, thus leading to its loss of function (57).

We recently showed that TKi-treated leukemia cells displaying deficiencies in HR and D-NHEJ were less sensitive to PARPi in the in vitro bone marrow microenvironment (BMM) mimicking conditions and in vivo in immunodeficient mice (58). However, the protective effect of BMM could be at least partially abrogated by longer treatment regimen with higher doses of PARPi and/or by antitumor immune response elicited by PARPi in immunocompetent mice (this work and ref. 59). In conclusion, our report warrants clinical trial testing PARPi ± TKi for OTK-positive TET2mut or WT1mut hematological malignancies.

P. Valent reports personal fees from Celgene-BMS, Novartis, Blueprint, and Thermofisher, as well as grants and personal fees from Pfizer, and personal fees from AOP Orphan Pharmaceuticals outside the submitted work. M.S. Tallman reports grants from AbbVie, Orsenix, Biosight, Glycomimetics, Rafael Pharmaceuticals, Amgen, and other support from AbbVie, Daiichi-Sankyo, Orsenix, Rigel, Delta Fly Pharma, Tetraphase, Onzolyze, Jazz Pharmaceuticals, Roche, Biosight, Novartis, Innate Pharma, Kura, Syros Pharmaceuticals, and UpToDate; personal fees and non-financial support from EHA Congress Medscape Live Symposium and ASH CRTI Workshop, non-financial support from Hammeresmith Hospital, Britanico Hospital, and personal fees from PIME Oncology; personal fees and non-financial support from Penn State University, non-financial support from Mumbai Hematology Group, German AML Cooperative Group, and Emirates Hematology Society; personal fees and non-financial support from INDY Hematology Review-St. Vincent's Hospital, personal fees from Targeted Oncology, personal fees and non-financial support from Vanderbilt University, ASCO Direct Highlights, New Orleans Summer Cancer Meeting, Mayo Clinic, UC Davis; personal fees from FDNY, NCCN, MCI Summit of the Americas, non-financial support from Rambam Medical Center Israel, and Miami Leukemia Symposium University of Miami outside the submitted work. H.F. Fernandez reports personal fees from Incyte and Jazz Pharmaceuticals outside the submitted work. G.S. Vassiliou reports personal fees from AstraZeneca and STRM.BIO outside the submitted work. G.A. Challen reports grants from NIH and grants from LLS during the conduct of the study, and personal fees for consulting for Incyte, but not relevant to the work presented in this study. No disclosures were reported by the other authors.

S. Maifrede: Formal analysis, validation, investigation, methodology. B.V. Le: Formal analysis, validation, investigation, methodology. M. Nieborowska-Skorska: Formal analysis, validation, investigation, methodology. K. Golovine: Formal analysis, validation, investigation, methodology. K. Sullivan-Reed: Formal analysis, validation, investigation, methodology. W.M.B. Dunuwille: Formal analysis, validation, investigation, methodology. J. Nacson: Formal analysis, investigation, methodology. M. Hulse: Formal analysis, investigation, methodology. K. Keith: Data curation, software, formal analysis, investigation, visualization. J. Madzo: Data curation, software, formal analysis, visualization, methodology. L.B. Caruso: Investigation, methodology. Z. Gazze: Investigation, methodology. Z. Lian: Investigation. A. Padella: Resources. K.N. Chitrala: Data curation, software, formal analysis, visualization, methodology. B.A. Bartholdy: Data curation, software, visualization, methodology. K. Matlawska-Wasowska: Data curation, Software, Methodology. D. Di Marcantonio: Investigation. G. Simonetti: Resources. G. Greiner: Resources. S.M. Sykes: Supervision. P. Valent: Resources, supervision. E.M. Paietta: Resources. M.S. Tallman: Resources. H.F. Fernandez: Resources. M.R. Litzow: Resources. M.D. Minden: Resources. J. Huang: Supervision. G. Martinelli: Resources. G.S. Vassiliou: Resources. I. Tempera: Supervision. K. Piwocka: Supervision. N. Johnson: Supervision. G.A. Challen: Conceptualization, data curation, formal analysis, supervision, funding acquisition, validation, methodology, writing–review and editing. T. Skorski: Conceptualization, data curation, supervision, funding acquisition, writing–original draft, project administration, writing–review and editing.

This work was funded by the NIH/NCI 1R01CA244044, 1R01CA247707, 2R01CA186238, 1R01CA237286, the Leukemia and Lymphoma Society Translational Research Program award 6565–19, the grant from When Everyone Survives Foundation (to T. Skorski) and by NIH/NIDDK 1R01DK102428 and R01HL147978 (to G.A. Challen). N. Johnson was supported by R01CA214799 and I. Tempera was supported by R01GM124449. This study was conducted in part by the ECOG-ACRIN Cancer Research Group supported by the NCI/NIH U10CA180820, UG1CA189859, UG1CA233290, and UG1CA232760. P. Valent was supported by the Austrian Science Fund (FWF), grants F4701-B20 and F4704-B20. B.V. Le has been supported by the European Union's Horizon 2020 Research and Innovation Program under the Marie Sklodowska-Curie grant agreement no 665735 and by the funding from Polish Ministry of Science and Higher Education funds for the implementation of international projects, 2016–2020 (to K. Piwocka). K. Sullivan-Reed was supported by T32CA009009035–43 from NIH. G.A. Challen is a scholar of the Leukemia and Lymphoma Society. The authors thank Dr. Scott Kauffman (Mayo Clinic, Rochester, MN) for providing AML primary cells, Dr. Ross Levine (Memorial Sloan Kettering Cancer Center, New York, NY) for providing Flt3m/m;Wt1+/− and Flt3m/m;Wt1+/+ bone marrow cells and Dr. Jaroslav Jelinek for assistance in bioinformatics analyses.

The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1.
Scheijen
B
,
Griffin
JD
. 
Tyrosine kinase oncogenes in normal hematopoiesis and hematological disease
.
Oncogene
2002
;
21
:
3314
33
.
2.
Sallmyr
A
,
Fan
J
,
Datta
K
,
Kim
KT
,
Grosu
D
,
Shapiro
P
, et al
Internal tandem duplication of FLT3 (FLT3/ITD) induces increased ROS production, DNA damage, and misrepair: implications for poor prognosis in AML
.
Blood
2008
;
111
:
3173
82
.
3.
Maifrede
S
,
Nieborowska-Skorska
M
,
Sullivan-Reed
K
,
Dasgupta
Y
,
Podszywalow-Bartnicka
P
,
Le
BV
, et al
Tyrosine kinase inhibitor-induced defects in DNA repair sensitize FLT3(ITD)-positive leukemia cells to PARP1 inhibitors
.
Blood
2018
;
132
:
67
77
.
4.
Bolton-Gillespie
E
,
Schemionek
M
,
Klein
HU
,
Flis
S
,
Hoser
G
,
Lange
T
, et al
Genomic instability may originate from imatinib-refractory chronic myeloid leukemia stem cells
.
Blood
2013
;
121
:
4175
83
.
5.
Nieborowska-Skorska
M
,
Kopinski
PK
,
Ray
R
,
Hoser
G
,
Ngaba
D
,
Flis
S
, et al
Rac2-mitochondrial respiratory chain complex III-generated ROS cause genomic instability in chronic myeloid leukemia stem cells and primitive progenitors
.
Blood
2012
;
119
:
4253
63
.
6.
Nieborowska-Skorska
M
,
Maifrede
S
,
Dasgupta
Y
,
Sullivan
K
,
Flis
S
,
Le
BV
, et al
Ruxolitinib-induced defects in DNA repair cause sensitivity to PARP inhibitors in myeloproliferative neoplasms
.
Blood
2017
;
130
:
2848
59
.
7.
Chen
E
,
Ahn
JS
,
Massie
CE
,
Clynes
D
,
Godfrey
AL
,
Li
J
, et al
JAK2V617F promotes replication fork stalling with disease-restricted impairment of the intra-S checkpoint response
.
PNAS
2014
;
111
:
15190
5
.
8.
Mahajan
K
,
Mahajan
NP
. 
Cross talk of tyrosine kinases with the DNA damage signaling pathways
.
Nucleic Acids Res
2015
;
43
:
10588
601
.
9.
Shibata
A
,
Jeggo
PA
. 
DNA double-strand break repair in a cellular context
.
Clin Oncol (R Coll Radiol)
2014
;
26
:
243
9
.
10.
Lord
CJ
,
Tutt
AN
,
Ashworth
A
. 
Synthetic lethality and cancer therapy: lessons learned from the development of PARP inhibitors
.
Annu Rev Med
2015
;
66
:
455
70
.
11.
Nieborowska-Skorska
M
,
Sullivan
K
,
Dasgupta
Y
,
Podszywalow-Bartnicka
P
,
Hoser
G
,
Maifrede
S
, et al
Gene expression and mutation-guided synthetic lethality eradicates proliferating and quiescent leukemia cells
.
J Clin Invest
2017
;
127
:
2392
406
.
12.
Esposito
MT
,
Zhao
L
,
Fung
TK
,
Rane
JK
,
Wilson
A
,
Martin
N
, et al
Synthetic lethal targeting of oncogenic transcription factors in acute leukemia by PARP inhibitors
.
Nat Med
2015
;
21
:
1481
90
.
13.
Chen
LL
,
Lin
HP
,
Zhou
WJ
,
He
CX
,
Zhang
ZY
,
Cheng
ZL
, et al
SNIP1 recruits TET2 to regulate c-MYC target genes and cellular DNA damage response
.
Cell Rep
2018
;
25
:
1485
500
.
14.
Inoue
S
,
Li
WY
,
Tseng
A
,
Beerman
I
,
Elia
AJ
,
Bendall
SC
, et al
Mutant IDH1 downregulates ATM and alters DNA repair and sensitivity to DNA damage independent of TET2
.
Cancer Cell
2016
;
30
:
337
48
.
15.
Sato
H
,
Wheat
JC
,
Steidl
U
,
Ito
K
. 
DNMT3A and TET2 in the pre-leukemic phase of hematopoietic disorders
.
Front Oncol
2016
;
6
:
187
.
16.
Okano
M
,
Bell
DW
,
Haber
DA
,
Li
E
. 
DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development
.
Cell
1999
;
99
:
247
57
.
17.
Koh
KP
,
Yabuuchi
A
,
Rao
S
,
Huang
Y
,
Cunniff
K
,
Nardone
J
, et al
Tet1 and Tet2 regulate 5-hydroxymethylcytosine production and cell lineage specification in mouse embryonic stem cells
.
Cell Stem Cell
2011
;
8
:
200
13
.
18.
Ostrander
EL
,
Kramer
AC
,
Mallaney
C
,
Celik
H
,
Koh
WK
,
Fairchild
J
, et al
Divergent effects of Dnmt3a and Tet2 mutations on hematopoietic progenitor cell fitness
.
Stem cell reports
2020
;
14
:
551
60
.
19.
Morinishi
L
,
Kochanowski
K
,
Levine
RL
,
Wu
LF
,
Altschuler
SJ
. 
Loss of TET2 affects proliferation and drug sensitivity through altered dynamics of cell-state transitions
.
Cell Syst
2020
;
11
:
86
94
.
20.
Guryanova
OA
,
Shank
K
,
Spitzer
B
,
Luciani
L
,
Koche
RP
,
Garrett-Bakelman
FE
, et al
DNMT3A mutations promote anthracycline resistance in acute myeloid leukemia via impaired nucleosome remodeling
.
Nat Med
2016
;
22
:
1488
95
.
21.
Patel
JP
,
Gonen
M
,
Figueroa
ME
,
Fernandez
H
,
Sun
Z
,
Racevskis
J
, et al
Prognostic relevance of integrated genetic profiling in acute myeloid leukemia
.
N Engl J Med
2012
;
366
:
1079
89
.
22.
Kaneda
M
,
Okano
M
,
Hata
K
,
Sado
T
,
Tsujimoto
N
,
Li
E
, et al
Essential role for de novo DNA methyltransferase Dnmt3a in paternal and maternal imprinting
.
Nature
2004
;
429
:
900
3
.
23.
Moran-Crusio
K
,
Reavie
L
,
Shih
A
,
Abdel-Wahab
O
,
Ndiaye-Lobry
D
,
Lobry
C
, et al
Tet2 loss leads to increased hematopoietic stem cell self-renewal and myeloid transformation
.
Cancer Cell
2011
;
20
:
11
24
.
24.
Lee
BH
,
Tothova
Z
,
Levine
RL
,
Anderson
K
,
Buza-Vidas
N
,
Cullen
DE
, et al
FLT3 mutations confer enhanced proliferation and survival properties to multipotent progenitors in a murine model of chronic myelomonocytic leukemia
.
Cancer Cell
2007
;
12
:
367
80
.
25.
Georgiades
P
,
Ogilvy
S
,
Duval
H
,
Licence
DR
,
Charnock-Jones
DS
,
Smith
SK
, et al
VavCre transgenic mice: a tool for mutagenesis in hematopoietic and endothelial lineages
.
Genesis
2002
;
34
:
251
6
.
26.
Pronier
E
,
Bowman
RL
,
Ahn
J
,
Glass
J
,
Kandoth
C
,
Merlinsky
TR
, et al
Genetic and epigenetic evolution as a contributor to WT1-mutant leukemogenesis
.
Blood
2018
;
132
:
1265
78
.
27.
Tadokoro
Y
,
Ema
H
,
Okano
M
,
Li
E
,
Nakauchi
H
. 
De novo DNA methyltransferase is essential for self-renewal, but not for differentiation, in hematopoietic stem cells
.
J Exp Med
2007
;
204
:
715
22
.
28.
Wang
Y
,
Xiao
M
,
Chen
X
,
Chen
L
,
Xu
Y
,
Lv
L
, et al
WT1 recruits TET2 to regulate its target gene expression and suppress leukemia cell proliferation
.
Mol Cell
2015
;
57
:
662
73
.
29.
Cramer-Morales
K
,
Nieborowska-Skorska
M
,
Scheibner
K
,
Padget
M
,
Irvine
DA
,
Sliwinski
T
, et al
Personalized synthetic lethality induced by targeting RAD52 in leukemias identified by gene mutation and expression profile
.
Blood
2013
;
122
:
1293
304
.
30.
Luigi
A
,
Giordano
A
,
Pentimalli
F
. 
DNA fiber assay upon treatment with ultraviolet radiations
.
BioProtoc
2017
;
7
:
e2301
.
31.
Heath
EM
,
Chan
SM
,
Minden
MD
,
Murphy
T
,
Shlush
LI
,
Schimmer
AD
. 
Biological and clinical consequences of NPM1 mutations in AML
.
Leukemia
2017
;
31
:
798
807
.
32.
Kunimoto
H
,
Meydan
C
,
Nazir
A
,
Whitfield
J
,
Shank
K
,
Rapaport
F
, et al
Cooperative epigenetic remodeling by TET2 loss and NRAS mutation drives myeloid transformation and MEK inhibitor sensitivity
.
Cancer Cell
2018
;
33
:
44
59
.
33.
Delhommeau
F
,
Dupont
S
,
Della Valle
V
,
James
C
,
Trannoy
S
,
Masse
A
, et al
Mutation in TET2 in myeloid cancers
.
N Engl J Med
2009
;
360
:
2289
301
.
34.
Li
Z
,
Cai
X
,
Cai
CL
,
Wang
J
,
Zhang
W
,
Petersen
BE
, et al
Deletion of Tet2 in mice leads to dysregulated hematopoietic stem cells and subsequent development of myeloid malignancies
.
Blood
2011
;
118
:
4509
18
.
35.
Xu
W
,
Yang
H
,
Liu
Y
,
Yang
Y
,
Wang
P
,
Kim
SH
, et al
Oncometabolite 2-hydroxyglutarate is a competitive inhibitor of alpha-ketoglutarate-dependent dioxygenases
.
Cancer Cell
2011
;
19
:
17
30
.
36.
Shen
Y
,
Rehman
FL
,
Feng
Y
,
Boshuizen
J
,
Bajrami
I
,
Elliott
R
, et al
BMN 673, a novel and highly potent PARP1/2 inhibitor for the treatment of human cancers with DNA repair deficiency
.
Clin Cancer Res
2013
;
19
:
5003
15
.
37.
Kogan
SC
,
Ward
JM
,
Anver
MR
,
Berman
JJ
,
Brayton
C
,
Cardiff
RD
, et al
Bethesda proposals for classification of nonlymphoid hematopoietic neoplasms in mice
.
Blood
2002
;
100
:
238
45
.
38.
Bonner
WM
,
Redon
CE
,
Dickey
JS
,
Nakamura
AJ
,
Sedelnikova
OA
,
Solier
S
, et al
γH2AX and cancer
.
Nat Rev Cancer
2008
;
8
:
957
67
.
39.
Olive
PL
,
Wlodek
D
,
Banath
JP
. 
DNA double-strand breaks measured in individual cells subjected to gel electrophoresis
.
Cancer Res
1991
;
51
:
4671
6
.
40.
Maya-Mendoza
A
,
Moudry
P
,
Merchut-Maya
JM
,
Lee
M
,
Strauss
R
,
Bartek
J
. 
High speed of fork progression induces DNA replication stress and genomic instability
.
Nature
2018
;
559
:
279
84
.
41.
Ponciano-Gómez
A
,
Martínez-Tovar
A
,
Vela-Ojeda
J
,
Olarte-Carrillo
I
,
Centeno-Cruz
F
,
Garrido
E
. 
Mutations in TET2 and DNMT3A genes are associated with changes in global and gene-specific methylation in acute myeloid leukemia
.
Tumour Biol
2017
;
39
:
1010428317732181
.
42.
Beck
C
,
Robert
I
,
Reina-San-Martin
B
,
Schreiber
V
,
Dantzer
F
, et al
. 
Poly(ADP-ribose) polymerases in double-strand break repair: focus on PARP1, PARP2, and PARP3
.
Exp Cell Res
2014
;
329
:
18
25
.
43.
Langelier
MF
,
Riccio
AA
,
Pascal
JM
. 
PARP-2 and PARP-3 are selectively activated by 5′ phosphorylated DNA breaks through an allosteric regulatory mechanism shared with PARP-1
.
Nucleic Acids Res
2014
;
42
:
7762
75
.
44.
Rampal
R
,
Alkalin
A
,
Madzo
J
,
Vasanthakumar
A
,
Pronier
E
,
Patel
J
, et al
DNA hydroxymethylation profiling reveals that WT1 mutations result in loss of TET2 function in acute myeloid leukemia
.
Cell Rep
2014
;
9
:
1841
55
.
45.
Faraoni
I
,
Giansanti
M
,
Voso
MT
,
Lo-Coco
F
,
Graziani
G
. 
Targeting ADP-ribosylation by PARP inhibitors in acute myeloid leukaemia and related disorders
.
Biochem Pharmacol
2019
;
167
:
133
48
.
46.
Grinfeld
J
,
Nangalia
J
,
Baxter
EJ
,
Wedge
DC
,
Angelopoulos
N
,
Cantrill
R
, et al
Classification and personalized prognosis in myeloproliferative neoplasms
.
N Engl J Med
2018
;
379
:
1416
30
.
47.
Papaemmanuil
E
,
Gerstung
M
,
Bullinger
L
,
Gaidzik
VI
,
Paschka
P
,
Roberts
ND
, et al
Genomic classification and prognosis in acute myeloid leukemia
.
N Engl J Med
2016
;
374
:
2209
21
.
48.
Branford
S
,
Kim
DDH
,
Apperley
JF
,
Eide
CA
,
Mustjoki
S
,
Ong
ST
, et al
Laying the foundation for genomically-based risk assessment in chronic myeloid leukemia
.
Leukemia
2019
;
33
:
1835
50
.
49.
Jing
CB
,
Fu
C
,
Prutsch
N
,
Wang
M
,
He
S
,
Look
AT
. 
Synthetic lethal targeting of TET2-mutant hematopoietic stem and progenitor cells (HSPCs) with TOP1-targeted drugs and PARP1 inhibitors
.
Leukemia
2020
;
34
:
2992
3006
.
50.
Klijn
C
,
Durinck
S
,
Stawiski
EW
,
Haverty
PM
,
Jiang
Z
,
Liu
H
, et al
A comprehensive transcriptional portrait of human cancer cell lines
.
Nat Biotechnol
2015
;
33
:
306
12
.
51.
Abdel-Wahab
O
,
Mullally
A
,
Hedvat
C
,
Garcia-Manero
G
,
Patel
J
,
Wadleigh
M
, et al
Genetic characterization of TET1, TET2, and TET3 alterations in myeloid malignancies
.
Blood
2009
;
114
:
144
7
.
52.
Pan
F
,
Wingo
TS
,
Zhao
Z
,
Gao
R
,
Makishima
H
,
Qu
G
, et al
Tet2 loss leads to hypermutagenicity in haematopoietic stem/progenitor cells
.
Nat Commun
2017
;
8
:
15102
.
53.
Pilzecker
B
,
Jacobs
H
. 
Mutating for good: DNA damage responses during somatic hypermutation
.
Front Immunol
2019
;
10
:
438
.
54.
An
J
,
Gonzalez-Avalos
E
,
Chawla
A
,
Jeong
M
,
Lopez-Moyado
IF
,
Li
W
, et al
Acute loss of TET function results in aggressive myeloid cancer in mice
.
Nat Commun
2015
;
6
:
10071
.
55.
Feng
FY
,
de Bono
JS
,
Rubin
MA
,
Knudsen
KE
. 
Chromatin to clinic: the molecular rationale for PARP1 inhibitor function
.
Mol Cell
2015
;
58
:
925
34
.
56.
Sulkowski
PL
,
Corso
CD
,
Robinson
ND
,
Scanlon
SE
,
Purshouse
KR
,
Bai
H
, et al
2-Hydroxyglutarate produced by neomorphic IDH mutations suppresses homologous recombination and induces PARP inhibitor sensitivity
.
Sci Transl Med
2017
;
9
:
eaal2463
.
57.
Mancini
M
,
Veljkovic
N
,
Leo
E
,
Aluigi
M
,
Borsi
E
,
Galloni
C
, et al
Cytoplasmatic compartmentalization by Bcr-Abl promotes TET2 loss-of-function in chronic myeloid leukemia
.
J Cell Biochem
2012
;
113
:
2765
74
.
58.
Le
BV
,
Podszywalow-Bartnicka
P
,
Maifrede
S
,
Sullivan-Reed
K
,
Nieborowska-Skorska
M
,
Golovine
K
, et al
TGFβR–SMAD3 signaling induces resistance to PARP inhibitors in the bone marrow microenvironment
.
Cell Rep
2020
;
33
:
108221
.
59.
Ding
L
,
Kim
HJ
,
Wang
Q
,
Kearns
M
,
Jiang
T
,
Ohlson
CE
, et al
PARP inhibition elicits STING-dependent antitumor immunity in Brca1-deficient ovarian cancer
.
Cell Rep
2018
;
25
:
2972
80
.